Starting /dee2/code/volunteer_pipeline.sh SRR12897262 current disk space = 1543149424640 free memory = 1603037116 SRR12897262 SRAfilesize 881bb0684498227664920f5a5d4ac1f0 SRR12897262.sra SRR12897262.sra file validated SRR12897262 is single end SRR12897262 is conventional basespace SRR12897262 read1 length is 61-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897262_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66875 37.0 37.0 37.0 37.0 37.0 2 36.6585 37.0 37.0 37.0 37.0 37.0 3 36.7415 37.0 37.0 37.0 37.0 37.0 4 36.7245 37.0 37.0 37.0 37.0 37.0 5 36.7535 37.0 37.0 37.0 37.0 37.0 6 36.706 37.0 37.0 37.0 37.0 37.0 7 36.717 37.0 37.0 37.0 37.0 37.0 8 36.743 37.0 37.0 37.0 37.0 37.0 9 36.7315 37.0 37.0 37.0 37.0 37.0 10-11 36.75975 37.0 37.0 37.0 37.0 37.0 12-13 36.739 37.0 37.0 37.0 37.0 37.0 14-15 36.73675 37.0 37.0 37.0 37.0 37.0 16-17 36.74375 37.0 37.0 37.0 37.0 37.0 18-19 36.74275 37.0 37.0 37.0 37.0 37.0 20-21 36.71875 37.0 37.0 37.0 37.0 37.0 22-23 36.716750000000005 37.0 37.0 37.0 37.0 37.0 24-25 36.730999999999995 37.0 37.0 37.0 37.0 37.0 26-27 36.659 37.0 37.0 37.0 37.0 37.0 28-29 36.694 37.0 37.0 37.0 37.0 37.0 30-31 36.696250000000006 37.0 37.0 37.0 37.0 37.0 32-33 36.726749999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.6845 37.0 37.0 37.0 37.0 37.0 36-37 36.6805 37.0 37.0 37.0 37.0 37.0 38-39 36.71825 37.0 37.0 37.0 37.0 37.0 40-41 36.699749999999995 37.0 37.0 37.0 37.0 37.0 42-43 36.653999999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.663 37.0 37.0 37.0 37.0 37.0 46-47 36.64975 37.0 37.0 37.0 37.0 37.0 48-49 36.65575 37.0 37.0 37.0 37.0 37.0 50-51 36.703 37.0 37.0 37.0 37.0 37.0 52-53 36.68875 37.0 37.0 37.0 37.0 37.0 54-55 36.65875 37.0 37.0 37.0 37.0 37.0 56-57 36.654250000000005 37.0 37.0 37.0 37.0 37.0 58-59 36.605500000000006 37.0 37.0 37.0 37.0 37.0 60-61 36.67175 37.0 37.0 37.0 37.0 37.0 62-63 36.691172793198305 37.0 37.0 37.0 37.0 37.0 64-65 36.68867216804201 37.0 37.0 37.0 37.0 37.0 66-67 36.66591647911978 37.0 37.0 37.0 37.0 37.0 68-69 36.61290322580645 37.0 37.0 37.0 37.0 37.0 70-71 36.605151287821954 37.0 37.0 37.0 37.0 37.0 72-73 36.69222737874226 37.0 37.0 37.0 37.0 37.0 74-75 36.61261261261261 37.0 37.0 37.0 37.0 37.0 76-77 36.688820026034044 37.0 37.0 37.0 37.0 37.0 78-79 36.58420510997014 37.0 37.0 37.0 37.0 37.0 80-81 36.61409529870052 37.0 37.0 37.0 37.0 37.0 82-83 36.67869352598457 37.0 37.0 37.0 37.0 37.0 84-85 36.63982147807678 37.0 37.0 37.0 37.0 37.0 86-87 36.610535568862154 37.0 37.0 37.0 37.0 37.0 88-89 36.60907116852137 37.0 37.0 37.0 37.0 37.0 90-91 36.645456711294415 37.0 37.0 37.0 37.0 37.0 92-93 36.612464643420196 37.0 37.0 37.0 37.0 37.0 94-95 36.59672410873614 37.0 37.0 37.0 37.0 37.0 96-97 36.54168446836994 37.0 37.0 37.0 37.0 37.0 98-99 36.61332115697283 37.0 37.0 37.0 37.0 37.0 100-101 36.50322910590677 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 2.0 27 3.0 28 8.0 29 9.0 30 7.0 31 13.0 32 12.0 33 36.0 34 46.0 35 103.0 36 2103.0 37 1656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.270452839629723 9.757317988491367 5.8293720290217665 57.14285714285714 2 18.2 13.525 40.050000000000004 28.225 3 18.45 14.625 25.35 41.575 4 24.325 23.175 21.2 31.3 5 26.224999999999998 28.199999999999996 23.225 22.35 6 21.3 31.05 24.175 23.474999999999998 7 16.525000000000002 24.6 40.300000000000004 18.575 8 18.725 23.3 31.324999999999996 26.650000000000002 9 18.65 20.45 36.275 24.625 10-11 22.8375 29.675 23.775 23.7125 12-13 22.55 22.9875 27.8125 26.650000000000002 14-15 20.875 25.412499999999998 27.287499999999998 26.424999999999997 16-17 22.3625 25.637500000000003 26.0 26.0 18-19 22.925 25.35 25.674999999999997 26.05 20-21 22.4375 25.35 26.075 26.137500000000003 22-23 22.5875 26.3625 26.0625 24.9875 24-25 22.125 25.637500000000003 25.2625 26.974999999999998 26-27 22.575 26.2125 26.625 24.587500000000002 28-29 22.9625 26.35 25.587500000000002 25.1 30-31 21.5375 25.275 26.5625 26.625 32-33 22.125 25.374999999999996 26.5625 25.937500000000004 34-35 22.6875 25.35 26.125 25.837500000000002 36-37 22.3 25.15 26.4625 26.087500000000002 38-39 22.400000000000002 25.775 25.874999999999996 25.95 40-41 22.775000000000002 25.7875 25.05 26.387500000000003 42-43 23.0875 25.474999999999998 25.424999999999997 26.0125 44-45 21.9 25.6 26.450000000000003 26.05 46-47 22.5125 26.075 25.3125 26.1 48-49 22.400000000000002 25.8125 25.337500000000002 26.450000000000003 50-51 22.3375 24.887500000000003 26.150000000000002 26.625 52-53 23.275000000000002 25.825 25.2125 25.687500000000004 54-55 22.8 25.674999999999997 26.075 25.45 56-57 22.8625 25.124999999999996 26.275 25.7375 58-59 22.775000000000002 25.6125 25.8125 25.8 60-61 23.4375 25.387500000000003 25.2625 25.912499999999998 62-63 22.468117029257314 26.106526631657918 25.85646411602901 25.568892223055762 64-65 22.693173293323333 25.84396099024756 25.71892973243311 25.743935983995996 66-67 21.605401350337583 25.406351587896975 26.406601650412604 26.581645411352838 68-69 22.968242060515127 24.843710927731934 26.756689172293076 25.431357839459867 70-71 22.99324831207802 24.518629657414355 26.85671417854464 25.63140785196299 72-73 23.795821343675716 24.32128112098086 25.234580257725508 26.648317277617917 74-75 23.385885885885884 25.462962962962965 26.7017017017017 24.44944944944945 76-77 23.832770058830892 25.334835398673178 25.67280010013769 25.15959444235824 78-79 22.60488415779587 24.896681277395118 26.712586098935503 25.785848465873514 80-81 22.744950445364445 24.338226069501946 27.47459540835529 25.442228076778324 82-83 23.58265241986172 25.267127592708988 25.769956002514142 25.380263984915146 84-85 23.634533098414295 25.119557009816262 24.993707525799145 26.2522023659703 86-87 23.025569971029096 26.300541629928205 26.01083259856405 24.663055800478652 88-89 23.446969696969695 25.227272727272727 26.48989898989899 24.835858585858585 90-91 23.839048462609135 24.610907250411238 24.813362014424904 26.736682272554724 92-93 23.512244639005203 24.565410480903438 26.100748635959903 25.821596244131456 94-95 23.006252392497128 25.16268980477224 26.272808472629833 25.5582493301008 96-97 23.610219540377457 25.227885479522406 25.240724098087046 25.921170882013094 98-99 23.461487993701613 24.261907886104186 26.217031885579324 26.05957223461488 100-101 23.32727573104246 11.56451346439782 32.678010903684125 32.4301999008756 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.0 29 4.5 30 8.5 31 13.0 32 10.5 33 14.5 34 27.0 35 35.0 36 43.5 37 58.0 38 73.5 39 90.5 40 123.0 41 148.0 42 172.0 43 212.5 44 209.5 45 183.0 46 191.5 47 212.5 48 201.0 49 191.5 50 186.0 51 174.0 52 155.5 53 127.0 54 128.5 55 124.5 56 101.5 57 96.0 58 91.5 59 77.0 60 76.5 61 76.0 62 63.5 63 54.0 64 51.5 65 47.0 66 42.5 67 32.5 68 25.0 69 19.5 70 14.5 71 11.0 72 7.0 73 5.5 74 3.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 2.0 72 1.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 3.0 79 3.0 80 5.0 81 5.0 82 1.0 83 3.0 84 2.0 85 1.0 86 3.0 87 6.0 88 4.0 89 5.0 90 3.0 91 5.0 92 9.0 93 11.0 94 13.0 95 11.0 96 13.0 97 31.0 98 93.0 99 290.0 100 895.0 101 2579.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.82029598308668 89.7 2 4.651162790697675 8.799999999999999 3 0.5285412262156448 1.5 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893982 READS because READLEN < 1 Read 893982 spots for SRR12897262.sra Written 893982 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra Rejected 893973 READS because READLEN < 1 Read 893973 spots for SRR12897262.sra Written 893973 spots for SRR12897262.sra SRR ids: ['SRR12897262.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_la02j_sl SRR12897262.sra spots: 17879469 blocks: [[1, 893973], [893974, 1787946], [1787947, 2681919], [2681920, 3575892], [3575893, 4469865], [4469866, 5363838], [5363839, 6257811], [6257812, 7151784], [7151785, 8045757], [8045758, 8939730], [8939731, 9833703], [9833704, 10727676], [10727677, 11621649], [11621650, 12515622], [12515623, 13409595], [13409596, 14303568], [14303569, 15197541], [15197542, 16091514], [16091515, 16985487], [16985488, 17879469]] SRR12897262 file size 4277690 SRR12897262 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897262 SRR12897262_1.fastq Input file: SRR12897262_1.fastq trimmed: SRR12897262-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:28:26 2024 >> started Sat Dec 7 12:28:35 2024 >> done (8.830s) 17879469 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 1645 ( 0.01%) empty reads filtered out after trimming by size control 17877817 (99.99%) reads available; of these: 289 ( 0.00%) trimmed reads available after processing 17877528 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 45 0.00% 36 46 0.00% 37 61 0.00% 38 75 0.00% 39 89 0.00% 40 77 0.00% 41 89 0.00% 42 120 0.00% 43 145 0.00% 44 129 0.00% 45 159 0.00% 46 149 0.00% 47 184 0.00% 48 223 0.00% 49 287 0.00% 50 338 0.00% 51 353 0.00% 52 397 0.00% 53 409 0.00% 54 444 0.00% 55 454 0.00% 56 517 0.00% 57 609 0.00% 58 787 0.00% 59 883 0.00% 60 1012 0.01% 61 1148 0.01% 62 1172 0.01% 63 1390 0.01% 64 1543 0.01% 65 1721 0.01% 66 1834 0.01% 67 2048 0.01% 68 2240 0.01% 69 2582 0.01% 70 2965 0.02% 71 3382 0.02% 72 3808 0.02% 73 4265 0.02% 74 4844 0.03% 75 5556 0.03% 76 6058 0.03% 77 6520 0.04% 78 7320 0.04% 79 8067 0.05% 80 8778 0.05% 81 9887 0.06% 82 11253 0.06% 83 12587 0.07% 84 13926 0.08% 85 15834 0.09% 86 17316 0.10% 87 18958 0.11% 88 20335 0.11% 89 21623 0.12% 90 23836 0.13% 91 26032 0.15% 92 27560 0.15% 93 30418 0.17% 94 34598 0.19% 95 39330 0.22% 96 62516 0.35% 97 122910 0.69% 98 367285 2.05% 99 1206682 6.75% 100 4173174 23.34% 101 11536425 64.53% 17877817 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=370.96 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=34.0 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:28:55 Started mapping on | Dec 07 12:28:55 Finished on | Dec 07 12:29:13 Mapping speed, Million of reads per hour | 3575.56 Number of input reads | 17877817 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17298269 Uniquely mapped reads % | 96.76% Average mapped length | 99.97 Number of splices: Total | 6163511 Number of splices: Annotated (sjdb) | 5816061 Number of splices: GT/AG | 6074382 Number of splices: GC/AG | 76628 Number of splices: AT/AC | 3359 Number of splices: Non-canonical | 9142 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332127 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 143730 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 247421 247421 247421 N_multimapping 332127 332127 332127 N_noFeature 825847 16885994 964382 N_ambiguous 311731 1249 39137 UnstrandedReadsAssigned:16160691 PositiveStrandReadsAssigned:411026 NegativeStrandReadsAssigned:16294750 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897262 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897262-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,877,817 reads, 16,466,704 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR12897262.ke.tsv 35125 SRR12897262.se.tsv 88098 total ==> SRR12897262.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 169.731 21.7226 PNS24247 1044 945 56.6773 6.42471 PNS24249 1928 1829 42.2266 2.47314 PNS24246 1044 945 56.6773 6.42471 PNS24248 1044 945 56.6773 6.42471 PNS24244 1471 1372 153.011 11.9466 PNS24243 293 194 0 0 KQK14069 1603 1504 5036.16 358.697 KQK14071 474 375 329.985 94.2623 ==> SRR12897262.se.tsv <== BRADI_1g14170v3 6043 BRADI_1g53295v3 243 BRADI_1g59795v3 511 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1215 BRADI_1g74790v3 282 BRADI_1g09890v3 0 BRADI_1g77505v3 376 BRADI_1g48960v3 0 SRR12897262 completed mapping pipeline successfully