Starting /dee2/code/volunteer_pipeline.sh SRR12897263 current disk space = 1543156711424 free memory = 1606491928 SRR12897263 SRAfilesize 1a4f4287b82aa8ef6c3e3c5a1dc05e1a SRR12897263.sra SRR12897263.sra file validated SRR12897263 is single end SRR12897263 is conventional basespace SRR12897263 read1 length is 61-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897263_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6505 37.0 37.0 37.0 37.0 37.0 2 36.666 37.0 37.0 37.0 37.0 37.0 3 36.676 37.0 37.0 37.0 37.0 37.0 4 36.732 37.0 37.0 37.0 37.0 37.0 5 36.814 37.0 37.0 37.0 37.0 37.0 6 36.719 37.0 37.0 37.0 37.0 37.0 7 36.725 37.0 37.0 37.0 37.0 37.0 8 36.6805 37.0 37.0 37.0 37.0 37.0 9 36.7115 37.0 37.0 37.0 37.0 37.0 10-11 36.76975 37.0 37.0 37.0 37.0 37.0 12-13 36.76475 37.0 37.0 37.0 37.0 37.0 14-15 36.7315 37.0 37.0 37.0 37.0 37.0 16-17 36.7915 37.0 37.0 37.0 37.0 37.0 18-19 36.77975 37.0 37.0 37.0 37.0 37.0 20-21 36.7695 37.0 37.0 37.0 37.0 37.0 22-23 36.73925 37.0 37.0 37.0 37.0 37.0 24-25 36.726749999999996 37.0 37.0 37.0 37.0 37.0 26-27 36.670500000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.7555 37.0 37.0 37.0 37.0 37.0 30-31 36.7115 37.0 37.0 37.0 37.0 37.0 32-33 36.664500000000004 37.0 37.0 37.0 37.0 37.0 34-35 36.672 37.0 37.0 37.0 37.0 37.0 36-37 36.70475 37.0 37.0 37.0 37.0 37.0 38-39 36.717 37.0 37.0 37.0 37.0 37.0 40-41 36.634 37.0 37.0 37.0 37.0 37.0 42-43 36.673 37.0 37.0 37.0 37.0 37.0 44-45 36.675 37.0 37.0 37.0 37.0 37.0 46-47 36.65975 37.0 37.0 37.0 37.0 37.0 48-49 36.72925 37.0 37.0 37.0 37.0 37.0 50-51 36.711 37.0 37.0 37.0 37.0 37.0 52-53 36.697500000000005 37.0 37.0 37.0 37.0 37.0 54-55 36.69375 37.0 37.0 37.0 37.0 37.0 56-57 36.66075 37.0 37.0 37.0 37.0 37.0 58-59 36.620999999999995 37.0 37.0 37.0 37.0 37.0 60-61 36.732 37.0 37.0 37.0 37.0 37.0 62-63 36.69342335583896 37.0 37.0 37.0 37.0 37.0 64-65 36.66033016508254 37.0 37.0 37.0 37.0 37.0 66-67 36.644776165916326 37.0 37.0 37.0 37.0 37.0 68-69 36.64473355016263 37.0 37.0 37.0 37.0 37.0 70-71 36.668211243517725 37.0 37.0 37.0 37.0 37.0 72-73 36.65628116768394 37.0 37.0 37.0 37.0 37.0 74-75 36.66791833541896 37.0 37.0 37.0 37.0 37.0 76-77 36.66813065504071 37.0 37.0 37.0 37.0 37.0 78-79 36.61389445347826 37.0 37.0 37.0 37.0 37.0 80-81 36.59366759304062 37.0 37.0 37.0 37.0 37.0 82-83 36.66693424430035 37.0 37.0 37.0 37.0 37.0 84-85 36.66447262896729 37.0 37.0 37.0 37.0 37.0 86-87 36.63306752695492 37.0 37.0 37.0 37.0 37.0 88-89 36.627550792373796 37.0 37.0 37.0 37.0 37.0 90-91 36.591141457531904 37.0 37.0 37.0 37.0 37.0 92-93 36.64158134154761 37.0 37.0 37.0 37.0 37.0 94-95 36.64599112586846 37.0 37.0 37.0 37.0 37.0 96-97 36.599633424810875 37.0 37.0 37.0 37.0 37.0 98-99 36.61448859406227 37.0 37.0 37.0 37.0 37.0 100-101 36.574061940331106 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 5.0 28 4.0 29 4.0 30 11.0 31 22.0 32 12.0 33 29.0 34 42.0 35 87.0 36 2110.0 37 1671.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.6408204102051 10.130065032516258 4.702351175587794 53.52676338169084 2 17.724999999999998 12.950000000000001 40.825 28.499999999999996 3 18.3 13.65 25.25 42.8 4 24.474999999999998 23.025000000000002 21.875 30.625000000000004 5 24.75 27.625 25.575 22.05 6 23.625 29.65 22.225 24.5 7 18.45 23.25 39.925 18.375 8 18.575 23.775 32.525 25.124999999999996 9 20.599999999999998 20.549999999999997 34.599999999999994 24.25 10-11 23.3875 29.45 23.799999999999997 23.3625 12-13 22.287499999999998 23.45 27.3625 26.900000000000002 14-15 22.05 24.525 27.125 26.3 16-17 22.7 24.087500000000002 26.200000000000003 27.0125 18-19 22.5625 24.825 25.900000000000002 26.7125 20-21 22.175 25.275 26.3125 26.237500000000004 22-23 22.875 26.200000000000003 25.7875 25.137500000000003 24-25 22.6375 24.8625 25.15 27.35 26-27 22.3375 24.7 26.75 26.2125 28-29 23.0875 25.2375 25.900000000000002 25.775 30-31 22.975 25.374999999999996 25.162499999999998 26.487500000000004 32-33 22.6125 25.5 26.2125 25.674999999999997 34-35 22.787499999999998 25.025 26.687499999999996 25.5 36-37 23.4375 24.837500000000002 25.25 26.474999999999998 38-39 22.6375 25.4 25.837500000000002 26.125 40-41 23.625 25.1875 26.25 24.9375 42-43 23.575 24.349999999999998 25.9875 26.087500000000002 44-45 22.5 26.0125 26.4125 25.074999999999996 46-47 23.775 25.7625 25.637500000000003 24.825 48-49 23.4875 24.6 25.624999999999996 26.2875 50-51 22.5125 26.0625 24.825 26.6 52-53 23.150000000000002 26.5875 25.6125 24.65 54-55 23.5125 25.05 25.724999999999998 25.7125 56-57 22.725 26.5125 26.025 24.7375 58-59 22.525000000000002 26.05 26.125 25.3 60-61 22.9875 25.174999999999997 25.0375 26.8 62-63 23.055763940985248 25.881470367591895 25.731432858214554 25.331332833208304 64-65 23.13656828414207 26.138069034517258 25.200100050025014 25.52526263131566 66-67 22.301438398999373 26.153846153846157 25.59099437148218 25.95372107567229 68-69 23.2424318238679 25.143857893420062 25.444083062296723 26.169627220415308 70-71 23.52058050794445 25.70999624671588 25.84761666458151 24.92180658075816 72-73 23.532356990862436 24.83414695205908 25.134560020027536 26.498936037050946 74-75 22.301527673428502 25.05634861006762 26.859504132231404 25.782619584272474 76-77 24.088231607970922 24.902870033838827 25.404185988219076 25.60471236997117 78-79 23.46746897329823 25.159834524257242 25.59859596339476 25.774100539049766 80-81 23.026728573221234 25.674488643493536 25.27293261387878 26.02585016940645 82-83 24.50389349409696 25.38306958050741 24.453654860587793 25.65938206480784 84-85 23.274559193954662 25.35264483627204 24.87405541561713 26.498740554156168 86-87 22.86435331230284 25.274447949526813 25.690851735015773 26.170347003154575 88-89 23.790271636133923 25.5085281111813 25.003158559696782 25.698041692988 90-91 23.27848101265823 25.44303797468355 24.962025316455698 26.316455696202535 92-93 23.44206117527605 25.015864957481917 26.043914202309935 25.498159664932096 94-95 23.774353750159175 24.474723035782503 25.76085572392716 25.990067490131157 96-97 22.902523376457026 25.220955552709107 25.47713590367619 26.39938516715768 98-99 23.59858878871031 23.45485430550111 27.03514961453025 25.91140729125833 100-101 24.906275468622656 11.475142624286878 30.888345558272206 32.73023634881825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 2.0 29 3.0 30 6.5 31 8.5 32 12.5 33 19.0 34 21.0 35 25.0 36 31.0 37 50.5 38 80.5 39 108.5 40 131.5 41 143.0 42 155.5 43 183.5 44 202.5 45 197.0 46 191.5 47 188.5 48 192.0 49 191.0 50 180.0 51 173.0 52 149.0 53 141.0 54 142.5 55 122.5 56 111.5 57 106.0 58 93.5 59 86.0 60 86.0 61 75.5 62 67.0 63 64.0 64 54.0 65 43.5 66 36.5 67 32.5 68 32.5 69 21.5 70 14.0 71 14.0 72 8.5 73 7.0 74 5.0 75 2.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 1.0 71 1.0 72 1.0 73 0.0 74 2.0 75 2.0 76 1.0 77 0.0 78 1.0 79 2.0 80 3.0 81 1.0 82 2.0 83 8.0 84 4.0 85 4.0 86 3.0 87 1.0 88 5.0 89 4.0 90 2.0 91 8.0 92 3.0 93 9.0 94 5.0 95 13.0 96 15.0 97 31.0 98 77.0 99 266.0 100 909.0 101 2613.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.42231075697211 88.875 2 4.9933598937583 9.4 3 0.5046480743691899 1.425 4 0.0796812749003984 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0125 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912163 READS because READLEN < 1 Read 912163 spots for SRR12897263.sra Written 912163 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra Rejected 912153 READS because READLEN < 1 Read 912153 spots for SRR12897263.sra Written 912153 spots for SRR12897263.sra SRR ids: ['SRR12897263.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yhkhratp SRR12897263.sra spots: 18243070 blocks: [[1, 912153], [912154, 1824306], [1824307, 2736459], [2736460, 3648612], [3648613, 4560765], [4560766, 5472918], [5472919, 6385071], [6385072, 7297224], [7297225, 8209377], [8209378, 9121530], [9121531, 10033683], [10033684, 10945836], [10945837, 11857989], [11857990, 12770142], [12770143, 13682295], [13682296, 14594448], [14594449, 15506601], [15506602, 16418754], [16418755, 17330907], [17330908, 18243070]] SRR12897263 file size 4362902 SRR12897263 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897263 SRR12897263_1.fastq Input file: SRR12897263_1.fastq trimmed: SRR12897263-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:28:42 2024 >> started Sat Dec 7 12:28:51 2024 >> done (8.633s) 18243070 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 2478 ( 0.01%) empty reads filtered out after trimming by size control 18240584 (99.99%) reads available; of these: 441 ( 0.00%) trimmed reads available after processing 18240143 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 2 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 4 0.00% 29 0 0.00% 30 2 0.00% 31 2 0.00% 32 5 0.00% 33 0 0.00% 34 1 0.00% 35 57 0.00% 36 77 0.00% 37 90 0.00% 38 94 0.00% 39 100 0.00% 40 127 0.00% 41 129 0.00% 42 140 0.00% 43 131 0.00% 44 142 0.00% 45 165 0.00% 46 178 0.00% 47 208 0.00% 48 270 0.00% 49 354 0.00% 50 377 0.00% 51 430 0.00% 52 485 0.00% 53 501 0.00% 54 510 0.00% 55 606 0.00% 56 659 0.00% 57 772 0.00% 58 966 0.01% 59 1061 0.01% 60 1301 0.01% 61 1465 0.01% 62 1697 0.01% 63 1835 0.01% 64 1833 0.01% 65 2109 0.01% 66 2214 0.01% 67 2432 0.01% 68 2752 0.02% 69 3218 0.02% 70 3650 0.02% 71 4145 0.02% 72 4680 0.03% 73 5319 0.03% 74 5830 0.03% 75 6481 0.04% 76 7075 0.04% 77 7773 0.04% 78 8787 0.05% 79 9683 0.05% 80 10715 0.06% 81 11912 0.07% 82 13670 0.07% 83 14845 0.08% 84 16702 0.09% 85 18507 0.10% 86 20644 0.11% 87 21914 0.12% 88 24446 0.13% 89 26368 0.14% 90 28484 0.16% 91 31465 0.17% 92 32910 0.18% 93 36211 0.20% 94 40037 0.22% 95 46191 0.25% 96 68477 0.38% 97 126818 0.70% 98 376527 2.06% 99 1225673 6.72% 100 4200900 23.03% 101 11754242 64.44% 18240584 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=2.2 sequence=AGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=90.28 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.8 sequence=CGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG Started job on | Dec 07 12:29:04 Started mapping on | Dec 07 12:29:05 Finished on | Dec 07 12:29:22 Mapping speed, Million of reads per hour | 3862.71 Number of input reads | 18240584 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17724312 Uniquely mapped reads % | 97.17% Average mapped length | 99.91 Number of splices: Total | 6264940 Number of splices: Annotated (sjdb) | 5929153 Number of splices: GT/AG | 6177868 Number of splices: GC/AG | 75401 Number of splices: AT/AC | 2832 Number of splices: Non-canonical | 8839 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307591 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 119243 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 208681 208681 208681 N_multimapping 307591 307591 307591 N_noFeature 725451 17319725 853073 N_ambiguous 313527 1342 37820 UnstrandedReadsAssigned:16685334 PositiveStrandReadsAssigned:403245 NegativeStrandReadsAssigned:16833419 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897263 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897263-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,240,584 reads, 16,963,286 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR12897263.ke.tsv 35125 SRR12897263.se.tsv 88098 total ==> SRR12897263.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 137.305 16.8367 PNS24247 1044 945 20.1857 2.19235 PNS24249 1928 1829 3.87606 0.217508 PNS24246 1044 945 20.1857 2.19235 PNS24248 1044 945 20.1857 2.19235 PNS24244 1471 1372 92.2623 6.90189 PNS24243 293 194 0 0 KQK14069 1603 1504 1182.31 80.6827 KQK14071 474 375 171.045 46.8141 ==> SRR12897263.se.tsv <== BRADI_1g14170v3 1664 BRADI_1g53295v3 120 BRADI_1g59795v3 330 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 1739 BRADI_1g74790v3 191 BRADI_1g09890v3 4 BRADI_1g77505v3 249 BRADI_1g48960v3 0 SRR12897263 completed mapping pipeline successfully