Starting /dee2/code/volunteer_pipeline.sh SRR12897264 current disk space = 1543139540992 free memory = 1601871588 SRR12897264 SRAfilesize e6260ffd76ca36efa0642ae3bd051f09 SRR12897264.sra SRR12897264.sra file validated SRR12897264 is single end SRR12897264 is conventional basespace SRR12897264 read1 length is 60-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897264_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 60-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.67275 37.0 37.0 37.0 37.0 37.0 2 36.647 37.0 37.0 37.0 37.0 37.0 3 36.732 37.0 37.0 37.0 37.0 37.0 4 36.7205 37.0 37.0 37.0 37.0 37.0 5 36.728 37.0 37.0 37.0 37.0 37.0 6 36.7495 37.0 37.0 37.0 37.0 37.0 7 36.711 37.0 37.0 37.0 37.0 37.0 8 36.7165 37.0 37.0 37.0 37.0 37.0 9 36.6915 37.0 37.0 37.0 37.0 37.0 10-11 36.740750000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.7525 37.0 37.0 37.0 37.0 37.0 14-15 36.77025 37.0 37.0 37.0 37.0 37.0 16-17 36.77975 37.0 37.0 37.0 37.0 37.0 18-19 36.729749999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.7425 37.0 37.0 37.0 37.0 37.0 22-23 36.734 37.0 37.0 37.0 37.0 37.0 24-25 36.7055 37.0 37.0 37.0 37.0 37.0 26-27 36.678250000000006 37.0 37.0 37.0 37.0 37.0 28-29 36.6935 37.0 37.0 37.0 37.0 37.0 30-31 36.6915 37.0 37.0 37.0 37.0 37.0 32-33 36.6525 37.0 37.0 37.0 37.0 37.0 34-35 36.670249999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.682 37.0 37.0 37.0 37.0 37.0 38-39 36.65325 37.0 37.0 37.0 37.0 37.0 40-41 36.68375 37.0 37.0 37.0 37.0 37.0 42-43 36.62625 37.0 37.0 37.0 37.0 37.0 44-45 36.6525 37.0 37.0 37.0 37.0 37.0 46-47 36.62875 37.0 37.0 37.0 37.0 37.0 48-49 36.66075 37.0 37.0 37.0 37.0 37.0 50-51 36.652249999999995 37.0 37.0 37.0 37.0 37.0 52-53 36.6215 37.0 37.0 37.0 37.0 37.0 54-55 36.54925 37.0 37.0 37.0 37.0 37.0 56-57 36.67075 37.0 37.0 37.0 37.0 37.0 58-59 36.59775 37.0 37.0 37.0 37.0 37.0 60-61 36.649200737684424 37.0 37.0 37.0 37.0 37.0 62-63 36.60115028757189 37.0 37.0 37.0 37.0 37.0 64-65 36.620405101275324 37.0 37.0 37.0 37.0 37.0 66-67 36.63611137902035 37.0 37.0 37.0 37.0 37.0 68-69 36.58974708770447 37.0 37.0 37.0 37.0 37.0 70-71 36.58043532649487 37.0 37.0 37.0 37.0 37.0 72-73 36.624374374374376 37.0 37.0 37.0 37.0 37.0 74-75 36.57872340425532 37.0 37.0 37.0 37.0 37.0 76-77 36.594741511573105 37.0 37.0 37.0 37.0 37.0 78-79 36.58927097247002 37.0 37.0 37.0 37.0 37.0 80-81 36.56868765505966 37.0 37.0 37.0 37.0 37.0 82-83 36.61380789248328 37.0 37.0 37.0 37.0 37.0 84-85 36.61707346205233 37.0 37.0 37.0 37.0 37.0 86-87 36.58689586218439 37.0 37.0 37.0 37.0 37.0 88-89 36.59254518122557 37.0 37.0 37.0 37.0 37.0 90-91 36.552652632213835 37.0 37.0 37.0 37.0 37.0 92-93 36.59116815027523 37.0 37.0 37.0 37.0 37.0 94-95 36.59521568296875 37.0 37.0 37.0 37.0 37.0 96-97 36.52599509835885 37.0 37.0 37.0 37.0 37.0 98-99 36.59470535941124 37.0 37.0 37.0 37.0 37.0 100-101 36.5221003062636 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 0.0 27 6.0 28 7.0 29 9.0 30 17.0 31 9.0 32 16.0 33 28.0 34 59.0 35 105.0 36 2079.0 37 1661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.83395848962241 11.252813203300825 4.026006501625407 48.88722180545136 2 19.175 11.75 39.925 29.15 3 17.05 16.275000000000002 25.724999999999998 40.949999999999996 4 23.775 24.25 22.400000000000002 29.575000000000003 5 25.0 28.599999999999998 25.074999999999996 21.325 6 22.55 31.7 23.175 22.575 7 17.45 23.150000000000002 41.125 18.275 8 19.05 22.825 32.074999999999996 26.05 9 19.225 20.175 35.0 25.6 10-11 22.3375 29.875 24.575 23.2125 12-13 22.6 24.962500000000002 25.674999999999997 26.7625 14-15 21.75 26.387500000000003 26.375 25.4875 16-17 22.85 25.05 26.5375 25.5625 18-19 22.400000000000002 26.087500000000002 25.162499999999998 26.35 20-21 23.3875 25.324999999999996 25.362499999999997 25.924999999999997 22-23 22.237499999999997 26.2125 26.4125 25.137500000000003 24-25 22.0 24.825 26.987499999999997 26.187500000000004 26-27 23.0375 24.525 26.6125 25.825 28-29 22.675 26.25 26.687499999999996 24.3875 30-31 21.825 25.4375 25.45 27.287499999999998 32-33 22.75 26.0 26.0 25.25 34-35 22.787499999999998 25.424999999999997 25.8125 25.974999999999998 36-37 23.1625 25.8 25.387500000000003 25.650000000000002 38-39 21.3875 25.9625 26.974999999999998 25.674999999999997 40-41 23.0375 26.187500000000004 25.874999999999996 24.9 42-43 23.35 25.3 26.0375 25.3125 44-45 22.725 25.362499999999997 26.887499999999996 25.025 46-47 23.7 26.650000000000002 25.8 23.849999999999998 48-49 22.8125 25.8 25.5125 25.874999999999996 50-51 22.650000000000002 25.662499999999998 25.4 26.2875 52-53 23.275000000000002 26.125 25.6125 24.9875 54-55 23.1875 25.6 25.387500000000003 25.825 56-57 22.475 25.7375 25.8625 25.924999999999997 58-59 21.775 26.0375 26.825 25.362499999999997 60-61 23.177897237154642 24.74059257407176 26.015751968996128 26.065758219777475 62-63 22.630657664416105 25.418854713678417 25.743935983995996 26.206551637909474 64-65 23.055763940985248 25.831457864466117 26.04401100275069 25.068767191797946 66-67 23.071151681880707 24.934350381393024 26.08478179317244 25.909716143553833 68-69 22.263914946841776 25.791119449656037 26.216385240775487 25.728580362726706 70-71 22.516887665749312 25.756817613209908 25.356517388041034 26.36977733299975 72-73 22.7977977977978 25.33783783783784 25.538038038038035 26.326326326326328 74-75 22.853566958698373 25.944931163954944 25.669586983729666 25.53191489361702 76-77 22.60488415779587 26.537257357545396 25.660613650594865 25.19724483406387 78-79 23.25523117403834 25.698534018293444 25.147224658564088 25.899010149104125 80-81 22.19294944172626 26.14477480868147 26.809685108518376 24.852590641073892 82-83 22.53609541745135 25.963590709353422 26.101694915254235 25.398618957940993 84-85 23.354271356783922 25.56532663316583 25.452261306532662 25.628140703517587 86-87 22.040508240030192 25.562963894829537 26.33035601962511 26.066171845515157 88-89 23.134140191628845 25.51689359556228 25.630358043368634 25.718608169440245 90-91 23.140182186234817 25.40485829959514 25.278340080971663 26.17661943319838 92-93 22.626159908478456 25.880259311046146 26.757340790644463 24.73623998983094 94-95 23.565416985462893 25.580209130323894 25.146646263708238 25.707727620504972 96-97 23.097651738739895 25.651225458745024 25.625561401257542 25.625561401257542 98-99 22.881466928618206 24.426981008513422 26.35232481990832 26.33922724296005 100-101 23.820445609436437 11.66448230668414 33.01114023591088 31.50393184796855 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 3.0 28 4.5 29 3.0 30 3.0 31 7.5 32 8.5 33 14.5 34 31.5 35 39.0 36 44.0 37 64.0 38 81.0 39 97.0 40 137.0 41 163.0 42 175.5 43 204.0 44 205.5 45 202.0 46 211.0 47 198.5 48 187.5 49 183.5 50 178.5 51 167.5 52 166.0 53 145.5 54 112.5 55 109.5 56 105.0 57 92.5 58 82.5 59 79.0 60 77.0 61 75.5 62 75.0 63 65.5 64 47.0 65 35.5 66 36.0 67 33.5 68 23.5 69 16.5 70 11.0 71 6.5 72 4.5 73 3.0 74 3.0 75 2.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 0.0 70 0.0 71 1.0 72 0.0 73 1.0 74 0.0 75 2.0 76 1.0 77 1.0 78 1.0 79 3.0 80 3.0 81 1.0 82 1.0 83 0.0 84 4.0 85 1.0 86 5.0 87 5.0 88 2.0 89 8.0 90 10.0 91 10.0 92 7.0 93 6.0 94 6.0 95 15.0 96 13.0 97 29.0 98 87.0 99 284.0 100 876.0 101 2614.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40318302387269 88.97500000000001 2 5.119363395225464 9.65 3 0.4509283819628647 1.275 4 0.02652519893899204 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009634 READS because READLEN < 1 Read 1009634 spots for SRR12897264.sra Written 1009634 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra Rejected 1009630 READS because READLEN < 1 Read 1009630 spots for SRR12897264.sra Written 1009630 spots for SRR12897264.sra SRR ids: ['SRR12897264.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8qw1roy_ SRR12897264.sra spots: 20192604 blocks: [[1, 1009630], [1009631, 2019260], [2019261, 3028890], [3028891, 4038520], [4038521, 5048150], [5048151, 6057780], [6057781, 7067410], [7067411, 8077040], [8077041, 9086670], [9086671, 10096300], [10096301, 11105930], [11105931, 12115560], [12115561, 13125190], [13125191, 14134820], [14134821, 15144450], [15144451, 16154080], [16154081, 17163710], [17163711, 18173340], [18173341, 19182970], [19182971, 20192604]] SRR12897264 file size 4834200 SRR12897264 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897264 SRR12897264_1.fastq Input file: SRR12897264_1.fastq trimmed: SRR12897264-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:29:44 2024 >> started Sat Dec 7 12:29:53 2024 >> done (9.490s) 20192604 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 2276 ( 0.01%) empty reads filtered out after trimming by size control 20190318 (99.99%) reads available; of these: 446 ( 0.00%) trimmed reads available after processing 20189872 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 39 0.00% 36 58 0.00% 37 65 0.00% 38 106 0.00% 39 87 0.00% 40 131 0.00% 41 97 0.00% 42 95 0.00% 43 122 0.00% 44 118 0.00% 45 162 0.00% 46 176 0.00% 47 217 0.00% 48 262 0.00% 49 300 0.00% 50 376 0.00% 51 415 0.00% 52 450 0.00% 53 471 0.00% 54 458 0.00% 55 592 0.00% 56 630 0.00% 57 757 0.00% 58 881 0.00% 59 988 0.00% 60 1206 0.01% 61 1398 0.01% 62 1472 0.01% 63 1661 0.01% 64 1740 0.01% 65 1828 0.01% 66 2142 0.01% 67 2292 0.01% 68 2572 0.01% 69 2962 0.01% 70 3386 0.02% 71 3704 0.02% 72 4234 0.02% 73 4810 0.02% 74 5296 0.03% 75 5980 0.03% 76 6485 0.03% 77 7224 0.04% 78 7891 0.04% 79 8672 0.04% 80 9710 0.05% 81 11328 0.06% 82 12624 0.06% 83 13788 0.07% 84 15685 0.08% 85 17546 0.09% 86 18975 0.09% 87 20841 0.10% 88 22762 0.11% 89 24162 0.12% 90 26645 0.13% 91 29622 0.15% 92 30615 0.15% 93 34179 0.17% 94 38324 0.19% 95 43521 0.22% 96 69209 0.34% 97 134613 0.67% 98 410144 2.03% 99 1360777 6.74% 100 4703549 23.30% 101 13056679 64.67% 20190318 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=2.2 sequence=AGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=95.48 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.3 sequence=CGGCGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG Started job on | Dec 07 12:30:11 Started mapping on | Dec 07 12:30:12 Finished on | Dec 07 12:30:29 Mapping speed, Million of reads per hour | 4275.60 Number of input reads | 20190318 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19666600 Uniquely mapped reads % | 97.41% Average mapped length | 99.97 Number of splices: Total | 6977981 Number of splices: Annotated (sjdb) | 6609348 Number of splices: GT/AG | 6879684 Number of splices: GC/AG | 85389 Number of splices: AT/AC | 3203 Number of splices: Non-canonical | 9705 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324938 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 95762 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 198780 198780 198780 N_multimapping 324938 324938 324938 N_noFeature 842843 19218772 982311 N_ambiguous 348932 1542 42114 UnstrandedReadsAssigned:18474825 PositiveStrandReadsAssigned:446286 NegativeStrandReadsAssigned:18642175 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897264 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897264-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,190,318 reads, 18,798,829 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52973 SRR12897264.ke.tsv 35125 SRR12897264.se.tsv 88098 total ==> SRR12897264.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 73.1317 8.21797 PNS24247 1044 945 54.8807 5.46226 PNS24249 1928 1829 25.7496 1.32416 PNS24246 1044 945 54.8807 5.46226 PNS24248 1044 945 54.8807 5.46226 PNS24244 1471 1372 136.476 9.35595 PNS24243 293 194 0 0 KQK14069 1603 1504 1504.79 94.1049 KQK14071 474 375 146.022 36.6245 ==> SRR12897264.se.tsv <== BRADI_1g14170v3 2081 BRADI_1g53295v3 131 BRADI_1g59795v3 398 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 1502 BRADI_1g74790v3 230 BRADI_1g09890v3 0 BRADI_1g77505v3 361 BRADI_1g48960v3 0 SRR12897264 completed mapping pipeline successfully