Starting /dee2/code/volunteer_pipeline.sh SRR12897265 current disk space = 1543137001472 free memory = 1598311436 SRR12897265 SRAfilesize ff590cf38f34d752ffaf8d8d58673e7c SRR12897265.sra SRR12897265.sra file validated SRR12897265 is single end SRR12897265 is conventional basespace SRR12897265 read1 length is 61-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897265_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.68225 37.0 37.0 37.0 37.0 37.0 2 36.6445 37.0 37.0 37.0 37.0 37.0 3 36.6745 37.0 37.0 37.0 37.0 37.0 4 36.712 37.0 37.0 37.0 37.0 37.0 5 36.6715 37.0 37.0 37.0 37.0 37.0 6 36.677 37.0 37.0 37.0 37.0 37.0 7 36.694 37.0 37.0 37.0 37.0 37.0 8 36.7275 37.0 37.0 37.0 37.0 37.0 9 36.672 37.0 37.0 37.0 37.0 37.0 10-11 36.7575 37.0 37.0 37.0 37.0 37.0 12-13 36.710499999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.7645 37.0 37.0 37.0 37.0 37.0 16-17 36.7025 37.0 37.0 37.0 37.0 37.0 18-19 36.73125 37.0 37.0 37.0 37.0 37.0 20-21 36.7665 37.0 37.0 37.0 37.0 37.0 22-23 36.66675 37.0 37.0 37.0 37.0 37.0 24-25 36.72175 37.0 37.0 37.0 37.0 37.0 26-27 36.62425 37.0 37.0 37.0 37.0 37.0 28-29 36.6565 37.0 37.0 37.0 37.0 37.0 30-31 36.69625 37.0 37.0 37.0 37.0 37.0 32-33 36.6485 37.0 37.0 37.0 37.0 37.0 34-35 36.67225 37.0 37.0 37.0 37.0 37.0 36-37 36.667 37.0 37.0 37.0 37.0 37.0 38-39 36.64975 37.0 37.0 37.0 37.0 37.0 40-41 36.6535 37.0 37.0 37.0 37.0 37.0 42-43 36.6635 37.0 37.0 37.0 37.0 37.0 44-45 36.658 37.0 37.0 37.0 37.0 37.0 46-47 36.64175 37.0 37.0 37.0 37.0 37.0 48-49 36.69725 37.0 37.0 37.0 37.0 37.0 50-51 36.6285 37.0 37.0 37.0 37.0 37.0 52-53 36.604 37.0 37.0 37.0 37.0 37.0 54-55 36.61425 37.0 37.0 37.0 37.0 37.0 56-57 36.60325 37.0 37.0 37.0 37.0 37.0 58-59 36.59975 37.0 37.0 37.0 37.0 37.0 60-61 36.63175 37.0 37.0 37.0 37.0 37.0 62-63 36.65086769441235 37.0 37.0 37.0 37.0 37.0 64-65 36.65503348371709 37.0 37.0 37.0 37.0 37.0 66-67 36.63305017661797 37.0 37.0 37.0 37.0 37.0 68-69 36.522926584815835 37.0 37.0 37.0 37.0 37.0 70-71 36.584908435541095 37.0 37.0 37.0 37.0 37.0 72-73 36.593131110554026 37.0 37.0 37.0 37.0 37.0 74-75 36.60200352751256 37.0 37.0 37.0 37.0 37.0 76-77 36.56674831019568 37.0 37.0 37.0 37.0 37.0 78-79 36.507286432160804 37.0 37.0 37.0 37.0 37.0 80-81 36.57727286507954 37.0 37.0 37.0 37.0 37.0 82-83 36.599249123330864 37.0 37.0 37.0 37.0 37.0 84-85 36.54314911622904 37.0 37.0 37.0 37.0 37.0 86-87 36.56501927581107 37.0 37.0 37.0 37.0 37.0 88-89 36.60648838116681 37.0 37.0 37.0 37.0 37.0 90-91 36.58606249585556 37.0 37.0 37.0 37.0 37.0 92-93 36.50966040027404 37.0 37.0 37.0 37.0 37.0 94-95 36.56323016167288 37.0 37.0 37.0 37.0 37.0 96-97 36.59771230503516 37.0 37.0 37.0 37.0 37.0 98-99 36.56065379643046 37.0 37.0 37.0 37.0 37.0 100-101 36.48762118393697 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 0.0 26 5.0 27 6.0 28 10.0 29 10.0 30 14.0 31 15.0 32 27.0 33 20.0 34 37.0 35 127.0 36 2035.0 37 1693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.884221055263815 11.40285071267817 4.551137784446111 47.1617904476119 2 19.625 12.3 38.025 30.049999999999997 3 17.0 16.225 26.950000000000003 39.825 4 23.3 23.5 23.599999999999998 29.599999999999998 5 25.5 29.275000000000002 23.400000000000002 21.825 6 23.325000000000003 31.775 23.325000000000003 21.575 7 17.325 24.925 39.775 17.974999999999998 8 18.6 23.9 32.300000000000004 25.2 9 20.825 21.575 34.375 23.225 10-11 21.912499999999998 30.5125 25.3 22.275 12-13 22.2125 23.1625 28.025 26.6 14-15 21.6125 24.975 27.3375 26.075 16-17 22.112499999999997 25.7875 26.8625 25.2375 18-19 22.5125 26.0375 26.0375 25.412499999999998 20-21 22.425 26.700000000000003 26.075 24.8 22-23 23.150000000000002 26.5125 25.624999999999996 24.712500000000002 24-25 21.825 25.35 26.525 26.3 26-27 22.225 26.200000000000003 25.4375 26.137500000000003 28-29 22.175 25.2375 26.8125 25.775 30-31 23.0625 26.2625 25.587500000000002 25.087500000000002 32-33 21.6875 26.087500000000002 26.875 25.35 34-35 22.6125 26.437500000000004 26.1625 24.7875 36-37 22.0 25.95 26.0 26.05 38-39 22.5 26.0 26.025 25.474999999999998 40-41 22.112499999999997 26.187500000000004 25.912499999999998 25.7875 42-43 22.45 26.337500000000002 25.825 25.387500000000003 44-45 22.85 24.9875 26.825 25.337500000000002 46-47 22.2125 26.375 25.9875 25.424999999999997 48-49 23.0625 25.275 25.4375 26.224999999999998 50-51 22.575 26.0 26.0625 25.362499999999997 52-53 22.875 26.1 25.95 25.074999999999996 54-55 21.8625 26.137500000000003 26.3 25.7 56-57 22.112499999999997 25.724999999999998 26.275 25.887500000000003 58-59 22.175 25.912499999999998 25.650000000000002 26.2625 60-61 23.0125 25.087500000000002 25.9625 25.937500000000004 62-63 22.883581343003627 26.47242716018507 25.70964111541828 24.934350381393024 64-65 23.78986866791745 25.25328330206379 25.82864290181363 25.128205128205128 66-67 22.95554164057608 25.51033187226049 25.497808390732622 26.03631809643081 68-69 22.41292909045352 26.196441994487596 26.572287647206217 24.818341267852666 70-71 23.386389271838574 25.79270585286377 25.930567740318335 24.89033713497932 72-73 22.46176986713462 26.81123088493357 25.65805966407621 25.068939583855602 74-75 22.394984326018808 25.93103448275862 27.072100313479623 24.601880877742946 76-77 23.531626506024097 25.539658634538153 25.665160642570285 25.26355421686747 78-79 23.605527638190953 25.351758793969847 25.816582914572866 25.22613065326633 80-81 23.39783865292787 26.036692636340792 26.149786378487054 24.41568233224428 82-83 23.68785399622404 25.449968533668976 25.37444933920705 25.48772813089994 84-85 22.565200957540632 26.092982235101424 25.979589265465542 25.362227541892402 86-87 22.543206761700517 25.6465245363946 26.32774063327867 25.482528068626216 88-89 22.83763277693475 26.074860900354075 25.758725341426402 25.328780981284776 90-91 23.38403041825095 26.362484157160964 24.74017743979721 25.513307984790874 92-93 22.69485481406011 25.547631176770246 26.94854814060112 24.808965868568517 94-95 23.20675105485232 25.444316583557093 25.87904360056259 25.469888761028002 96-97 23.35175427322966 26.39763526539005 25.51085978665981 24.739750674720472 98-99 22.853403141361255 24.437172774869108 26.8717277486911 25.837696335078537 100-101 23.5977105478332 12.117743254292723 31.83973834832379 32.44480784955029 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.0 26 3.0 27 3.5 28 3.5 29 7.0 30 8.5 31 9.5 32 12.5 33 22.0 34 29.5 35 32.5 36 47.5 37 63.5 38 76.0 39 96.5 40 128.5 41 151.5 42 170.5 43 191.0 44 217.0 45 227.0 46 213.0 47 211.0 48 203.0 49 198.0 50 178.0 51 154.0 52 151.0 53 138.0 54 129.0 55 122.0 56 109.5 57 92.5 58 83.5 59 80.5 60 71.0 61 67.5 62 59.0 63 51.0 64 50.0 65 41.0 66 31.5 67 22.0 68 14.0 69 13.5 70 9.5 71 5.0 72 5.5 73 3.5 74 0.5 75 0.5 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 1.0 63 0.0 64 1.0 65 3.0 66 3.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 1.0 74 1.0 75 1.0 76 4.0 77 2.0 78 0.0 79 0.0 80 2.0 81 4.0 82 3.0 83 1.0 84 3.0 85 1.0 86 5.0 87 3.0 88 8.0 89 2.0 90 6.0 91 10.0 92 12.0 93 5.0 94 9.0 95 8.0 96 15.0 97 22.0 98 82.0 99 264.0 100 915.0 101 2600.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.88396624472574 89.95 2 4.773206751054852 9.049999999999999 3 0.31645569620253167 0.8999999999999999 4 0.026371308016877634 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024441 READS because READLEN < 1 Read 1024441 spots for SRR12897265.sra Written 1024441 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra Rejected 1024439 READS because READLEN < 1 Read 1024439 spots for SRR12897265.sra Written 1024439 spots for SRR12897265.sra SRR ids: ['SRR12897265.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_khgtwkt3 SRR12897265.sra spots: 20488782 blocks: [[1, 1024439], [1024440, 2048878], [2048879, 3073317], [3073318, 4097756], [4097757, 5122195], [5122196, 6146634], [6146635, 7171073], [7171074, 8195512], [8195513, 9219951], [9219952, 10244390], [10244391, 11268829], [11268830, 12293268], [12293269, 13317707], [13317708, 14342146], [14342147, 15366585], [15366586, 16391024], [16391025, 17415463], [17415464, 18439902], [18439903, 19464341], [19464342, 20488782]] SRR12897265 file size 4903204 SRR12897265 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897265 SRR12897265_1.fastq Input file: SRR12897265_1.fastq trimmed: SRR12897265-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:32:04 2024 >> started Sat Dec 7 12:32:14 2024 >> done (9.998s) 20488782 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 3832 ( 0.02%) empty reads filtered out after trimming by size control 20484943 (99.98%) reads available; of these: 497 ( 0.00%) trimmed reads available after processing 20484446 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 3 0.00% 33 1 0.00% 34 2 0.00% 35 53 0.00% 36 50 0.00% 37 69 0.00% 38 85 0.00% 39 87 0.00% 40 100 0.00% 41 109 0.00% 42 112 0.00% 43 119 0.00% 44 122 0.00% 45 136 0.00% 46 171 0.00% 47 221 0.00% 48 236 0.00% 49 339 0.00% 50 383 0.00% 51 453 0.00% 52 450 0.00% 53 464 0.00% 54 510 0.00% 55 595 0.00% 56 614 0.00% 57 742 0.00% 58 865 0.00% 59 1169 0.01% 60 1301 0.01% 61 1415 0.01% 62 1737 0.01% 63 1803 0.01% 64 1846 0.01% 65 2115 0.01% 66 2306 0.01% 67 2649 0.01% 68 2854 0.01% 69 3350 0.02% 70 3773 0.02% 71 4468 0.02% 72 4900 0.02% 73 5730 0.03% 74 6208 0.03% 75 6987 0.03% 76 7704 0.04% 77 8301 0.04% 78 9359 0.05% 79 10496 0.05% 80 11334 0.06% 81 13170 0.06% 82 15038 0.07% 83 16683 0.08% 84 18394 0.09% 85 20579 0.10% 86 22737 0.11% 87 24014 0.12% 88 26580 0.13% 89 28831 0.14% 90 31622 0.15% 91 34746 0.17% 92 35932 0.18% 93 40072 0.20% 94 44038 0.21% 95 50248 0.25% 96 76310 0.37% 97 143992 0.70% 98 424481 2.07% 99 1380597 6.74% 100 4791110 23.39% 101 13136862 64.13% 20484943 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=21 prefix-density=0.28 prefix-fanout=2.2 sequence=AGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=19.77 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=2.1 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGACGAGAAGGTAGCAGACATCTCTGCTCTGC Started job on | Dec 07 12:32:28 Started mapping on | Dec 07 12:32:29 Finished on | Dec 07 12:32:47 Mapping speed, Million of reads per hour | 4096.99 Number of input reads | 20484943 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19892099 Uniquely mapped reads % | 97.11% Average mapped length | 99.92 Number of splices: Total | 7021843 Number of splices: Annotated (sjdb) | 6658730 Number of splices: GT/AG | 6924731 Number of splices: GC/AG | 84357 Number of splices: AT/AC | 3227 Number of splices: Non-canonical | 9528 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360186 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 129648 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 232658 232658 232658 N_multimapping 360186 360186 360186 N_noFeature 847922 19440668 984297 N_ambiguous 354927 1581 41149 UnstrandedReadsAssigned:18689250 PositiveStrandReadsAssigned:449850 NegativeStrandReadsAssigned:18866653 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897265 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897265-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,484,943 reads, 19,028,735 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR12897265.ke.tsv 35125 SRR12897265.se.tsv 88098 total ==> SRR12897265.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 122.682 13.6408 PNS24247 1044 945 51.471 5.06892 PNS24249 1928 1829 14.8083 0.753485 PNS24246 1044 945 51.471 5.06892 PNS24248 1044 945 51.471 5.06892 PNS24244 1471 1372 111.097 7.53583 PNS24243 293 194 0 0 KQK14069 1603 1504 1253.12 77.5407 KQK14071 474 375 83.3209 20.6779 ==> SRR12897265.se.tsv <== BRADI_1g14170v3 1705 BRADI_1g53295v3 113 BRADI_1g59795v3 381 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 2051 BRADI_1g74790v3 251 BRADI_1g09890v3 1 BRADI_1g77505v3 332 BRADI_1g48960v3 0 SRR12897265 completed mapping pipeline successfully