Starting /dee2/code/volunteer_pipeline.sh SRR12897266 current disk space = 1543124840448 free memory = 1606472592 SRR12897266 SRAfilesize 01bf1a93180b958d0fdb66381046d6dd SRR12897266.sra SRR12897266.sra file validated SRR12897266 is single end SRR12897266 is conventional basespace SRR12897266 read1 length is 58-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897266_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 58-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6735 37.0 37.0 37.0 37.0 37.0 2 36.6875 37.0 37.0 37.0 37.0 37.0 3 36.692 37.0 37.0 37.0 37.0 37.0 4 36.7455 37.0 37.0 37.0 37.0 37.0 5 36.773 37.0 37.0 37.0 37.0 37.0 6 36.782 37.0 37.0 37.0 37.0 37.0 7 36.699 37.0 37.0 37.0 37.0 37.0 8 36.6995 37.0 37.0 37.0 37.0 37.0 9 36.727 37.0 37.0 37.0 37.0 37.0 10-11 36.7425 37.0 37.0 37.0 37.0 37.0 12-13 36.74575 37.0 37.0 37.0 37.0 37.0 14-15 36.706500000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.741749999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.7475 37.0 37.0 37.0 37.0 37.0 20-21 36.753 37.0 37.0 37.0 37.0 37.0 22-23 36.695 37.0 37.0 37.0 37.0 37.0 24-25 36.732749999999996 37.0 37.0 37.0 37.0 37.0 26-27 36.71725 37.0 37.0 37.0 37.0 37.0 28-29 36.64575 37.0 37.0 37.0 37.0 37.0 30-31 36.670500000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.66775 37.0 37.0 37.0 37.0 37.0 34-35 36.6965 37.0 37.0 37.0 37.0 37.0 36-37 36.674 37.0 37.0 37.0 37.0 37.0 38-39 36.6235 37.0 37.0 37.0 37.0 37.0 40-41 36.66875 37.0 37.0 37.0 37.0 37.0 42-43 36.649249999999995 37.0 37.0 37.0 37.0 37.0 44-45 36.60925 37.0 37.0 37.0 37.0 37.0 46-47 36.67775 37.0 37.0 37.0 37.0 37.0 48-49 36.6425 37.0 37.0 37.0 37.0 37.0 50-51 36.704499999999996 37.0 37.0 37.0 37.0 37.0 52-53 36.672250000000005 37.0 37.0 37.0 37.0 37.0 54-55 36.664 37.0 37.0 37.0 37.0 37.0 56-57 36.6455 37.0 37.0 37.0 37.0 37.0 58-59 36.65770423855964 37.0 37.0 37.0 37.0 37.0 60-61 36.636409102275564 37.0 37.0 37.0 37.0 37.0 62-63 36.62965741435359 37.0 37.0 37.0 37.0 37.0 64-65 36.69367341835459 37.0 37.0 37.0 37.0 37.0 66-67 36.633408352088026 37.0 37.0 37.0 37.0 37.0 68-69 36.628324394083265 37.0 37.0 37.0 37.0 37.0 70-71 36.52559151595929 37.0 37.0 37.0 37.0 37.0 72-73 36.655569461827284 37.0 37.0 37.0 37.0 37.0 74-75 36.65281602002503 37.0 37.0 37.0 37.0 37.0 76-77 36.61212285495611 37.0 37.0 37.0 37.0 37.0 78-79 36.56351791530945 37.0 37.0 37.0 37.0 37.0 80-81 36.58877054865515 37.0 37.0 37.0 37.0 37.0 82-83 36.62915348009123 37.0 37.0 37.0 37.0 37.0 84-85 36.624244559478285 37.0 37.0 37.0 37.0 37.0 86-87 36.608551325921376 37.0 37.0 37.0 37.0 37.0 88-89 36.616191982033676 37.0 37.0 37.0 37.0 37.0 90-91 36.57156495002364 37.0 37.0 37.0 37.0 37.0 92-93 36.61215309522143 37.0 37.0 37.0 37.0 37.0 94-95 36.594305331883746 37.0 37.0 37.0 37.0 37.0 96-97 36.57665938868037 37.0 37.0 37.0 37.0 37.0 98-99 36.58974318391918 37.0 37.0 37.0 37.0 37.0 100-101 36.51874237589508 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 2.0 27 2.0 28 11.0 29 7.0 30 14.0 31 17.0 32 18.0 33 24.0 34 50.0 35 94.0 36 2074.0 37 1685.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.475 10.875 4.875 49.775000000000006 2 18.075 13.5 40.2 28.225 3 18.55 15.4 25.5 40.550000000000004 4 24.7 23.799999999999997 22.275 29.225 5 25.424999999999997 29.549999999999997 24.6 20.424999999999997 6 21.825 31.35 23.95 22.875 7 17.625 23.75 39.6 19.025 8 18.05 22.375 33.175 26.400000000000002 9 18.6 21.075 34.949999999999996 25.374999999999996 10-11 22.7375 30.099999999999998 24.9 22.2625 12-13 22.237499999999997 24.099999999999998 27.462500000000002 26.200000000000003 14-15 20.2125 25.2375 28.249999999999996 26.3 16-17 23.05 25.1875 26.4125 25.35 18-19 22.900000000000002 25.412499999999998 25.825 25.8625 20-21 21.987499999999997 25.8 27.462500000000002 24.75 22-23 23.150000000000002 25.6125 25.05 26.187500000000004 24-25 21.9 25.874999999999996 26.087500000000002 26.137500000000003 26-27 22.5625 25.2625 26.450000000000003 25.724999999999998 28-29 22.6125 25.124999999999996 26.8125 25.45 30-31 22.95 25.7375 25.587500000000002 25.724999999999998 32-33 22.412499999999998 24.875 27.1 25.6125 34-35 22.6375 25.15 25.775 26.437500000000004 36-37 21.55 25.4625 27.3125 25.674999999999997 38-39 21.85 26.224999999999998 26.35 25.575 40-41 23.1375 25.874999999999996 26.0 24.9875 42-43 23.150000000000002 25.5625 25.924999999999997 25.362499999999997 44-45 23.0 25.025 27.275 24.7 46-47 22.375 26.275 26.0375 25.3125 48-49 23.5 25.887500000000003 25.45 25.162499999999998 50-51 21.675 25.974999999999998 25.7 26.650000000000002 52-53 22.825 25.837500000000002 26.9125 24.425 54-55 22.6875 25.2 25.575 26.5375 56-57 21.7375 24.4875 26.637499999999996 27.1375 58-59 22.940367545943243 26.290786348293537 25.59069883735467 25.17814726840855 60-61 23.20580145036259 25.18129532383096 25.831457864466117 25.78144536134033 62-63 22.255563890972745 26.04401100275069 25.76894223555889 25.93148287071768 64-65 22.53063265816454 26.056514128532132 26.644161040260066 24.76869217304326 66-67 22.843210802700675 25.818954738684667 25.406351587896975 25.93148287071768 68-69 22.923961980990494 25.975487743871934 25.900450225112557 25.200100050025014 70-71 22.231952958838985 26.37307644188665 27.01113474290004 24.38383585637433 72-73 22.590738423028785 25.193992490613265 26.83354192740926 25.381727158948685 74-75 22.74092615769712 25.3566958698373 26.107634543178975 25.79474342928661 76-77 23.137598597721297 25.72931012895956 25.87955427569801 25.253536997621133 78-79 23.076923076923077 26.02104735655224 25.85818090704084 25.043848659483835 80-81 22.204112337011033 25.45135406218656 26.68004012036108 25.664493480441326 82-83 22.381131602057458 25.053318278760507 25.517500940910804 27.04804917827123 84-85 23.257566243877935 24.927791033530077 26.133366821549668 25.681275901042323 86-87 22.292112215373002 24.946534155239654 27.09774814442068 25.663605484966663 88-89 23.828125 25.0 26.68850806451613 24.483366935483872 90-91 23.630396364554407 25.157788437263317 25.523857611714213 25.687957586468062 92-93 22.94646247310467 25.06011897228199 26.059992406024552 25.933426148588783 94-95 22.251874444020842 25.83555724996823 25.848265345024778 26.064302960986147 96-97 23.59092068349911 24.789594491201225 26.052027543993876 25.56745728130579 98-99 22.771506422732582 24.53613598027767 27.053328143246397 25.63902945374335 100-101 22.508983992159425 12.789937928781445 32.06468474354786 32.63639333551127 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 1.0 28 4.0 29 6.0 30 4.5 31 4.5 32 15.5 33 21.0 34 22.5 35 30.0 36 36.5 37 59.0 38 78.5 39 100.5 40 134.0 41 164.5 42 180.0 43 182.5 44 210.5 45 226.0 46 218.0 47 214.5 48 208.0 49 201.0 50 181.5 51 160.0 52 156.5 53 149.0 54 122.5 55 103.0 56 98.5 57 89.5 58 84.0 59 75.0 60 75.5 61 71.0 62 59.5 63 55.0 64 40.5 65 35.0 66 33.5 67 26.5 68 19.5 69 16.0 70 11.5 71 9.5 72 8.0 73 5.0 74 1.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 2.0 78 0.0 79 2.0 80 2.0 81 1.0 82 1.0 83 2.0 84 3.0 85 2.0 86 7.0 87 0.0 88 6.0 89 2.0 90 4.0 91 6.0 92 5.0 93 9.0 94 9.0 95 4.0 96 10.0 97 23.0 98 79.0 99 275.0 100 956.0 101 2583.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.56809750927398 89.225 2 4.954954954954955 9.35 3 0.4239533651298357 1.2 4 0.026497085320614733 0.1 5 0.026497085320614733 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTGCCCCGGTTGCCTCATTAAGACAGGGCACCTGATCCCCAGGCGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra Rejected 962165 READS because READLEN < 1 Read 962165 spots for SRR12897266.sra Written 962165 spots for SRR12897266.sra Rejected 962150 READS because READLEN < 1 Read 962150 spots for SRR12897266.sra Written 962150 spots for SRR12897266.sra SRR ids: ['SRR12897266.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3hk8pog9 SRR12897266.sra spots: 19243015 blocks: [[1, 962150], [962151, 1924300], [1924301, 2886450], [2886451, 3848600], [3848601, 4810750], [4810751, 5772900], [5772901, 6735050], [6735051, 7697200], [7697201, 8659350], [8659351, 9621500], [9621501, 10583650], [10583651, 11545800], [11545801, 12507950], [12507951, 13470100], [13470101, 14432250], [14432251, 15394400], [15394401, 16356550], [16356551, 17318700], [17318701, 18280850], [18280851, 19243015]] SRR12897266 file size 4610916 SRR12897266 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897266 SRR12897266_1.fastq Input file: SRR12897266_1.fastq trimmed: SRR12897266-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:34:19 2024 >> started Sat Dec 7 12:35:13 2024 >> done (54.281s) 19243015 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1171 ( 0.01%) empty reads filtered out after trimming by size control 19241838 (99.99%) reads available; of these: 220 ( 0.00%) trimmed reads available after processing 19241618 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 2 0.00% 33 0 0.00% 34 3 0.00% 35 39 0.00% 36 35 0.00% 37 27 0.00% 38 38 0.00% 39 53 0.00% 40 60 0.00% 41 65 0.00% 42 85 0.00% 43 69 0.00% 44 71 0.00% 45 109 0.00% 46 104 0.00% 47 136 0.00% 48 109 0.00% 49 166 0.00% 50 193 0.00% 51 213 0.00% 52 248 0.00% 53 228 0.00% 54 269 0.00% 55 282 0.00% 56 286 0.00% 57 327 0.00% 58 413 0.00% 59 527 0.00% 60 604 0.00% 61 645 0.00% 62 693 0.00% 63 810 0.00% 64 875 0.00% 65 984 0.01% 66 1002 0.01% 67 1154 0.01% 68 1314 0.01% 69 1497 0.01% 70 1725 0.01% 71 1967 0.01% 72 2308 0.01% 73 2641 0.01% 74 3026 0.02% 75 3415 0.02% 76 3719 0.02% 77 4193 0.02% 78 4575 0.02% 79 5112 0.03% 80 5552 0.03% 81 6378 0.03% 82 7298 0.04% 83 8276 0.04% 84 9519 0.05% 85 10652 0.06% 86 11730 0.06% 87 13087 0.07% 88 14113 0.07% 89 15487 0.08% 90 16970 0.09% 91 18987 0.10% 92 19909 0.10% 93 22214 0.12% 94 25041 0.13% 95 29932 0.16% 96 53831 0.28% 97 118575 0.62% 98 382944 1.99% 99 1302669 6.77% 100 4553658 23.67% 101 12548593 65.22% 19241838 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=36 prefix-density=0.13 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=383.28 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=33.4 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:35:29 Started mapping on | Dec 07 12:35:29 Finished on | Dec 07 12:35:50 Mapping speed, Million of reads per hour | 3298.60 Number of input reads | 19241838 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18685300 Uniquely mapped reads % | 97.11% Average mapped length | 100.11 Number of splices: Total | 6706267 Number of splices: Annotated (sjdb) | 6355061 Number of splices: GT/AG | 6611463 Number of splices: GC/AG | 81460 Number of splices: AT/AC | 3768 Number of splices: Non-canonical | 9576 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334583 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 107628 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 221955 221955 221955 N_multimapping 334583 334583 334583 N_noFeature 861716 18258005 998100 N_ambiguous 329449 1546 39535 UnstrandedReadsAssigned:17494135 PositiveStrandReadsAssigned:425749 NegativeStrandReadsAssigned:17647665 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897266 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897266-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,241,838 reads, 17,830,441 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR12897266.ke.tsv 35125 SRR12897266.se.tsv 88098 total ==> SRR12897266.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 145.111 17.4546 PNS24247 1044 945 52.7736 5.62239 PNS24249 1928 1829 41.2464 2.27043 PNS24246 1044 945 52.7736 5.62239 PNS24248 1044 945 52.7736 5.62239 PNS24244 1471 1372 178.322 13.0854 PNS24243 293 194 0 0 KQK14069 1603 1504 2862.79 191.636 KQK14071 474 375 240.013 64.4377 ==> SRR12897266.se.tsv <== BRADI_1g14170v3 3606 BRADI_1g53295v3 151 BRADI_1g59795v3 445 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2117 BRADI_1g74790v3 225 BRADI_1g09890v3 3 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR12897266 completed mapping pipeline successfully