Starting /dee2/code/volunteer_pipeline.sh SRR12897267 current disk space = 1543122976768 free memory = 1602438952 SRR12897267 SRAfilesize 5259025846488df63ae2eee217bf25f4 SRR12897267.sra SRR12897267.sra file validated SRR12897267 is single end SRR12897267 is conventional basespace SRR12897267 read1 length is 53-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897267_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.706 37.0 37.0 37.0 37.0 37.0 2 36.7185 37.0 37.0 37.0 37.0 37.0 3 36.6935 37.0 37.0 37.0 37.0 37.0 4 36.7775 37.0 37.0 37.0 37.0 37.0 5 36.7865 37.0 37.0 37.0 37.0 37.0 6 36.7525 37.0 37.0 37.0 37.0 37.0 7 36.7165 37.0 37.0 37.0 37.0 37.0 8 36.7665 37.0 37.0 37.0 37.0 37.0 9 36.76 37.0 37.0 37.0 37.0 37.0 10-11 36.75025 37.0 37.0 37.0 37.0 37.0 12-13 36.78575 37.0 37.0 37.0 37.0 37.0 14-15 36.79325 37.0 37.0 37.0 37.0 37.0 16-17 36.748999999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.78874999999999 37.0 37.0 37.0 37.0 37.0 20-21 36.7675 37.0 37.0 37.0 37.0 37.0 22-23 36.7405 37.0 37.0 37.0 37.0 37.0 24-25 36.753 37.0 37.0 37.0 37.0 37.0 26-27 36.676249999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.70525 37.0 37.0 37.0 37.0 37.0 30-31 36.734750000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.64875 37.0 37.0 37.0 37.0 37.0 34-35 36.733000000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.71075 37.0 37.0 37.0 37.0 37.0 38-39 36.712 37.0 37.0 37.0 37.0 37.0 40-41 36.71925 37.0 37.0 37.0 37.0 37.0 42-43 36.658500000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.717 37.0 37.0 37.0 37.0 37.0 46-47 36.688 37.0 37.0 37.0 37.0 37.0 48-49 36.691 37.0 37.0 37.0 37.0 37.0 50-51 36.7095 37.0 37.0 37.0 37.0 37.0 52-53 36.66 37.0 37.0 37.0 37.0 37.0 54-55 36.680170042510625 37.0 37.0 37.0 37.0 37.0 56-57 36.695423855963995 37.0 37.0 37.0 37.0 37.0 58-59 36.68117029257314 37.0 37.0 37.0 37.0 37.0 60-61 36.686171542885724 37.0 37.0 37.0 37.0 37.0 62-63 36.659664916229055 37.0 37.0 37.0 37.0 37.0 64-65 36.70542635658914 37.0 37.0 37.0 37.0 37.0 66-67 36.65666416604151 37.0 37.0 37.0 37.0 37.0 68-69 36.64732138751475 37.0 37.0 37.0 37.0 37.0 70-71 36.64919303842246 37.0 37.0 37.0 37.0 37.0 72-73 36.68864759628214 37.0 37.0 37.0 37.0 37.0 74-75 36.65601398236212 37.0 37.0 37.0 37.0 37.0 76-77 36.68742670162496 37.0 37.0 37.0 37.0 37.0 78-79 36.65797392176529 37.0 37.0 37.0 37.0 37.0 80-81 36.60431293881645 37.0 37.0 37.0 37.0 37.0 82-83 36.65500055149114 37.0 37.0 37.0 37.0 37.0 84-85 36.62239517951293 37.0 37.0 37.0 37.0 37.0 86-87 36.57422478244883 37.0 37.0 37.0 37.0 37.0 88-89 36.659036420365766 37.0 37.0 37.0 37.0 37.0 90-91 36.62585355387178 37.0 37.0 37.0 37.0 37.0 92-93 36.56101309955939 37.0 37.0 37.0 37.0 37.0 94-95 36.582671984102504 37.0 37.0 37.0 37.0 37.0 96-97 36.61103568957422 37.0 37.0 37.0 37.0 37.0 98-99 36.626737621804324 37.0 37.0 37.0 37.0 37.0 100-101 36.57961738484559 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 2.0 27 4.0 28 4.0 29 8.0 30 12.0 31 16.0 32 10.0 33 25.0 34 48.0 35 84.0 36 2049.0 37 1735.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.31665832916458 11.555777888944473 4.6773386693346675 50.45022511255628 2 18.725 13.375 39.574999999999996 28.325 3 17.95 15.125 25.275 41.65 4 23.724999999999998 23.575 22.75 29.95 5 26.025 28.9 23.775 21.3 6 22.5 29.975 23.875 23.65 7 17.25 23.724999999999998 40.875 18.15 8 18.95 22.325 32.15 26.575 9 18.224999999999998 21.9 34.425 25.45 10-11 21.912499999999998 29.525000000000002 25.412499999999998 23.150000000000002 12-13 22.0875 24.1375 27.325 26.450000000000003 14-15 22.0125 24.825 27.6125 25.55 16-17 23.2625 25.7 26.0 25.0375 18-19 22.237499999999997 25.074999999999996 26.1 26.5875 20-21 21.625 26.2875 26.4625 25.624999999999996 22-23 22.525000000000002 26.05 26.3 25.124999999999996 24-25 21.575 24.9 26.825 26.700000000000003 26-27 21.775 25.650000000000002 26.8125 25.7625 28-29 22.3125 25.912499999999998 26.687499999999996 25.087500000000002 30-31 22.15 26.25 25.575 26.025 32-33 21.975 25.95 25.9625 26.1125 34-35 22.5875 26.375 26.924999999999997 24.1125 36-37 21.7 25.337500000000002 26.337500000000002 26.625 38-39 21.6875 25.424999999999997 27.375 25.5125 40-41 21.45 26.825 25.5375 26.187500000000004 42-43 22.475 25.587500000000002 26.137500000000003 25.8 44-45 21.2875 25.937500000000004 26.6625 26.1125 46-47 22.8125 26.0125 25.85 25.324999999999996 48-49 21.7875 25.087500000000002 26.2625 26.8625 50-51 22.4625 25.937500000000004 26.6625 24.9375 52-53 21.8125 26.150000000000002 25.775 26.2625 54-55 21.80545136284071 25.593898474618655 26.219054763690924 26.38159539884971 56-57 22.168042010502624 25.868967241810452 26.056514128532132 25.906476619154787 58-59 22.493123280820203 26.106526631657918 26.644161040260066 24.756189047261813 60-61 22.718179544886222 25.731432858214554 25.818954738684667 25.731432858214554 62-63 22.080520130032507 26.65666416604151 25.693923480870218 25.568892223055762 64-65 23.118279569892472 25.406351587896975 25.70642660665166 25.76894223555889 66-67 23.10577644411103 25.543885971492873 25.393848462115532 25.95648912228057 68-69 22.923961980990494 26.600800400200097 26.275637818909452 24.19959979989995 70-71 23.282872513449266 25.84761666458151 25.997748029525837 24.871762792443388 72-73 22.550369165310975 25.929170316606182 26.342134901764485 25.178325616318357 74-75 22.33496179381185 26.356006513841912 25.942628084679946 25.366403607666292 76-77 22.68454693570623 25.454317583657097 25.178593808747962 26.68254167188871 78-79 22.392176529588767 25.300902708124372 26.441825476429287 25.86509528585757 80-81 22.429789368104313 26.278836509528585 25.651955867602812 25.63941825476429 82-83 23.372224313135114 25.95659264835027 25.166227574959226 25.50495546355539 84-85 22.70901330655285 25.03138337936229 25.85990459452674 26.399698719558124 86-87 23.124293075279628 25.776046248586148 26.03996481085836 25.059695865275856 88-89 22.78560644187217 25.893306492199297 25.880724710619024 25.44036235530951 90-91 22.260015117157973 25.82514487276392 25.787351977828166 26.127488032249936 92-93 23.3862834089763 25.592536560766515 26.008572869389813 25.012607160867372 94-95 22.759404190860895 26.02878061095683 25.675334511486998 25.536480686695278 96-97 23.363774733637747 25.570776255707763 25.570776255707763 25.49467275494673 98-99 22.99058186040511 24.371048896916527 26.744936137272614 25.893433105405755 100-101 23.29056358616209 12.343673867143089 32.61328569108332 31.7524768556115 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 3.5 30 4.0 31 8.0 32 16.5 33 20.0 34 20.5 35 33.0 36 48.0 37 68.5 38 88.0 39 101.0 40 130.0 41 156.5 42 173.0 43 195.5 44 206.0 45 201.0 46 213.5 47 213.5 48 203.0 49 197.5 50 206.5 51 195.5 52 146.5 53 134.5 54 132.5 55 110.0 56 99.0 57 88.5 58 72.5 59 73.5 60 76.5 61 64.0 62 48.5 63 48.5 64 50.0 65 42.0 66 35.0 67 25.0 68 15.5 69 12.0 70 12.0 71 11.0 72 4.0 73 1.5 74 1.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 1.0 71 0.0 72 1.0 73 3.0 74 1.0 75 1.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 1.0 82 3.0 83 1.0 84 0.0 85 3.0 86 3.0 87 2.0 88 2.0 89 3.0 90 2.0 91 1.0 92 2.0 93 2.0 94 4.0 95 11.0 96 12.0 97 21.0 98 79.0 99 283.0 100 949.0 101 2604.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.51510333863276 89.17500000000001 2 5.007949125596185 9.45 3 0.45045045045045046 1.275 4 0.026497085320614733 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910979 READS because READLEN < 1 Read 910979 spots for SRR12897267.sra Written 910979 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra Rejected 910965 READS because READLEN < 1 Read 910965 spots for SRR12897267.sra Written 910965 spots for SRR12897267.sra SRR ids: ['SRR12897267.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qao89_29 SRR12897267.sra spots: 18219314 blocks: [[1, 910965], [910966, 1821930], [1821931, 2732895], [2732896, 3643860], [3643861, 4554825], [4554826, 5465790], [5465791, 6376755], [6376756, 7287720], [7287721, 8198685], [8198686, 9109650], [9109651, 10020615], [10020616, 10931580], [10931581, 11842545], [11842546, 12753510], [12753511, 13664475], [13664476, 14575440], [14575441, 15486405], [15486406, 16397370], [16397371, 17308335], [17308336, 18219314]] SRR12897267 file size 4364070 SRR12897267 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897267 SRR12897267_1.fastq Input file: SRR12897267_1.fastq trimmed: SRR12897267-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:34:39 2024 >> started Sat Dec 7 12:35:04 2024 >> done (25.198s) 18219314 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1399 ( 0.01%) empty reads filtered out after trimming by size control 18217909 (99.99%) reads available; of these: 246 ( 0.00%) trimmed reads available after processing 18217663 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 3 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 1 0.00% 35 36 0.00% 36 44 0.00% 37 49 0.00% 38 44 0.00% 39 50 0.00% 40 62 0.00% 41 90 0.00% 42 58 0.00% 43 73 0.00% 44 98 0.00% 45 88 0.00% 46 136 0.00% 47 119 0.00% 48 163 0.00% 49 195 0.00% 50 187 0.00% 51 248 0.00% 52 268 0.00% 53 246 0.00% 54 277 0.00% 55 314 0.00% 56 359 0.00% 57 393 0.00% 58 473 0.00% 59 526 0.00% 60 596 0.00% 61 699 0.00% 62 775 0.00% 63 865 0.00% 64 885 0.00% 65 998 0.01% 66 1057 0.01% 67 1177 0.01% 68 1398 0.01% 69 1617 0.01% 70 1775 0.01% 71 2066 0.01% 72 2318 0.01% 73 2720 0.01% 74 3051 0.02% 75 3387 0.02% 76 3714 0.02% 77 4024 0.02% 78 4549 0.02% 79 5191 0.03% 80 5602 0.03% 81 6350 0.03% 82 7329 0.04% 83 8169 0.04% 84 9208 0.05% 85 10437 0.06% 86 11625 0.06% 87 12474 0.07% 88 13914 0.08% 89 14874 0.08% 90 16541 0.09% 91 18386 0.10% 92 19160 0.11% 93 21249 0.12% 94 24807 0.14% 95 28974 0.16% 96 51344 0.28% 97 112536 0.62% 98 363927 2.00% 99 1232910 6.77% 100 4297863 23.59% 101 11882758 65.23% 18217909 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=430.32 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=34.6 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:35:21 Started mapping on | Dec 07 12:35:21 Finished on | Dec 07 12:35:41 Mapping speed, Million of reads per hour | 3279.22 Number of input reads | 18217909 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17681987 Uniquely mapped reads % | 97.06% Average mapped length | 100.10 Number of splices: Total | 6318208 Number of splices: Annotated (sjdb) | 5986663 Number of splices: GT/AG | 6229800 Number of splices: GC/AG | 76080 Number of splices: AT/AC | 3475 Number of splices: Non-canonical | 8853 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315440 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 107176 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 220482 220482 220482 N_multimapping 315440 315440 315440 N_noFeature 806623 17276438 939560 N_ambiguous 309060 1422 37365 UnstrandedReadsAssigned:16566304 PositiveStrandReadsAssigned:404127 NegativeStrandReadsAssigned:16705062 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897267 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897267-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,217,909 reads, 16,877,416 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR12897267.ke.tsv 35125 SRR12897267.se.tsv 88098 total ==> SRR12897267.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 146.805 18.603 PNS24247 1044 945 49.5833 5.56509 PNS24249 1928 1829 7.19101 0.417008 PNS24246 1044 945 49.5833 5.56509 PNS24248 1044 945 49.5833 5.56509 PNS24244 1471 1372 159.254 12.3113 PNS24243 293 194 0 0 KQK14069 1603 1504 2778.54 195.946 KQK14071 474 375 214.018 60.5323 ==> SRR12897267.se.tsv <== BRADI_1g14170v3 3309 BRADI_1g53295v3 114 BRADI_1g59795v3 431 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 1945 BRADI_1g74790v3 189 BRADI_1g09890v3 4 BRADI_1g77505v3 370 BRADI_1g48960v3 1 SRR12897267 completed mapping pipeline successfully