Starting /dee2/code/volunteer_pipeline.sh SRR12897268 current disk space = 1543117697024 free memory = 1606467504 SRR12897268 SRAfilesize b5df309743544d84eb9e71919c2d76ad SRR12897268.sra SRR12897268.sra file validated SRR12897268 is single end SRR12897268 is conventional basespace SRR12897268 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897268_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.752 37.0 37.0 37.0 37.0 37.0 2 36.69375 37.0 37.0 37.0 37.0 37.0 3 36.76975 37.0 37.0 37.0 37.0 37.0 4 36.75525 37.0 37.0 37.0 37.0 37.0 5 36.72625 37.0 37.0 37.0 37.0 37.0 6 36.70475 37.0 37.0 37.0 37.0 37.0 7 36.70725 37.0 37.0 37.0 37.0 37.0 8 36.72525 37.0 37.0 37.0 37.0 37.0 9 36.74725 37.0 37.0 37.0 37.0 37.0 10-11 36.728750000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.7255 37.0 37.0 37.0 37.0 37.0 14-15 36.7125 37.0 37.0 37.0 37.0 37.0 16-17 36.72725 37.0 37.0 37.0 37.0 37.0 18-19 36.7655 37.0 37.0 37.0 37.0 37.0 20-21 36.76025 37.0 37.0 37.0 37.0 37.0 22-23 36.7495 37.0 37.0 37.0 37.0 37.0 24-25 36.705 37.0 37.0 37.0 37.0 37.0 26-27 36.6655 37.0 37.0 37.0 37.0 37.0 28-29 36.7465 37.0 37.0 37.0 37.0 37.0 30-31 36.6935 37.0 37.0 37.0 37.0 37.0 32-33 36.65975 37.0 37.0 37.0 37.0 37.0 34-35 36.72225 37.0 37.0 37.0 37.0 37.0 36-37 36.70767691922981 37.0 37.0 37.0 37.0 37.0 38-39 36.72918229557389 37.0 37.0 37.0 37.0 37.0 40-41 36.702425606401604 37.0 37.0 37.0 37.0 37.0 42-43 36.68117029257314 37.0 37.0 37.0 37.0 37.0 44-45 36.671667916979246 37.0 37.0 37.0 37.0 37.0 46-47 36.67366841710428 37.0 37.0 37.0 37.0 37.0 48-49 36.6721680420105 37.0 37.0 37.0 37.0 37.0 50-51 36.68217054263566 37.0 37.0 37.0 37.0 37.0 52-53 36.66166541635408 37.0 37.0 37.0 37.0 37.0 54-55 36.61890472618154 37.0 37.0 37.0 37.0 37.0 56-57 36.664666166541636 37.0 37.0 37.0 37.0 37.0 58-59 36.666666666666664 37.0 37.0 37.0 37.0 37.0 60-61 36.607354752645136 37.0 37.0 37.0 37.0 37.0 62-63 36.6295647823912 37.0 37.0 37.0 37.0 37.0 64-65 36.65857928964482 37.0 37.0 37.0 37.0 37.0 66-67 36.67308654327164 37.0 37.0 37.0 37.0 37.0 68-69 36.62251766363542 37.0 37.0 37.0 37.0 37.0 70-71 36.59794846134601 37.0 37.0 37.0 37.0 37.0 72-73 36.62607945868271 37.0 37.0 37.0 37.0 37.0 74-75 36.5978968452679 37.0 37.0 37.0 37.0 37.0 76-77 36.64007159071461 37.0 37.0 37.0 37.0 37.0 78-79 36.64875309375955 37.0 37.0 37.0 37.0 37.0 80-81 36.57429215735405 37.0 37.0 37.0 37.0 37.0 82-83 36.647619047619045 37.0 37.0 37.0 37.0 37.0 84-85 36.58133728898901 37.0 37.0 37.0 37.0 37.0 86-87 36.61379409877642 37.0 37.0 37.0 37.0 37.0 88-89 36.59507733600397 37.0 37.0 37.0 37.0 37.0 90-91 36.64991278407987 37.0 37.0 37.0 37.0 37.0 92-93 36.58589660284878 37.0 37.0 37.0 37.0 37.0 94-95 36.55909473968142 37.0 37.0 37.0 37.0 37.0 96-97 36.59917939148325 37.0 37.0 37.0 37.0 37.0 98-99 36.57296110564901 37.0 37.0 37.0 37.0 37.0 100-101 36.55697196719358 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 4.0 28 11.0 29 7.0 30 10.0 31 8.0 32 21.0 33 28.0 34 35.0 35 95.0 36 2160.0 37 1617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.665332666333168 11.480740370185092 5.252626313156578 52.601300650325165 2 18.254563640910227 12.80320080020005 40.66016504126031 28.28207051762941 3 17.779444861215303 15.55388847211803 26.9567391847962 39.709927481870466 4 24.381095273818453 23.85596399099775 21.85546386596649 29.9074768692173 5 25.531382845711427 28.93223305826457 23.305826456614152 22.230557639409852 6 22.355588897224308 32.55813953488372 23.20580145036259 21.880470117529384 7 17.37934483620905 24.33108277069267 39.0847711927982 19.204801200300075 8 20.655163790947736 21.880470117529384 31.657914478619652 25.806451612903224 9 19.779944986246562 20.7551887971993 34.78369592398099 24.681170292573142 10-11 22.20555138784696 29.557389347336834 24.50612653163291 23.730932733183295 12-13 22.518129532383096 23.3183295823956 27.556889222305575 26.60665166291573 14-15 21.66791697924481 24.48112028007002 29.182295573893473 24.668667166791696 16-17 22.29307326831708 25.131282820705174 26.819204801200303 25.756439109777446 18-19 23.005751437859466 25.03125781445361 25.85646411602901 26.106526631657918 20-21 22.05551387846962 25.30632658164541 27.019254813703427 25.618904726181547 22-23 22.230557639409852 26.806701675418854 25.806451612903224 25.156289072268066 24-25 22.50562640660165 25.95648912228057 25.70642660665166 25.831457864466117 26-27 21.955488872218055 26.019004751187797 26.71917979494874 25.30632658164541 28-29 22.518129532383096 25.506376594148538 26.494123530882717 25.481370342585645 30-31 22.630657664416105 25.55638909727432 25.581395348837212 26.231557889472366 32-33 22.655663915978995 25.406351587896975 27.081770442610654 24.85621405351338 34-35 22.705676419104776 26.019004751187797 26.16904226056514 25.10627656914228 36-37 22.168042010502624 25.51887971992998 25.868967241810452 26.44411102775694 38-39 23.63090772693173 26.11902975743936 25.381345336334082 24.868717179294826 40-41 23.005751437859466 25.693923480870218 24.918729682420604 26.38159539884971 42-43 21.6929232308077 26.219054763690924 25.943985996499126 26.144036009002253 44-45 21.94298574643661 25.968992248062015 27.506876719179797 24.58114528632158 46-47 22.50562640660165 26.056514128532132 25.818954738684667 25.618904726181547 48-49 22.418104526131533 25.93148287071768 25.656414103525883 25.993998499624904 50-51 22.06801700425106 25.243810952738183 26.531632908227053 26.156539134783696 52-53 22.155538884721178 25.70642660665166 26.219054763690924 25.918979744936234 54-55 22.18054513628407 25.893973493373345 26.531632908227053 25.393848462115532 56-57 22.74318579644911 25.70642660665166 26.969242310577645 24.58114528632158 58-59 22.630657664416105 25.381345336334082 26.231557889472366 25.756439109777446 60-61 23.50881580592722 25.109416031011627 25.909716143553833 25.472052019507313 62-63 24.037018509254626 25.475237618809405 25.362681340670335 25.125062531265634 64-65 22.823911955977987 25.41270635317659 26.350675337668832 25.41270635317659 66-67 22.298649324662332 25.56278139069535 26.463231615807903 25.67533766883442 68-69 22.67667292057536 25.19074421513446 26.36647904940588 25.7661038148843 70-71 22.679509632224168 25.756817613209908 26.044533400050035 25.519139354515886 72-73 21.999749718433236 25.50369165310975 25.991740708296835 26.50481792016018 74-75 22.1206810215323 25.97646469704557 26.70255383074612 25.200300450676018 76-77 22.629931120851595 25.823418910457107 25.823418910457107 25.72323105823419 78-79 22.15958912689465 26.030314418138545 26.28084679944883 25.529249655517976 80-81 22.86394387371586 25.444750689050366 26.509646705086443 25.181658732147334 82-83 23.596491228070178 25.588972431077693 26.090225563909776 24.724310776942357 84-85 22.362975040762574 25.272795685438354 26.56465571303148 25.79957356076759 86-87 23.25172630257376 25.009416195856875 26.17702448210923 25.56183301946014 88-89 22.93577981651376 26.316450923714967 25.838884001508106 24.908885258263165 90-91 23.249370277078086 24.77329974811083 25.75566750629723 26.221662468513856 92-93 23.681554377996466 24.703507443855667 26.24274539490285 25.37219278324502 94-95 23.789047679271533 25.433160490704438 25.92639433413431 24.851397495889717 96-97 23.195221148957803 25.94051855617692 25.34316217590239 25.521098118962886 98-99 24.163328595425764 24.202093293707197 25.7914459232459 25.843132187621137 100-101 24.353095316082545 11.791680314444807 32.03406485424173 31.821159515230917 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 3.0 29 6.0 30 6.5 31 7.5 32 9.0 33 18.0 34 25.0 35 27.0 36 47.5 37 65.5 38 81.0 39 105.5 40 123.5 41 151.0 42 186.0 43 198.0 44 206.5 45 221.0 46 215.5 47 207.5 48 199.0 49 195.5 50 174.0 51 146.5 52 155.0 53 143.5 54 120.0 55 116.5 56 110.0 57 94.5 58 81.5 59 85.5 60 82.5 61 68.5 62 55.5 63 48.5 64 47.0 65 45.0 66 41.0 67 27.5 68 18.0 69 16.0 70 11.0 71 4.0 72 2.5 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 1.0 70-71 1.0 72-73 2.0 74-75 1.0 76-77 1.0 78-79 1.0 80-81 1.0 82-83 3.0 84-85 3.0 86-87 5.0 88-89 5.0 90-91 9.0 92-93 9.0 94-95 16.0 96-97 36.0 98-99 389.0 100-101 3515.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.24560021013922 90.64999999999999 2 4.491725768321513 8.55 3 0.21013921723141582 0.6 4 0.052534804307853955 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791284 READS because READLEN < 1 Read 791284 spots for SRR12897268.sra Written 791284 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra Rejected 791273 READS because READLEN < 1 Read 791273 spots for SRR12897268.sra Written 791273 spots for SRR12897268.sra SRR ids: ['SRR12897268.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_teqzvfl7 SRR12897268.sra spots: 15825471 blocks: [[1, 791273], [791274, 1582546], [1582547, 2373819], [2373820, 3165092], [3165093, 3956365], [3956366, 4747638], [4747639, 5538911], [5538912, 6330184], [6330185, 7121457], [7121458, 7912730], [7912731, 8704003], [8704004, 9495276], [9495277, 10286549], [10286550, 11077822], [11077823, 11869095], [11869096, 12660368], [12660369, 13451641], [13451642, 14242914], [14242915, 15034187], [15034188, 15825471]] SRR12897268 file size 3787778 SRR12897268 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897268 SRR12897268_1.fastq Input file: SRR12897268_1.fastq trimmed: SRR12897268-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:34:58 2024 >> started Sat Dec 7 12:35:06 2024 >> done (7.958s) 15825471 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 1183 ( 0.01%) empty reads filtered out after trimming by size control 15824281 (99.99%) reads available; of these: 211 ( 0.00%) trimmed reads available after processing 15824070 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 27 0.00% 36 32 0.00% 37 38 0.00% 38 42 0.00% 39 45 0.00% 40 57 0.00% 41 59 0.00% 42 90 0.00% 43 75 0.00% 44 76 0.00% 45 92 0.00% 46 107 0.00% 47 113 0.00% 48 141 0.00% 49 128 0.00% 50 177 0.00% 51 200 0.00% 52 199 0.00% 53 223 0.00% 54 248 0.00% 55 251 0.00% 56 306 0.00% 57 336 0.00% 58 365 0.00% 59 409 0.00% 60 515 0.00% 61 549 0.00% 62 628 0.00% 63 728 0.00% 64 777 0.00% 65 860 0.01% 66 967 0.01% 67 1082 0.01% 68 1149 0.01% 69 1369 0.01% 70 1543 0.01% 71 1709 0.01% 72 1940 0.01% 73 2350 0.01% 74 2512 0.02% 75 3059 0.02% 76 3369 0.02% 77 3464 0.02% 78 3921 0.02% 79 4710 0.03% 80 4899 0.03% 81 5514 0.03% 82 6550 0.04% 83 7185 0.05% 84 8325 0.05% 85 9252 0.06% 86 9982 0.06% 87 11181 0.07% 88 12288 0.08% 89 13034 0.08% 90 14519 0.09% 91 16595 0.10% 92 16614 0.10% 93 19201 0.12% 94 21964 0.14% 95 24985 0.16% 96 45063 0.28% 97 99119 0.63% 98 313771 1.98% 99 1069207 6.76% 100 3733715 23.59% 101 10320273 65.22% 15824281 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=428.68 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=33.9 sequence=CTTCTTCTTGTC Started job on | Dec 07 12:35:23 Started mapping on | Dec 07 12:35:23 Finished on | Dec 07 12:35:39 Mapping speed, Million of reads per hour | 3560.46 Number of input reads | 15824281 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15358325 Uniquely mapped reads % | 97.06% Average mapped length | 100.10 Number of splices: Total | 5530728 Number of splices: Annotated (sjdb) | 5242074 Number of splices: GT/AG | 5453024 Number of splices: GC/AG | 66956 Number of splices: AT/AC | 2923 Number of splices: Non-canonical | 7825 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272571 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 96065 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 193385 193385 193385 N_multimapping 272571 272571 272571 N_noFeature 679275 15012617 787935 N_ambiguous 268648 1238 32367 UnstrandedReadsAssigned:14410402 PositiveStrandReadsAssigned:344470 NegativeStrandReadsAssigned:14538023 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897268 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897268-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,824,281 reads, 14,683,610 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR12897268.ke.tsv 35125 SRR12897268.se.tsv 88098 total ==> SRR12897268.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 86.2056 12.4722 PNS24247 1044 945 59.3342 7.6034 PNS24249 1928 1829 14.8638 0.984129 PNS24246 1044 945 59.3342 7.6034 PNS24248 1044 945 59.3342 7.6034 PNS24244 1471 1372 116.928 10.3205 PNS24243 293 194 0 0 KQK14069 1603 1504 2483.35 199.952 KQK14071 474 375 226.999 73.3039 ==> SRR12897268.se.tsv <== BRADI_1g14170v3 3117 BRADI_1g53295v3 96 BRADI_1g59795v3 361 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 1562 BRADI_1g74790v3 187 BRADI_1g09890v3 2 BRADI_1g77505v3 315 BRADI_1g48960v3 0 SRR12897268 completed mapping pipeline successfully