Starting /dee2/code/volunteer_pipeline.sh SRR12897269 current disk space = 1542797684736 free memory = 1604119256 SRR12897269 SRAfilesize 01d938fab5df49cf9c267251a7de9e49 SRR12897269.sra SRR12897269.sra file validated SRR12897269 is single end SRR12897269 is conventional basespace SRR12897269 read1 length is 43-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897269_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.70325 37.0 37.0 37.0 37.0 37.0 2 36.672 37.0 37.0 37.0 37.0 37.0 3 36.695 37.0 37.0 37.0 37.0 37.0 4 36.7515 37.0 37.0 37.0 37.0 37.0 5 36.797 37.0 37.0 37.0 37.0 37.0 6 36.792 37.0 37.0 37.0 37.0 37.0 7 36.7415 37.0 37.0 37.0 37.0 37.0 8 36.7375 37.0 37.0 37.0 37.0 37.0 9 36.748 37.0 37.0 37.0 37.0 37.0 10-11 36.75775 37.0 37.0 37.0 37.0 37.0 12-13 36.7095 37.0 37.0 37.0 37.0 37.0 14-15 36.772000000000006 37.0 37.0 37.0 37.0 37.0 16-17 36.74525 37.0 37.0 37.0 37.0 37.0 18-19 36.74325 37.0 37.0 37.0 37.0 37.0 20-21 36.77525 37.0 37.0 37.0 37.0 37.0 22-23 36.73675 37.0 37.0 37.0 37.0 37.0 24-25 36.72175 37.0 37.0 37.0 37.0 37.0 26-27 36.73325 37.0 37.0 37.0 37.0 37.0 28-29 36.70925 37.0 37.0 37.0 37.0 37.0 30-31 36.705 37.0 37.0 37.0 37.0 37.0 32-33 36.70025 37.0 37.0 37.0 37.0 37.0 34-35 36.736000000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.67575 37.0 37.0 37.0 37.0 37.0 38-39 36.70125 37.0 37.0 37.0 37.0 37.0 40-41 36.691500000000005 37.0 37.0 37.0 37.0 37.0 42-43 36.64075 37.0 37.0 37.0 37.0 37.0 44-45 36.68092023005751 37.0 37.0 37.0 37.0 37.0 46-47 36.64716179044761 37.0 37.0 37.0 37.0 37.0 48-49 36.67891972993248 37.0 37.0 37.0 37.0 37.0 50-51 36.71467866966742 37.0 37.0 37.0 37.0 37.0 52-53 36.668417104276074 37.0 37.0 37.0 37.0 37.0 54-55 36.67237669847677 37.0 37.0 37.0 37.0 37.0 56-57 36.69959979989995 37.0 37.0 37.0 37.0 37.0 58-59 36.650575287643825 37.0 37.0 37.0 37.0 37.0 60-61 36.652076038019004 37.0 37.0 37.0 37.0 37.0 62-63 36.64628367473704 37.0 37.0 37.0 37.0 37.0 64-65 36.71778834125594 37.0 37.0 37.0 37.0 37.0 66-67 36.632474355766824 37.0 37.0 37.0 37.0 37.0 68-69 36.600700525394046 37.0 37.0 37.0 37.0 37.0 70-71 36.60995746810107 37.0 37.0 37.0 37.0 37.0 72-73 36.64168064737242 37.0 37.0 37.0 37.0 37.0 74-75 36.66587814347514 37.0 37.0 37.0 37.0 37.0 76-77 36.561623246492985 37.0 37.0 37.0 37.0 37.0 78-79 36.572825269491105 37.0 37.0 37.0 37.0 37.0 80-81 36.63916750250752 37.0 37.0 37.0 37.0 37.0 82-83 36.62192674360261 37.0 37.0 37.0 37.0 37.0 84-85 36.5794818352464 37.0 37.0 37.0 37.0 37.0 86-87 36.61923312050855 37.0 37.0 37.0 37.0 37.0 88-89 36.65435717772444 37.0 37.0 37.0 37.0 37.0 90-91 36.60099848651704 37.0 37.0 37.0 37.0 37.0 92-93 36.609932339604875 37.0 37.0 37.0 37.0 37.0 94-95 36.55906728866799 37.0 37.0 37.0 37.0 37.0 96-97 36.62595620275923 37.0 37.0 37.0 37.0 37.0 98-99 36.61056355240753 37.0 37.0 37.0 37.0 37.0 100-101 36.5302412003722 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 0.0 26 1.0 27 4.0 28 3.0 29 8.0 30 10.0 31 11.0 32 17.0 33 35.0 34 40.0 35 110.0 36 2138.0 37 1621.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.084521130282575 12.228057014253563 4.026006501625407 45.66141535383846 2 18.8 12.525 40.175 28.499999999999996 3 17.675 15.5 27.325 39.5 4 23.575 24.0 23.200000000000003 29.225 5 24.925 29.275000000000002 24.05 21.75 6 22.05 34.125 21.675 22.15 7 16.825000000000003 24.725 41.55 16.900000000000002 8 19.650000000000002 21.95 32.25 26.150000000000002 9 19.6 20.849999999999998 34.425 25.124999999999996 10-11 23.1875 30.362499999999997 23.775 22.675 12-13 21.4125 23.799999999999997 28.0875 26.700000000000003 14-15 21.912499999999998 25.474999999999998 27.325 25.2875 16-17 22.95 25.362499999999997 26.337500000000002 25.35 18-19 23.0375 26.1125 25.424999999999997 25.424999999999997 20-21 22.325 25.912499999999998 26.775 24.9875 22-23 22.8 25.7 26.1625 25.337500000000002 24-25 22.287499999999998 25.9875 25.5625 26.1625 26-27 23.0 25.887500000000003 26.437500000000004 24.675 28-29 22.4625 25.4875 25.912499999999998 26.137500000000003 30-31 22.4875 26.5125 25.087500000000002 25.912499999999998 32-33 22.225 26.0625 26.6125 25.1 34-35 22.8625 26.9625 24.8125 25.362499999999997 36-37 22.8 25.624999999999996 25.724999999999998 25.85 38-39 23.05 26.237500000000004 25.5625 25.15 40-41 22.8625 26.3 26.174999999999997 24.6625 42-43 23.6375 25.45 25.474999999999998 25.4375 44-45 22.168042010502624 26.081520380095025 26.894223555888974 24.85621405351338 46-47 22.643160790197552 25.49387346836709 25.906476619154787 25.95648912228057 48-49 22.380595148787197 25.756439109777446 26.156539134783696 25.70642660665166 50-51 22.593148287071767 25.056264066016503 26.6816704176044 25.668917229307326 52-53 22.893223305826456 26.831707926981746 25.44386096524131 24.831207801950487 54-55 21.99574840565212 25.50956608728273 27.072652244591723 25.422033262473427 56-57 22.923961980990494 24.574787393696848 26.40070035017509 26.100550275137568 58-59 22.648824412206103 26.075537768884445 26.575787893946973 24.69984992496248 60-61 23.386693346673336 24.92496248124062 26.350675337668832 25.337668834417208 62-63 22.83927454659162 25.203252032520325 25.916197623514698 26.04127579737336 64-65 23.217413059794847 26.207155366524894 24.981235926945207 25.594195646735052 66-67 23.34250688016012 24.86865148861646 26.019514635976982 25.769326995246434 68-69 22.066549912434326 27.47060295221416 25.494120590442833 24.96872654490868 70-71 22.34175631723793 26.319739804853644 25.781836377282964 25.55666750062547 72-73 23.620668084574003 25.359689728512446 26.122857500312772 24.896784686600775 74-75 22.587911400325368 24.377424602678012 26.73007133024653 26.304592666750093 76-77 22.983466933867735 26.13977955911824 25.33817635270541 25.538577154308616 78-79 22.374028578591126 26.15943845575332 25.595387315116568 25.871145650538985 80-81 23.156970912738213 25.438816449348046 26.35406218655968 25.050150451354064 82-83 23.607626693426994 26.442548921224287 25.087807325639737 24.862017059708982 84-85 23.775433308214016 26.29992464204974 24.981160512434062 24.943481537302187 86-87 22.349534122387308 25.4973558297658 26.454293628808866 25.698816419038025 88-89 23.156435144333795 26.219589058363795 25.450649186940627 25.17332661036178 90-91 22.39089184060721 26.034155597722958 25.90765338393422 25.667299177735607 92-93 22.71746031746032 26.082539682539686 26.666666666666668 24.53333333333333 94-95 23.65002547121752 24.9745287824758 26.54100866021396 24.834437086092713 96-97 23.08774622665643 25.556408288564853 25.709900230237913 25.645945254540802 98-99 22.789911596463856 25.273010920436818 26.222048881955278 25.715028601144045 100-101 23.350666233344167 12.154696132596685 32.10919727006824 32.3854403639909 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 0.5 25 0.5 26 0.5 27 0.0 28 1.0 29 3.0 30 5.5 31 7.5 32 8.5 33 19.5 34 26.5 35 33.5 36 47.5 37 65.5 38 87.0 39 97.5 40 125.5 41 151.0 42 164.5 43 188.0 44 209.0 45 213.0 46 226.0 47 229.5 48 208.0 49 199.5 50 180.5 51 165.5 52 167.5 53 147.5 54 130.5 55 124.0 56 104.0 57 84.5 58 77.5 59 73.5 60 74.5 61 67.0 62 44.5 63 42.5 64 40.0 65 42.5 66 42.5 67 24.5 68 17.5 69 16.0 70 13.5 71 8.5 72 4.0 73 2.5 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 1.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 1.0 74-75 4.0 76-77 3.0 78-79 1.0 80-81 2.0 82-83 3.0 84-85 11.0 86-87 4.0 88-89 12.0 90-91 16.0 92-93 12.0 94-95 12.0 96-97 31.0 98-99 348.0 100-101 3537.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 94.61538461538461 89.17500000000001 2 4.694960212201591 8.85 3 0.6631299734748011 1.875 4 0.02652519893899204 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra Rejected 902495 READS because READLEN < 1 Read 902495 spots for SRR12897269.sra Written 902495 spots for SRR12897269.sra SRR ids: ['SRR12897269.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5d031lph SRR12897269.sra spots: 18049900 blocks: [[1, 902495], [902496, 1804990], [1804991, 2707485], [2707486, 3609980], [3609981, 4512475], [4512476, 5414970], [5414971, 6317465], [6317466, 7219960], [7219961, 8122455], [8122456, 9024950], [9024951, 9927445], [9927446, 10829940], [10829941, 11732435], [11732436, 12634930], [12634931, 13537425], [13537426, 14439920], [14439921, 15342415], [15342416, 16244910], [16244911, 17147405], [17147406, 18049900]] SRR12897269 file size 4319788 SRR12897269 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897269 SRR12897269_1.fastq Input file: SRR12897269_1.fastq trimmed: SRR12897269-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:36:09 2024 >> started Sat Dec 7 12:36:18 2024 >> done (9.177s) 18049900 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 1390 ( 0.01%) empty reads filtered out after trimming by size control 18048507 (99.99%) reads available; of these: 397 ( 0.00%) trimmed reads available after processing 18048110 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 2 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 32 0.00% 36 57 0.00% 37 60 0.00% 38 68 0.00% 39 73 0.00% 40 85 0.00% 41 80 0.00% 42 109 0.00% 43 95 0.00% 44 110 0.00% 45 120 0.00% 46 145 0.00% 47 186 0.00% 48 198 0.00% 49 259 0.00% 50 276 0.00% 51 322 0.00% 52 356 0.00% 53 355 0.00% 54 409 0.00% 55 403 0.00% 56 448 0.00% 57 587 0.00% 58 620 0.00% 59 771 0.00% 60 913 0.01% 61 1103 0.01% 62 1070 0.01% 63 1183 0.01% 64 1410 0.01% 65 1482 0.01% 66 1636 0.01% 67 1889 0.01% 68 2031 0.01% 69 2237 0.01% 70 2630 0.01% 71 2942 0.02% 72 3477 0.02% 73 3957 0.02% 74 4399 0.02% 75 4825 0.03% 76 5489 0.03% 77 6048 0.03% 78 6578 0.04% 79 7222 0.04% 80 7878 0.04% 81 8881 0.05% 82 10125 0.06% 83 11554 0.06% 84 13028 0.07% 85 14536 0.08% 86 15909 0.09% 87 17412 0.10% 88 19148 0.11% 89 20225 0.11% 90 22423 0.12% 91 25306 0.14% 92 25827 0.14% 93 28177 0.16% 94 32367 0.18% 95 37280 0.21% 96 59112 0.33% 97 122249 0.68% 98 370625 2.05% 99 1225126 6.79% 100 4246962 23.53% 101 11645593 64.52% 18048507 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.1 sequence=CCGCAGCTGCATCCAGATCCACAGCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=479.95 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=33.9 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:36:36 Started mapping on | Dec 07 12:36:37 Finished on | Dec 07 12:37:34 Mapping speed, Million of reads per hour | 1139.91 Number of input reads | 18048507 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15989390 Uniquely mapped reads % | 88.59% Average mapped length | 99.98 Number of splices: Total | 5566589 Number of splices: Annotated (sjdb) | 5294409 Number of splices: GT/AG | 5486989 Number of splices: GC/AG | 67157 Number of splices: AT/AC | 3482 Number of splices: Non-canonical | 8961 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230002 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 75736 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.68% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1829115 1829115 1829115 N_multimapping 230002 230002 230002 N_noFeature 672330 15595963 780481 N_ambiguous 308656 1051 25277 UnstrandedReadsAssigned:15008404 PositiveStrandReadsAssigned:392376 NegativeStrandReadsAssigned:15183632 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897269 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897269-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,048,507 reads, 15,306,982 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,299 rounds 52973 SRR12897269.ke.tsv 35125 SRR12897269.se.tsv 88098 total ==> SRR12897269.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 31.7511 4.2899 PNS24247 1044 945 81.6522 9.77126 PNS24249 1928 1829 20.6108 1.27437 PNS24246 1044 945 81.6522 9.77126 PNS24248 1044 945 81.6522 9.77126 PNS24244 1471 1372 163.681 13.4915 PNS24243 293 194 0 0 KQK14069 1603 1504 3593.01 270.163 KQK14071 474 375 233.791 70.5034 ==> SRR12897269.se.tsv <== BRADI_1g14170v3 4220 BRADI_1g53295v3 81 BRADI_1g59795v3 509 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 540 BRADI_1g74790v3 140 BRADI_1g09890v3 0 BRADI_1g77505v3 114 BRADI_1g48960v3 0 SRR12897269 completed mapping pipeline successfully