Starting /dee2/code/volunteer_pipeline.sh SRR12897270 current disk space = 1543031861248 free memory = 1602403804 SRR12897270 SRAfilesize 704e8305ad3394c105919b38b90eea27 SRR12897270.sra SRR12897270.sra file validated SRR12897270 is single end SRR12897270 is conventional basespace SRR12897270 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897270_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.72875 37.0 37.0 37.0 37.0 37.0 2 36.58975 37.0 37.0 37.0 37.0 37.0 3 36.70775 37.0 37.0 37.0 37.0 37.0 4 36.72725 37.0 37.0 37.0 37.0 37.0 5 36.78375 37.0 37.0 37.0 37.0 37.0 6 36.73775 37.0 37.0 37.0 37.0 37.0 7 36.68825 37.0 37.0 37.0 37.0 37.0 8 36.72875 37.0 37.0 37.0 37.0 37.0 9 36.75375 37.0 37.0 37.0 37.0 37.0 10-11 36.72775 37.0 37.0 37.0 37.0 37.0 12-13 36.735749999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.7415 37.0 37.0 37.0 37.0 37.0 16-17 36.7535 37.0 37.0 37.0 37.0 37.0 18-19 36.736000000000004 37.0 37.0 37.0 37.0 37.0 20-21 36.716499999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.7185 37.0 37.0 37.0 37.0 37.0 24-25 36.70425 37.0 37.0 37.0 37.0 37.0 26-27 36.729 37.0 37.0 37.0 37.0 37.0 28-29 36.676 37.0 37.0 37.0 37.0 37.0 30-31 36.691500000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.72325 37.0 37.0 37.0 37.0 37.0 34-35 36.71275 37.0 37.0 37.0 37.0 37.0 36-37 36.69517379344836 37.0 37.0 37.0 37.0 37.0 38-39 36.69092273068267 37.0 37.0 37.0 37.0 37.0 40-41 36.70142535633909 37.0 37.0 37.0 37.0 37.0 42-43 36.7119279819955 37.0 37.0 37.0 37.0 37.0 44-45 36.71292823205802 37.0 37.0 37.0 37.0 37.0 46-47 36.6816704176044 37.0 37.0 37.0 37.0 37.0 48-49 36.70492623155789 37.0 37.0 37.0 37.0 37.0 50-51 36.68892223055764 37.0 37.0 37.0 37.0 37.0 52-53 36.68242060515129 37.0 37.0 37.0 37.0 37.0 54-55 36.716429107276824 37.0 37.0 37.0 37.0 37.0 56-57 36.67891972993249 37.0 37.0 37.0 37.0 37.0 58-59 36.63790947736934 37.0 37.0 37.0 37.0 37.0 60-61 36.67425569176883 37.0 37.0 37.0 37.0 37.0 62-63 36.658861364493404 37.0 37.0 37.0 37.0 37.0 64-65 36.712819228843266 37.0 37.0 37.0 37.0 37.0 66-67 36.62233909341347 37.0 37.0 37.0 37.0 37.0 68-69 36.63060355622339 37.0 37.0 37.0 37.0 37.0 70-71 36.620056508442566 37.0 37.0 37.0 37.0 37.0 72-73 36.6527951867636 37.0 37.0 37.0 37.0 37.0 74-75 36.66248746238716 37.0 37.0 37.0 37.0 37.0 76-77 36.65362029389725 37.0 37.0 37.0 37.0 37.0 78-79 36.58572088184245 37.0 37.0 37.0 37.0 37.0 80-81 36.578734244678984 37.0 37.0 37.0 37.0 37.0 82-83 36.670484609413364 37.0 37.0 37.0 37.0 37.0 84-85 36.658791805859494 37.0 37.0 37.0 37.0 37.0 86-87 36.55298010414833 37.0 37.0 37.0 37.0 37.0 88-89 36.5997079568897 37.0 37.0 37.0 37.0 37.0 90-91 36.61631221737278 37.0 37.0 37.0 37.0 37.0 92-93 36.57251098037309 37.0 37.0 37.0 37.0 37.0 94-95 36.592999068857836 37.0 37.0 37.0 37.0 37.0 96-97 36.56225450256825 37.0 37.0 37.0 37.0 37.0 98-99 36.600382517800334 37.0 37.0 37.0 37.0 37.0 100-101 36.51296312125694 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 6.0 28 3.0 29 7.0 30 5.0 31 12.0 32 21.0 33 24.0 34 43.0 35 107.0 36 2179.0 37 1589.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.15436577433075 11.558669001751314 4.953715286464848 44.33324993745309 2 19.479869967491872 12.578144536134033 37.95948987246812 29.982495623905976 3 17.22930732683171 14.003500875218805 27.031757939484873 41.73543385846462 4 24.20605151287822 22.605651412853213 23.455863965991497 29.732433108277068 5 26.806701675418854 27.93198299574894 23.355838959739934 21.905476369092273 6 22.380595148787197 31.932983245811453 22.20555138784696 23.48087021755439 7 19.229807451862964 23.25581395348837 39.40985246311578 18.104526131532882 8 19.954988747186796 23.755938984746187 30.682670667666915 25.6064016004001 9 19.879969992498125 20.855213803450862 34.83370842710677 24.431107776944234 10-11 23.418354588647162 30.657664416104026 23.093273318329583 22.83070767691923 12-13 21.717929482370593 23.34333583395849 27.70692673168292 27.231807951987996 14-15 22.43060765191298 25.70642660665166 26.494123530882717 25.36884221055264 16-17 24.343585896474117 24.893723430857715 25.918979744936234 24.843710927731934 18-19 23.48087021755439 25.55638909727432 25.85646411602901 25.10627656914228 20-21 23.34333583395849 25.35633908477119 26.219054763690924 25.081270317579396 22-23 22.48062015503876 26.219054763690924 26.144036009002253 25.156289072268066 24-25 23.093273318329583 26.03150787696924 25.44386096524131 25.431357839459867 26-27 22.818204551137786 25.881470367591895 26.144036009002253 25.156289072268066 28-29 23.118279569892472 25.893973493373345 26.30657664416104 24.681170292573142 30-31 23.168292073018254 25.506376594148538 25.6064016004001 25.71892973243311 32-33 22.50562640660165 25.681420355088775 25.618904726181547 26.19404851212803 34-35 23.018254563640912 24.968742185546386 26.294073518379594 25.71892973243311 36-37 22.893223305826456 26.506626656664167 24.731182795698924 25.868967241810452 38-39 22.718179544886222 25.568892223055762 25.76894223555889 25.943985996499126 40-41 22.88072018004501 25.64391097774444 25.36884221055264 26.106526631657918 42-43 23.20580145036259 26.469117279319832 24.456114028507127 25.868967241810452 44-45 22.005501375343837 26.11902975743936 25.44386096524131 26.431607901975497 46-47 23.355838959739934 26.531632908227053 25.51887971992998 24.593648412103025 48-49 22.780695173793447 26.30657664416104 25.93148287071768 24.981245311327832 50-51 22.080520130032507 25.893973493373345 26.469117279319832 25.55638909727432 52-53 22.61815453863466 26.16904226056514 26.006501625406354 25.206301575393848 54-55 22.143035758939735 25.431357839459867 26.056514128532132 26.36909227306827 56-57 22.630657664416105 26.04401100275069 25.881470367591895 25.44386096524131 58-59 22.50562640660165 25.993998499624904 26.231557889472366 25.268817204301076 60-61 22.554415811858895 26.1195896922692 24.668501376032022 26.65749311983988 62-63 22.82567888874984 26.59241646852709 25.804029533224877 24.777875109498186 64-65 22.97195793690536 26.552328492739107 26.41462193289935 24.061091637456183 66-67 22.489356373653894 26.183320811419986 25.85775106436263 25.469571750563485 68-69 23.140495867768596 26.383671424993736 25.244177310293015 25.231655396944653 70-71 23.784461152882205 25.112781954887218 25.75187969924812 25.35087719298246 72-73 22.837803960892455 25.457508147405367 26.222110804712962 25.482577086989224 74-75 22.179037111334 26.253761283851556 26.241223671013035 25.325977933801404 76-77 22.573363431151243 25.369952345121643 26.486079759217457 25.570604464509657 78-79 22.93497363796134 25.847351242781823 25.671604318353005 25.54607080090384 80-81 22.043483725021993 25.51212768631394 26.743747643584264 25.700640945079805 82-83 22.945248584015104 24.984266834487098 25.966016362492134 26.104468219005668 84-85 22.985752111965706 25.97402597402597 25.923590972134665 25.11663094187366 86-87 23.020583406995833 26.56901123879278 26.36696552595025 24.043439828261143 88-89 22.746835443037973 25.721518987341774 25.78481012658228 25.746835443037973 90-91 22.90687333248634 26.98513530682251 24.7617837631813 25.346207597509846 92-93 23.06810948440484 25.334182049649907 25.99618077657543 25.60152768936983 94-95 22.288849196223527 25.886705792293952 26.881857616738962 24.94258739474356 96-97 22.055619633474304 24.92631039343842 27.233115468409586 25.78495450467769 98-99 22.53797799895233 23.91304347826087 27.13462545835516 26.41435306443164 100-101 23.9672131147541 11.540983606557377 32.0327868852459 32.459016393442624 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 2.5 30 5.0 31 7.0 32 9.5 33 17.0 34 26.5 35 38.5 36 54.5 37 70.0 38 77.5 39 90.0 40 113.5 41 141.0 42 173.5 43 191.5 44 200.0 45 216.0 46 228.5 47 221.0 48 211.5 49 197.5 50 174.5 51 165.5 52 153.5 53 147.0 54 138.5 55 116.0 56 102.5 57 90.0 58 79.0 59 75.0 60 72.0 61 69.5 62 54.0 63 47.0 64 52.0 65 44.0 66 30.0 67 26.5 68 25.0 69 19.0 70 15.5 71 8.0 72 3.5 73 3.0 74 4.0 75 3.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 2.0 60-61 1.0 62-63 2.0 64-65 1.0 66-67 0.0 68-69 2.0 70-71 2.0 72-73 1.0 74-75 0.0 76-77 3.0 78-79 6.0 80-81 4.0 82-83 8.0 84-85 7.0 86-87 7.0 88-89 16.0 90-91 7.0 92-93 9.0 94-95 12.0 96-97 45.0 98-99 353.0 100-101 3511.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.43307086614173 90.9 2 4.225721784776903 8.05 3 0.26246719160104987 0.75 4 0.07874015748031496 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919447 READS because READLEN < 1 Read 919447 spots for SRR12897270.sra Written 919447 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra Rejected 919443 READS because READLEN < 1 Read 919443 spots for SRR12897270.sra Written 919443 spots for SRR12897270.sra SRR ids: ['SRR12897270.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tihutkh7 SRR12897270.sra spots: 18388864 blocks: [[1, 919443], [919444, 1838886], [1838887, 2758329], [2758330, 3677772], [3677773, 4597215], [4597216, 5516658], [5516659, 6436101], [6436102, 7355544], [7355545, 8274987], [8274988, 9194430], [9194431, 10113873], [10113874, 11033316], [11033317, 11952759], [11952760, 12872202], [12872203, 13791645], [13791646, 14711088], [14711089, 15630531], [15630532, 16549974], [16549975, 17469417], [17469418, 18388864]] SRR12897270 file size 4398260 SRR12897270 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897270 SRR12897270_1.fastq Input file: SRR12897270_1.fastq trimmed: SRR12897270-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:37:18 2024 >> started Sat Dec 7 12:37:28 2024 >> done (9.681s) 18388864 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 2139 ( 0.01%) empty reads filtered out after trimming by size control 18386720 (99.99%) reads available; of these: 366 ( 0.00%) trimmed reads available after processing 18386354 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 4 0.00% 33 0 0.00% 34 1 0.00% 35 53 0.00% 36 41 0.00% 37 42 0.00% 38 57 0.00% 39 66 0.00% 40 90 0.00% 41 67 0.00% 42 101 0.00% 43 111 0.00% 44 92 0.00% 45 128 0.00% 46 150 0.00% 47 184 0.00% 48 227 0.00% 49 285 0.00% 50 350 0.00% 51 405 0.00% 52 450 0.00% 53 456 0.00% 54 451 0.00% 55 493 0.00% 56 619 0.00% 57 602 0.00% 58 832 0.00% 59 1014 0.01% 60 1161 0.01% 61 1414 0.01% 62 1541 0.01% 63 1581 0.01% 64 1741 0.01% 65 1885 0.01% 66 2000 0.01% 67 2318 0.01% 68 2670 0.01% 69 3007 0.02% 70 3486 0.02% 71 4000 0.02% 72 4485 0.02% 73 5218 0.03% 74 5549 0.03% 75 6144 0.03% 76 6959 0.04% 77 7649 0.04% 78 8340 0.05% 79 9384 0.05% 80 10495 0.06% 81 11492 0.06% 82 13403 0.07% 83 14942 0.08% 84 16338 0.09% 85 18205 0.10% 86 19966 0.11% 87 22106 0.12% 88 24002 0.13% 89 26141 0.14% 90 28263 0.15% 91 31287 0.17% 92 32140 0.17% 93 34507 0.19% 94 39988 0.22% 95 44775 0.24% 96 67843 0.37% 97 134499 0.73% 98 387761 2.11% 99 1257787 6.84% 100 4311528 23.45% 101 11751343 63.91% 18386720 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.44 prefix-fanout=2.0 sequence=GTGCAGTTTGAGCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=43.09 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.2 sequence=TCCTCTTCTTCCTCCT Started job on | Dec 07 12:37:51 Started mapping on | Dec 07 12:37:52 Finished on | Dec 07 12:38:18 Mapping speed, Million of reads per hour | 2545.85 Number of input reads | 18386720 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17478431 Uniquely mapped reads % | 95.06% Average mapped length | 99.89 Number of splices: Total | 5753935 Number of splices: Annotated (sjdb) | 5452189 Number of splices: GT/AG | 5659526 Number of splices: GC/AG | 82665 Number of splices: AT/AC | 3345 Number of splices: Non-canonical | 8399 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260012 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 137078 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 648277 648277 648277 N_multimapping 260012 260012 260012 N_noFeature 718770 16999540 843886 N_ambiguous 378752 1250 25796 UnstrandedReadsAssigned:16380909 PositiveStrandReadsAssigned:477641 NegativeStrandReadsAssigned:16608749 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897270 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897270-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,386,720 reads, 16,740,881 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR12897270.ke.tsv 35125 SRR12897270.se.tsv 88098 total ==> SRR12897270.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 159.971 19.4068 PNS24247 1044 945 63.3236 6.80412 PNS24249 1928 1829 21.0508 1.16867 PNS24246 1044 945 63.3236 6.80412 PNS24248 1044 945 63.3236 6.80412 PNS24244 1471 1372 192.007 14.2103 PNS24243 293 194 0 0 KQK14069 1603 1504 14677 990.898 KQK14071 474 375 436.594 118.218 ==> SRR12897270.se.tsv <== BRADI_1g14170v3 15955 BRADI_1g53295v3 58 BRADI_1g59795v3 333 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 365 BRADI_1g74790v3 100 BRADI_1g09890v3 0 BRADI_1g77505v3 142 BRADI_1g48960v3 0 SRR12897270 completed mapping pipeline successfully