Starting /dee2/code/volunteer_pipeline.sh SRR12897271 current disk space = 1543112421376 free memory = 1598092828 SRR12897271 SRAfilesize ca16435f87ed17fad8ecdccfa2fe93d0 SRR12897271.sra SRR12897271.sra file validated SRR12897271 is single end SRR12897271 is conventional basespace SRR12897271 read1 length is 68-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897271_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.688 37.0 37.0 37.0 37.0 37.0 2 36.632 37.0 37.0 37.0 37.0 37.0 3 36.77 37.0 37.0 37.0 37.0 37.0 4 36.7335 37.0 37.0 37.0 37.0 37.0 5 36.7565 37.0 37.0 37.0 37.0 37.0 6 36.721 37.0 37.0 37.0 37.0 37.0 7 36.746 37.0 37.0 37.0 37.0 37.0 8 36.7255 37.0 37.0 37.0 37.0 37.0 9 36.704 37.0 37.0 37.0 37.0 37.0 10-11 36.748000000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.686499999999995 37.0 37.0 37.0 37.0 37.0 14-15 36.761250000000004 37.0 37.0 37.0 37.0 37.0 16-17 36.7245 37.0 37.0 37.0 37.0 37.0 18-19 36.754 37.0 37.0 37.0 37.0 37.0 20-21 36.72775 37.0 37.0 37.0 37.0 37.0 22-23 36.724999999999994 37.0 37.0 37.0 37.0 37.0 24-25 36.74725 37.0 37.0 37.0 37.0 37.0 26-27 36.69475 37.0 37.0 37.0 37.0 37.0 28-29 36.710750000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.69425 37.0 37.0 37.0 37.0 37.0 32-33 36.70475 37.0 37.0 37.0 37.0 37.0 34-35 36.695750000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.667500000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.669 37.0 37.0 37.0 37.0 37.0 40-41 36.689750000000004 37.0 37.0 37.0 37.0 37.0 42-43 36.670249999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.66825 37.0 37.0 37.0 37.0 37.0 46-47 36.69 37.0 37.0 37.0 37.0 37.0 48-49 36.6815 37.0 37.0 37.0 37.0 37.0 50-51 36.685 37.0 37.0 37.0 37.0 37.0 52-53 36.661500000000004 37.0 37.0 37.0 37.0 37.0 54-55 36.6375 37.0 37.0 37.0 37.0 37.0 56-57 36.660250000000005 37.0 37.0 37.0 37.0 37.0 58-59 36.585750000000004 37.0 37.0 37.0 37.0 37.0 60-61 36.68 37.0 37.0 37.0 37.0 37.0 62-63 36.62375 37.0 37.0 37.0 37.0 37.0 64-65 36.64125 37.0 37.0 37.0 37.0 37.0 66-67 36.687 37.0 37.0 37.0 37.0 37.0 68-69 36.63120142535634 37.0 37.0 37.0 37.0 37.0 70-71 36.59729864932466 37.0 37.0 37.0 37.0 37.0 72-73 36.62321741305979 37.0 37.0 37.0 37.0 37.0 74-75 36.638888888888886 37.0 37.0 37.0 37.0 37.0 76-77 36.64012376279851 37.0 37.0 37.0 37.0 37.0 78-79 36.59769907316537 37.0 37.0 37.0 37.0 37.0 80-81 36.59774153074028 37.0 37.0 37.0 37.0 37.0 82-83 36.573462788603265 37.0 37.0 37.0 37.0 37.0 84-85 36.61896881947216 37.0 37.0 37.0 37.0 37.0 86-87 36.588011888511424 37.0 37.0 37.0 37.0 37.0 88-89 36.608529590119204 37.0 37.0 37.0 37.0 37.0 90-91 36.58373499475336 37.0 37.0 37.0 37.0 37.0 92-93 36.58378291105336 37.0 37.0 37.0 37.0 37.0 94-95 36.57828603698998 37.0 37.0 37.0 37.0 37.0 96-97 36.61988157289227 37.0 37.0 37.0 37.0 37.0 98-99 36.62237773659219 37.0 37.0 37.0 37.0 37.0 100-101 36.53055284101431 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 4.0 27 2.0 28 5.0 29 9.0 30 13.0 31 23.0 32 16.0 33 26.0 34 46.0 35 97.0 36 2019.0 37 1739.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.51875937968984 11.405702851425712 4.527263631815908 46.54827413706853 2 20.275000000000002 13.05 38.7 27.975 3 18.775 15.1 25.825 40.300000000000004 4 24.65 23.3 22.775000000000002 29.275000000000002 5 25.724999999999998 28.275 24.925 21.075 6 21.975 30.025000000000002 23.3 24.7 7 17.65 24.3 39.800000000000004 18.25 8 18.65 23.075000000000003 33.425 24.85 9 19.55 20.875 34.825 24.75 10-11 22.412499999999998 30.45 23.974999999999998 23.1625 12-13 23.3125 23.775 27.5125 25.4 14-15 21.8125 24.3 28.15 25.7375 16-17 21.4 26.0625 26.424999999999997 26.1125 18-19 22.85 25.9875 25.424999999999997 25.7375 20-21 22.6125 25.8 25.937500000000004 25.650000000000002 22-23 22.975 26.4125 25.95 24.6625 24-25 22.6875 24.65 25.8625 26.8 26-27 21.587500000000002 26.450000000000003 27.150000000000002 24.8125 28-29 22.775000000000002 25.337500000000002 26.224999999999998 25.662499999999998 30-31 22.1875 25.637500000000003 26.05 26.125 32-33 22.237499999999997 24.887500000000003 27.187499999999996 25.687500000000004 34-35 22.7625 24.9 25.8 26.5375 36-37 22.3875 25.7625 25.4625 26.387500000000003 38-39 22.025 25.4375 26.5 26.0375 40-41 22.787499999999998 25.55 25.775 25.887500000000003 42-43 22.675 25.7125 25.55 26.0625 44-45 22.275 25.45 26.275 26.0 46-47 23.3125 25.825 25.624999999999996 25.2375 48-49 23.075000000000003 25.7625 25.112499999999997 26.05 50-51 22.1 26.150000000000002 26.337500000000002 25.412499999999998 52-53 23.525 25.7625 25.9875 24.725 54-55 22.75 25.4 26.05 25.8 56-57 22.4625 24.925 27.224999999999998 25.387500000000003 58-59 22.925 25.6125 25.7625 25.7 60-61 23.3875 25.35 25.387500000000003 25.874999999999996 62-63 23.8375 25.337500000000002 25.924999999999997 24.9 64-65 22.662499999999998 25.424999999999997 26.5 25.412499999999998 66-67 23.4875 25.087500000000002 25.4875 25.937500000000004 68-69 22.440305038129765 26.215776972121514 26.31578947368421 25.028128516064506 70-71 23.499249624812407 25.200100050025014 25.900450225112557 25.400200100050025 72-73 22.654490868151115 25.606705028771582 25.168876657493122 26.56992744558419 74-75 22.71021021021021 25.763263263263266 26.526526526526528 25.0 76-77 23.002754820936637 25.945404457801153 25.331830703731526 25.720010017530683 78-79 22.32109286878055 25.654843965409196 25.466850482516605 26.557212683293645 80-81 22.358845671267254 25.671267252195733 26.336260978670012 25.633626097867 82-83 23.49912082391359 25.131876412961567 25.584024114544086 25.784978648580758 84-85 23.681892538064677 25.27997986661633 26.248898955580724 24.789228639738266 86-87 23.585737684263574 25.18583847801436 25.81579942043593 25.41262441728613 88-89 23.654283548142534 26.055092241597173 25.638109679049787 24.652514531210514 90-91 23.82580073427016 25.104443600455756 25.16774275224712 25.90201291302697 92-93 23.727953305418094 24.514655500570996 26.532165968785687 25.225225225225223 94-95 23.628960427535308 24.875938414556558 26.73368112991475 24.761420027993385 96-97 22.478238607270864 25.332821300563236 26.280081925243216 25.908858166922684 98-99 23.73809834355028 24.06417112299465 26.803182470327375 25.394548063127694 100-101 23.501159324279563 11.725736999006294 32.47764160317986 32.29546207353428 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 0.5 27 2.5 28 4.0 29 6.5 30 8.5 31 7.5 32 10.5 33 14.0 34 19.5 35 29.0 36 41.5 37 62.5 38 83.0 39 90.5 40 97.5 41 142.0 42 168.5 43 193.0 44 226.0 45 220.0 46 221.0 47 221.0 48 213.0 49 201.5 50 184.0 51 172.0 52 156.5 53 135.0 54 129.0 55 119.5 56 101.0 57 86.0 58 73.5 59 76.0 60 78.0 61 68.5 62 59.5 63 52.5 64 48.5 65 48.0 66 42.5 67 37.5 68 28.0 69 15.0 70 11.5 71 7.5 72 3.0 73 2.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 68 1.0 69 1.0 70 0.0 71 1.0 72 0.0 73 1.0 74 0.0 75 2.0 76 2.0 77 1.0 78 3.0 79 3.0 80 0.0 81 2.0 82 4.0 83 4.0 84 3.0 85 1.0 86 5.0 87 7.0 88 4.0 89 3.0 90 5.0 91 4.0 92 5.0 93 3.0 94 11.0 95 13.0 96 10.0 97 32.0 98 71.0 99 309.0 100 940.0 101 2549.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57528446679015 89.35 2 5.027785128340831 9.5 3 0.37046837787774545 1.05 4 0.02646202699126753 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCCT 25 0.004912736 56.2575 7 >>END_MODULE Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra Rejected 860643 READS because READLEN < 1 Read 860643 spots for SRR12897271.sra Written 860643 spots for SRR12897271.sra SRR ids: ['SRR12897271.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8jxxo0be SRR12897271.sra spots: 17212860 blocks: [[1, 860643], [860644, 1721286], [1721287, 2581929], [2581930, 3442572], [3442573, 4303215], [4303216, 5163858], [5163859, 6024501], [6024502, 6885144], [6885145, 7745787], [7745788, 8606430], [8606431, 9467073], [9467074, 10327716], [10327717, 11188359], [11188360, 12049002], [12049003, 12909645], [12909646, 13770288], [13770289, 14630931], [14630932, 15491574], [15491575, 16352217], [16352218, 17212860]] SRR12897271 file size 4116381 SRR12897271 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897271 SRR12897271_1.fastq Input file: SRR12897271_1.fastq trimmed: SRR12897271-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:39:56 2024 >> started Sat Dec 7 12:40:05 2024 >> done (9.224s) 17212860 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 2254 ( 0.01%) empty reads filtered out after trimming by size control 17210605 (99.99%) reads available; of these: 341 ( 0.00%) trimmed reads available after processing 17210264 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 0 0.00% 35 35 0.00% 36 41 0.00% 37 61 0.00% 38 68 0.00% 39 56 0.00% 40 85 0.00% 41 96 0.00% 42 97 0.00% 43 80 0.00% 44 98 0.00% 45 99 0.00% 46 125 0.00% 47 173 0.00% 48 185 0.00% 49 233 0.00% 50 281 0.00% 51 293 0.00% 52 323 0.00% 53 370 0.00% 54 362 0.00% 55 442 0.00% 56 499 0.00% 57 590 0.00% 58 727 0.00% 59 852 0.00% 60 964 0.01% 61 1154 0.01% 62 1176 0.01% 63 1396 0.01% 64 1495 0.01% 65 1635 0.01% 66 1872 0.01% 67 2125 0.01% 68 2333 0.01% 69 2713 0.02% 70 3054 0.02% 71 3481 0.02% 72 3990 0.02% 73 4581 0.03% 74 5098 0.03% 75 5758 0.03% 76 6481 0.04% 77 7006 0.04% 78 7863 0.05% 79 8644 0.05% 80 9313 0.05% 81 10529 0.06% 82 12152 0.07% 83 13717 0.08% 84 15314 0.09% 85 17069 0.10% 86 18284 0.11% 87 20021 0.12% 88 21320 0.12% 89 22318 0.13% 90 24961 0.15% 91 27889 0.16% 92 28247 0.16% 93 31025 0.18% 94 34705 0.20% 95 39360 0.23% 96 60509 0.35% 97 120893 0.70% 98 357642 2.08% 99 1166051 6.78% 100 4021050 23.36% 101 11059136 64.26% 17210605 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.2 sequence=CCGCAGCTGCATCCAGATCCACAGCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=436.25 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=33.3 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:40:23 Started mapping on | Dec 07 12:40:24 Finished on | Dec 07 12:41:44 Mapping speed, Million of reads per hour | 774.48 Number of input reads | 17210605 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15339862 Uniquely mapped reads % | 89.13% Average mapped length | 99.91 Number of splices: Total | 5294392 Number of splices: Annotated (sjdb) | 5029855 Number of splices: GT/AG | 5217826 Number of splices: GC/AG | 64455 Number of splices: AT/AC | 3134 Number of splices: Non-canonical | 8977 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.54 Insertion rate per base | 0.01% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207679 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 60838 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.28% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1663064 1663064 1663064 N_multimapping 207679 207679 207679 N_noFeature 623364 14959955 729839 N_ambiguous 295910 1047 24370 UnstrandedReadsAssigned:14420588 PositiveStrandReadsAssigned:378860 NegativeStrandReadsAssigned:14585653 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897271 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897271-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,210,605 reads, 14,690,323 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR12897271.ke.tsv 35125 SRR12897271.se.tsv 88098 total ==> SRR12897271.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 115.223 16.094 PNS24247 1044 945 40.2233 4.97618 PNS24249 1928 1829 14.6257 0.93487 PNS24246 1044 945 40.2233 4.97618 PNS24248 1044 945 40.2233 4.97618 PNS24244 1471 1372 190.481 16.2311 PNS24243 293 194 0 0 KQK14069 1603 1504 3603.83 280.135 KQK14071 474 375 223.055 69.5395 ==> SRR12897271.se.tsv <== BRADI_1g14170v3 4210 BRADI_1g53295v3 55 BRADI_1g59795v3 428 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 423 BRADI_1g74790v3 157 BRADI_1g09890v3 0 BRADI_1g77505v3 126 BRADI_1g48960v3 0 SRR12897271 completed mapping pipeline successfully