Starting /dee2/code/volunteer_pipeline.sh SRR12897272 current disk space = 1543110656000 free memory = 1603956772 SRR12897272 SRAfilesize 2b2ac6d1921e4ff4525c3c8fb6975a4a SRR12897272.sra SRR12897272.sra file validated SRR12897272 is single end SRR12897272 is conventional basespace SRR12897272 read1 length is 52-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897272_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66025 37.0 37.0 37.0 37.0 37.0 2 36.5665 37.0 37.0 37.0 37.0 37.0 3 36.7535 37.0 37.0 37.0 37.0 37.0 4 36.7655 37.0 37.0 37.0 37.0 37.0 5 36.7665 37.0 37.0 37.0 37.0 37.0 6 36.7215 37.0 37.0 37.0 37.0 37.0 7 36.7325 37.0 37.0 37.0 37.0 37.0 8 36.731 37.0 37.0 37.0 37.0 37.0 9 36.696 37.0 37.0 37.0 37.0 37.0 10-11 36.7345 37.0 37.0 37.0 37.0 37.0 12-13 36.721000000000004 37.0 37.0 37.0 37.0 37.0 14-15 36.7615 37.0 37.0 37.0 37.0 37.0 16-17 36.72775 37.0 37.0 37.0 37.0 37.0 18-19 36.7685 37.0 37.0 37.0 37.0 37.0 20-21 36.72375 37.0 37.0 37.0 37.0 37.0 22-23 36.70975 37.0 37.0 37.0 37.0 37.0 24-25 36.7085 37.0 37.0 37.0 37.0 37.0 26-27 36.656000000000006 37.0 37.0 37.0 37.0 37.0 28-29 36.70875 37.0 37.0 37.0 37.0 37.0 30-31 36.68075 37.0 37.0 37.0 37.0 37.0 32-33 36.643 37.0 37.0 37.0 37.0 37.0 34-35 36.739000000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.663 37.0 37.0 37.0 37.0 37.0 38-39 36.65875 37.0 37.0 37.0 37.0 37.0 40-41 36.7115 37.0 37.0 37.0 37.0 37.0 42-43 36.6635 37.0 37.0 37.0 37.0 37.0 44-45 36.636250000000004 37.0 37.0 37.0 37.0 37.0 46-47 36.643 37.0 37.0 37.0 37.0 37.0 48-49 36.62925 37.0 37.0 37.0 37.0 37.0 50-51 36.6695 37.0 37.0 37.0 37.0 37.0 52-53 36.65770617654414 37.0 37.0 37.0 37.0 37.0 54-55 36.63965991497874 37.0 37.0 37.0 37.0 37.0 56-57 36.667416854213556 37.0 37.0 37.0 37.0 37.0 58-59 36.60315078769692 37.0 37.0 37.0 37.0 37.0 60-61 36.68251188391294 37.0 37.0 37.0 37.0 37.0 62-63 36.623967975981984 37.0 37.0 37.0 37.0 37.0 64-65 36.659494620965724 37.0 37.0 37.0 37.0 37.0 66-67 36.63092552146843 37.0 37.0 37.0 37.0 37.0 68-69 36.63509354160168 37.0 37.0 37.0 37.0 37.0 70-71 36.593241551939926 37.0 37.0 37.0 37.0 37.0 72-73 36.59539308963445 37.0 37.0 37.0 37.0 37.0 74-75 36.65726767993516 37.0 37.0 37.0 37.0 37.0 76-77 36.62416839691403 37.0 37.0 37.0 37.0 37.0 78-79 36.637390213299874 37.0 37.0 37.0 37.0 37.0 80-81 36.5865437017969 37.0 37.0 37.0 37.0 37.0 82-83 36.59994977398292 37.0 37.0 37.0 37.0 37.0 84-85 36.59952131113354 37.0 37.0 37.0 37.0 37.0 86-87 36.594473530472314 37.0 37.0 37.0 37.0 37.0 88-89 36.63098982488687 37.0 37.0 37.0 37.0 37.0 90-91 36.64641977808395 37.0 37.0 37.0 37.0 37.0 92-93 36.56684511387704 37.0 37.0 37.0 37.0 37.0 94-95 36.581123721029485 37.0 37.0 37.0 37.0 37.0 96-97 36.61469457875069 37.0 37.0 37.0 37.0 37.0 98-99 36.62873425327281 37.0 37.0 37.0 37.0 37.0 100-101 36.531042574385545 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 0.0 26 0.0 27 4.0 28 6.0 29 5.0 30 12.0 31 26.0 32 19.0 33 27.0 34 32.0 35 110.0 36 2142.0 37 1616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.80035026269702 10.482862146609957 4.978734050537904 50.738053540155114 2 19.5 11.525 39.775 29.2 3 17.9 15.375 26.275 40.45 4 23.125 22.55 23.674999999999997 30.65 5 25.15 28.475 25.4 20.974999999999998 6 21.825 30.175 25.2 22.8 7 18.775 23.525 39.65 18.05 8 18.525 23.25 32.5 25.724999999999998 9 18.8 21.025 36.575 23.599999999999998 10-11 23.175 29.6375 23.974999999999998 23.2125 12-13 22.162499999999998 24.2875 27.05 26.5 14-15 21.1875 26.3625 27.35 25.1 16-17 23.4125 24.962500000000002 25.837500000000002 25.7875 18-19 22.375 25.0625 26.525 26.0375 20-21 22.15 25.362499999999997 27.762500000000003 24.725 22-23 21.7375 26.687499999999996 26.525 25.05 24-25 22.4375 25.5375 25.374999999999996 26.650000000000002 26-27 21.2375 25.8625 27.05 25.85 28-29 23.2125 26.075 25.624999999999996 25.087500000000002 30-31 22.525000000000002 25.5125 26.2875 25.674999999999997 32-33 22.1875 24.7875 27.0125 26.0125 34-35 22.625 25.8 25.55 26.025 36-37 22.375 25.8625 25.525 26.237500000000004 38-39 22.45 25.9625 26.224999999999998 25.362499999999997 40-41 23.125 25.575 25.650000000000002 25.650000000000002 42-43 22.525000000000002 25.8625 25.7 25.912499999999998 44-45 21.987499999999997 26.224999999999998 26.387500000000003 25.4 46-47 21.837500000000002 25.825 26.650000000000002 25.687500000000004 48-49 23.175 24.1625 26.0125 26.650000000000002 50-51 22.325 25.8 26.700000000000003 25.174999999999997 52-53 23.51543942992874 26.078259782472806 25.86573321665208 24.54056757094637 54-55 22.55563890972743 25.85646411602901 25.78144536134033 25.806451612903224 56-57 22.918229557389346 26.106526631657918 26.569142285571395 24.406101525381345 58-59 22.50562640660165 25.6064016004001 26.25656414103526 25.63140785196299 60-61 22.466850137603203 25.193895421566175 26.80760570427821 25.531648736552416 62-63 22.95471603702777 25.369026770077557 26.45734300725544 25.21891418563923 64-65 23.117338003502628 25.481611208406306 26.64498373780335 24.756067050287715 66-67 22.54472663580633 25.59739772300763 26.035280870761916 25.822594770424125 68-69 23.751720685771495 25.62883243649105 25.76648729821049 24.852959579526967 70-71 23.44180225281602 25.519399249061326 26.245306633291616 24.793491864831037 72-73 22.57135703555333 25.062593890836254 26.602403605408114 25.763645468202302 74-75 22.936239508956533 25.95515470374546 26.456219466366026 24.652386320931978 76-77 23.266892315406796 25.911996991350133 25.52337971668547 25.297730976557602 78-79 23.186951066499372 24.78042659974906 25.77164366373902 26.26097867001255 80-81 23.572235471319193 25.09100037655328 26.19555667126898 25.14120748085854 82-83 22.626820693119036 25.339025615268707 26.305876443997988 25.728277247614262 84-85 23.076923076923077 26.48315736551031 25.716440422322773 24.723479135243842 86-87 22.986767485822305 25.88531821045999 26.238185255198488 24.889729048519218 88-89 23.05067610261595 26.00783520788576 25.603437381524074 25.33805130797422 90-91 22.68407046001774 25.04118616144975 26.270434672411607 26.0043087061209 92-93 23.082792827165203 26.020602823349865 25.575480096655223 25.32112425282971 94-95 22.654052671950907 25.69675274865763 25.926872922526208 25.722321656865255 96-97 23.59897172236504 25.835475578406168 25.604113110539846 24.961439588688947 98-99 22.61359172449915 24.171795207542228 26.738248003142594 26.476365064816026 100-101 24.307592049527532 11.22515477354187 32.681655262300424 31.78559791463017 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.0 27 2.5 28 3.5 29 6.0 30 6.5 31 9.5 32 12.5 33 18.5 34 28.0 35 39.0 36 45.5 37 59.0 38 71.0 39 98.5 40 131.0 41 149.0 42 174.5 43 201.5 44 199.5 45 208.0 46 228.0 47 217.5 48 232.5 49 218.0 50 177.0 51 155.0 52 136.5 53 130.0 54 125.0 55 118.0 56 105.0 57 92.5 58 80.5 59 65.0 60 57.0 61 59.5 62 61.5 63 57.5 64 52.0 65 44.0 66 33.5 67 32.5 68 31.0 69 17.0 70 11.5 71 10.0 72 4.5 73 2.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52-53 1.0 54-55 0.0 56-57 0.0 58-59 2.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 1.0 68-69 1.0 70-71 1.0 72-73 2.0 74-75 2.0 76-77 5.0 78-79 1.0 80-81 2.0 82-83 1.0 84-85 10.0 86-87 11.0 88-89 13.0 90-91 11.0 92-93 20.0 94-95 22.0 96-97 34.0 98-99 336.0 100-101 3524.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.63246959280804 89.47500000000001 2 5.023796932839767 9.5 3 0.29085140137493387 0.8250000000000001 4 0.052882072977260705 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863785 READS because READLEN < 1 Read 863785 spots for SRR12897272.sra Written 863785 spots for SRR12897272.sra Rejected 863797 READS because READLEN < 1 Read 863797 spots for SRR12897272.sra Written 863797 spots for SRR12897272.sra SRR ids: ['SRR12897272.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a9h6xb5i SRR12897272.sra spots: 17275712 blocks: [[1, 863785], [863786, 1727570], [1727571, 2591355], [2591356, 3455140], [3455141, 4318925], [4318926, 5182710], [5182711, 6046495], [6046496, 6910280], [6910281, 7774065], [7774066, 8637850], [8637851, 9501635], [9501636, 10365420], [10365421, 11229205], [11229206, 12092990], [12092991, 12956775], [12956776, 13820560], [13820561, 14684345], [14684346, 15548130], [15548131, 16411915], [16411916, 17275712]] SRR12897272 file size 4131196 SRR12897272 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897272 SRR12897272_1.fastq Input file: SRR12897272_1.fastq trimmed: SRR12897272-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:40:11 2024 >> started Sat Dec 7 12:40:20 2024 >> done (8.463s) 17275712 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 2216 ( 0.01%) empty reads filtered out after trimming by size control 17273490 (99.99%) reads available; of these: 351 ( 0.00%) trimmed reads available after processing 17273139 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 5 0.00% 33 0 0.00% 34 3 0.00% 35 38 0.00% 36 36 0.00% 37 54 0.00% 38 74 0.00% 39 85 0.00% 40 95 0.00% 41 125 0.00% 42 106 0.00% 43 117 0.00% 44 129 0.00% 45 120 0.00% 46 170 0.00% 47 215 0.00% 48 249 0.00% 49 265 0.00% 50 371 0.00% 51 412 0.00% 52 441 0.00% 53 425 0.00% 54 484 0.00% 55 540 0.00% 56 581 0.00% 57 646 0.00% 58 821 0.00% 59 973 0.01% 60 1164 0.01% 61 1323 0.01% 62 1420 0.01% 63 1587 0.01% 64 1603 0.01% 65 1837 0.01% 66 1925 0.01% 67 2271 0.01% 68 2440 0.01% 69 2695 0.02% 70 3270 0.02% 71 3696 0.02% 72 4205 0.02% 73 4653 0.03% 74 5109 0.03% 75 5932 0.03% 76 6485 0.04% 77 6963 0.04% 78 7603 0.04% 79 8374 0.05% 80 9308 0.05% 81 10774 0.06% 82 12232 0.07% 83 13026 0.08% 84 14899 0.09% 85 16708 0.10% 86 18203 0.11% 87 19718 0.11% 88 21876 0.13% 89 23171 0.13% 90 25465 0.15% 91 28089 0.16% 92 28440 0.16% 93 31461 0.18% 94 35649 0.21% 95 40091 0.23% 96 61610 0.36% 97 121143 0.70% 98 359717 2.08% 99 1171926 6.78% 100 4031416 23.34% 101 11096427 64.24% 17273490 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.1 sequence=CCGCAGCTGCATCCAGATCCACAGCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=444.33 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=33.5 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:40:37 Started mapping on | Dec 07 12:40:37 Finished on | Dec 07 12:41:44 Mapping speed, Million of reads per hour | 928.13 Number of input reads | 17273490 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15527372 Uniquely mapped reads % | 89.89% Average mapped length | 99.92 Number of splices: Total | 5353033 Number of splices: Annotated (sjdb) | 5084554 Number of splices: GT/AG | 5275391 Number of splices: GC/AG | 65674 Number of splices: AT/AC | 3326 Number of splices: Non-canonical | 8642 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216928 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 104480 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.20% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1529190 1529190 1529190 N_multimapping 216928 216928 216928 N_noFeature 627846 15137768 738157 N_ambiguous 301973 1006 24679 UnstrandedReadsAssigned:14597553 PositiveStrandReadsAssigned:388598 NegativeStrandReadsAssigned:14764536 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897272 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897272-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,273,490 reads, 14,876,317 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR12897272.ke.tsv 35125 SRR12897272.se.tsv 88098 total ==> SRR12897272.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 164.785 22.582 PNS24247 1044 945 42.7637 5.19055 PNS24249 1928 1829 40.5322 2.54189 PNS24246 1044 945 42.7637 5.19055 PNS24248 1044 945 42.7637 5.19055 PNS24244 1471 1372 139.392 11.6534 PNS24243 293 194 0 0 KQK14069 1603 1504 3243.84 247.39 KQK14071 474 375 111.829 34.2052 ==> SRR12897272.se.tsv <== BRADI_1g14170v3 3658 BRADI_1g53295v3 60 BRADI_1g59795v3 488 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 520 BRADI_1g74790v3 149 BRADI_1g09890v3 0 BRADI_1g77505v3 107 BRADI_1g48960v3 0 SRR12897272 completed mapping pipeline successfully