Starting /dee2/code/volunteer_pipeline.sh SRR12897273 current disk space = 1543112421376 free memory = 1479056528 SRR12897273 SRAfilesize ed85e388bac1465e9a69aba0c94cc1d7 SRR12897273.sra SRR12897273.sra file validated SRR12897273 is single end SRR12897273 is conventional basespace SRR12897273 read1 length is 54-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897273_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.73425 37.0 37.0 37.0 37.0 37.0 2 36.676 37.0 37.0 37.0 37.0 37.0 3 36.7625 37.0 37.0 37.0 37.0 37.0 4 36.7195 37.0 37.0 37.0 37.0 37.0 5 36.8055 37.0 37.0 37.0 37.0 37.0 6 36.7925 37.0 37.0 37.0 37.0 37.0 7 36.749 37.0 37.0 37.0 37.0 37.0 8 36.746 37.0 37.0 37.0 37.0 37.0 9 36.7425 37.0 37.0 37.0 37.0 37.0 10-11 36.775 37.0 37.0 37.0 37.0 37.0 12-13 36.7845 37.0 37.0 37.0 37.0 37.0 14-15 36.73325 37.0 37.0 37.0 37.0 37.0 16-17 36.7295 37.0 37.0 37.0 37.0 37.0 18-19 36.718 37.0 37.0 37.0 37.0 37.0 20-21 36.805 37.0 37.0 37.0 37.0 37.0 22-23 36.798500000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.748000000000005 37.0 37.0 37.0 37.0 37.0 26-27 36.69825 37.0 37.0 37.0 37.0 37.0 28-29 36.685249999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.712500000000006 37.0 37.0 37.0 37.0 37.0 32-33 36.749 37.0 37.0 37.0 37.0 37.0 34-35 36.73425 37.0 37.0 37.0 37.0 37.0 36-37 36.724000000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.6995 37.0 37.0 37.0 37.0 37.0 40-41 36.709500000000006 37.0 37.0 37.0 37.0 37.0 42-43 36.736999999999995 37.0 37.0 37.0 37.0 37.0 44-45 36.715500000000006 37.0 37.0 37.0 37.0 37.0 46-47 36.7175 37.0 37.0 37.0 37.0 37.0 48-49 36.7175 37.0 37.0 37.0 37.0 37.0 50-51 36.703500000000005 37.0 37.0 37.0 37.0 37.0 52-53 36.68825 37.0 37.0 37.0 37.0 37.0 54-55 36.68971161540385 37.0 37.0 37.0 37.0 37.0 56-57 36.679919979995 37.0 37.0 37.0 37.0 37.0 58-59 36.665126261555386 37.0 37.0 37.0 37.0 37.0 60-61 36.660830415207606 37.0 37.0 37.0 37.0 37.0 62-63 36.65078185827965 37.0 37.0 37.0 37.0 37.0 64-65 36.740020230388005 37.0 37.0 37.0 37.0 37.0 66-67 36.609762202753444 37.0 37.0 37.0 37.0 37.0 68-69 36.672340425531914 37.0 37.0 37.0 37.0 37.0 70-71 36.68490945075726 37.0 37.0 37.0 37.0 37.0 72-73 36.63613313365261 37.0 37.0 37.0 37.0 37.0 74-75 36.706093915819935 37.0 37.0 37.0 37.0 37.0 76-77 36.70475215239766 37.0 37.0 37.0 37.0 37.0 78-79 36.64189307203182 37.0 37.0 37.0 37.0 37.0 80-81 36.644752892227345 37.0 37.0 37.0 37.0 37.0 82-83 36.65694369453489 37.0 37.0 37.0 37.0 37.0 84-85 36.60998861155474 37.0 37.0 37.0 37.0 37.0 86-87 36.651203375007746 37.0 37.0 37.0 37.0 37.0 88-89 36.656267843738576 37.0 37.0 37.0 37.0 37.0 90-91 36.62192472351329 37.0 37.0 37.0 37.0 37.0 92-93 36.62959607367212 37.0 37.0 37.0 37.0 37.0 94-95 36.57770948093179 37.0 37.0 37.0 37.0 37.0 96-97 36.552619975969314 37.0 37.0 37.0 37.0 37.0 98-99 36.57582829272026 37.0 37.0 37.0 37.0 37.0 100-101 36.4714565603298 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 0.0 26 3.0 27 1.0 28 4.0 29 7.0 30 12.0 31 14.0 32 12.0 33 29.0 34 38.0 35 100.0 36 2082.0 37 1697.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05951487871968 12.228057014253563 4.901225306326581 44.81120280070017 2 20.825 12.525 39.225 27.425 3 18.65 15.0 26.1 40.25 4 24.425 24.349999999999998 22.55 28.675 5 25.6 29.7 22.325 22.375 6 22.0 31.574999999999996 23.974999999999998 22.45 7 19.05 25.75 37.525 17.675 8 20.05 24.45 31.025000000000002 24.474999999999998 9 20.424999999999997 19.525000000000002 34.875 25.174999999999997 10-11 22.4625 30.099999999999998 24.0625 23.375 12-13 23.0375 24.15 26.424999999999997 26.387500000000003 14-15 22.3875 26.1125 26.5 25.0 16-17 23.2125 25.900000000000002 26.025 24.8625 18-19 22.475 25.8125 25.2 26.5125 20-21 23.3625 25.525 25.825 25.2875 22-23 23.474999999999998 26.0125 25.45 25.0625 24-25 23.549999999999997 25.137500000000003 25.7875 25.525 26-27 21.912499999999998 26.125 26.525 25.4375 28-29 22.7125 26.275 25.9875 25.025 30-31 22.5875 25.912499999999998 26.1 25.4 32-33 22.3375 25.9875 26.674999999999997 25.0 34-35 22.8 25.75 24.675 26.775 36-37 23.1125 25.5375 25.362499999999997 25.9875 38-39 22.225 26.924999999999997 25.224999999999998 25.624999999999996 40-41 22.8625 26.0125 25.124999999999996 26.0 42-43 22.237499999999997 26.05 25.2375 26.474999999999998 44-45 22.6 26.05 26.137500000000003 25.2125 46-47 23.125 25.362499999999997 25.45 26.0625 48-49 23.0625 26.3 25.2625 25.374999999999996 50-51 22.425 26.400000000000002 25.2 25.974999999999998 52-53 22.162499999999998 27.025 26.25 24.5625 54-55 23.6029503687961 25.17814726840855 25.790723840480062 25.428178522315285 56-57 23.43085771442861 25.84396099024756 25.131282820705174 25.593898474618655 58-59 23.133675128173063 27.76041015380768 24.696761285482054 24.409153432537202 60-61 22.511255627813906 25.812906453226613 24.84992496248124 26.825912956478238 62-63 22.61413383364603 26.779237023139462 24.96560350218887 25.64102564102564 64-65 23.32040535468535 25.922682347053673 26.04779181784061 24.709120480420367 66-67 23.028785982478098 25.481852315394242 25.632040050062578 25.857321652065078 68-69 24.568210262828536 25.03128911138924 25.39424280350438 25.00625782227785 70-71 23.569192235441452 25.91108328115216 25.72323105823419 24.796493425172198 72-73 23.49329657937602 25.623355469239446 25.19734369126676 25.686004260117777 74-75 23.28526645768025 26.08150470219436 25.366771159874606 25.26645768025078 76-77 23.462214411247803 26.173738388149637 24.855636454933467 25.508410745669092 78-79 23.646186706872722 25.920341751476318 25.518281191104407 24.915190350546553 80-81 23.972344437460716 24.37460716530484 26.436203645505973 25.216844751728473 82-83 22.90643495781388 25.853167107417203 25.966502959325023 25.273894975443902 84-85 23.07013118062563 25.630676084762865 25.618062563067607 25.6811301715439 86-87 22.67155314040187 25.957285479590546 25.894098319221538 25.477063060786048 88-89 23.581560283687946 25.645896656534955 25.265957446808514 25.506585612968593 90-91 23.37184207185477 24.95874063729846 25.09838771105751 26.57102957978926 92-93 23.523421588594704 25.483706720977594 25.56008146639511 25.432790224032587 94-95 24.498658832545665 26.51679652573764 24.728573253289056 24.255971388427643 96-97 23.21497243943084 25.93257274708371 25.12498397641328 25.72747083707217 98-99 23.264932688537446 24.25826689321657 26.754672591818064 25.722127826427915 100-101 24.444444444444443 12.395061728395062 31.094650205761315 32.065843621399175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.5 28 1.5 29 2.0 30 6.0 31 9.5 32 9.0 33 16.5 34 26.0 35 34.5 36 51.0 37 64.0 38 81.0 39 105.5 40 127.5 41 137.5 42 165.0 43 191.5 44 210.5 45 215.5 46 210.0 47 211.5 48 185.0 49 172.0 50 187.0 51 181.5 52 151.0 53 129.5 54 128.0 55 131.5 56 106.0 57 90.0 58 91.5 59 72.5 60 60.5 61 58.5 62 54.0 63 54.0 64 55.0 65 48.0 66 50.0 67 48.5 68 26.0 69 20.0 70 17.5 71 5.5 72 3.0 73 3.5 74 3.5 75 3.5 76 2.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 1.0 66 0.0 67 0.0 68 0.0 69 2.0 70 1.0 71 0.0 72 3.0 73 0.0 74 3.0 75 1.0 76 4.0 77 0.0 78 3.0 79 0.0 80 1.0 81 4.0 82 5.0 83 3.0 84 2.0 85 5.0 86 3.0 87 5.0 88 4.0 89 5.0 90 5.0 91 5.0 92 6.0 93 8.0 94 5.0 95 7.0 96 9.0 97 30.0 98 81.0 99 269.0 100 957.0 101 2559.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 94.37217945314575 88.875 2 5.203079373506769 9.8 3 0.29200955667640033 0.8250000000000001 4 0.13273161667109104 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra Rejected 996862 READS because READLEN < 1 Read 996862 spots for SRR12897273.sra Written 996862 spots for SRR12897273.sra Rejected 996844 READS because READLEN < 1 Read 996844 spots for SRR12897273.sra Written 996844 spots for SRR12897273.sra SRR ids: ['SRR12897273.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hvbt4o8p SRR12897273.sra spots: 19936898 blocks: [[1, 996844], [996845, 1993688], [1993689, 2990532], [2990533, 3987376], [3987377, 4984220], [4984221, 5981064], [5981065, 6977908], [6977909, 7974752], [7974753, 8971596], [8971597, 9968440], [9968441, 10965284], [10965285, 11962128], [11962129, 12958972], [12958973, 13955816], [13955817, 14952660], [14952661, 15949504], [15949505, 16946348], [16946349, 17943192], [17943193, 18940036], [18940037, 19936898]] SRR12897273 file size 4772102 SRR12897273 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897273 SRR12897273_1.fastq Input file: SRR12897273_1.fastq trimmed: SRR12897273-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:41:44 2024 >> started Sat Dec 7 12:42:44 2024 >> done (60.015s) 19936898 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 2513 ( 0.01%) empty reads filtered out after trimming by size control 19934377 (99.99%) reads available; of these: 380 ( 0.00%) trimmed reads available after processing 19933997 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 4 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 63 0.00% 36 43 0.00% 37 87 0.00% 38 106 0.00% 39 114 0.00% 40 128 0.00% 41 130 0.00% 42 124 0.00% 43 142 0.00% 44 142 0.00% 45 164 0.00% 46 207 0.00% 47 254 0.00% 48 250 0.00% 49 337 0.00% 50 434 0.00% 51 446 0.00% 52 539 0.00% 53 493 0.00% 54 513 0.00% 55 603 0.00% 56 643 0.00% 57 772 0.00% 58 880 0.00% 59 1149 0.01% 60 1355 0.01% 61 1453 0.01% 62 1522 0.01% 63 1735 0.01% 64 1889 0.01% 65 1992 0.01% 66 2077 0.01% 67 2429 0.01% 68 2691 0.01% 69 3040 0.02% 70 3582 0.02% 71 3983 0.02% 72 4505 0.02% 73 5098 0.03% 74 5525 0.03% 75 6181 0.03% 76 6760 0.03% 77 7328 0.04% 78 8069 0.04% 79 9077 0.05% 80 9989 0.05% 81 11165 0.06% 82 12664 0.06% 83 14229 0.07% 84 15850 0.08% 85 17638 0.09% 86 19091 0.10% 87 20487 0.10% 88 22720 0.11% 89 23918 0.12% 90 27004 0.14% 91 29737 0.15% 92 30348 0.15% 93 33661 0.17% 94 38353 0.19% 95 42880 0.22% 96 68263 0.34% 97 137449 0.69% 98 408136 2.05% 99 1354858 6.80% 100 4663850 23.40% 101 12843018 64.43% 19934377 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=27 prefix-density=0.19 prefix-fanout=3.0 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=169.88 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=25.4 sequence=TCTTCTTCTTCC Started job on | Dec 07 12:44:59 Started mapping on | Dec 07 12:44:59 Finished on | Dec 07 12:50:02 Mapping speed, Million of reads per hour | 236.84 Number of input reads | 19934377 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18559514 Uniquely mapped reads % | 93.10% Average mapped length | 99.95 Number of splices: Total | 6227507 Number of splices: Annotated (sjdb) | 5937615 Number of splices: GT/AG | 6138591 Number of splices: GC/AG | 75284 Number of splices: AT/AC | 3617 Number of splices: Non-canonical | 10015 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262963 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 247536 % of reads mapped to too many loci | 1.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.24% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1111900 1111900 1111900 N_multimapping 262963 262963 262963 N_noFeature 699099 18107770 824749 N_ambiguous 350809 1279 26804 UnstrandedReadsAssigned:17509606 PositiveStrandReadsAssigned:450465 NegativeStrandReadsAssigned:17707961 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897273 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897273-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,934,377 reads, 17,841,146 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR12897273.ke.tsv 35125 SRR12897273.se.tsv 88098 total ==> SRR12897273.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 133.468 15.0689 PNS24247 1044 945 58.879 5.8879 PNS24249 1928 1829 46.2347 2.38883 PNS24246 1044 945 58.879 5.8879 PNS24248 1044 945 58.879 5.8879 PNS24244 1471 1372 191.661 13.2011 PNS24243 293 194 2 0.974228 KQK14069 1603 1504 3500.69 219.957 KQK14071 474 375 209.695 52.8432 ==> SRR12897273.se.tsv <== BRADI_1g14170v3 3959 BRADI_1g53295v3 42 BRADI_1g59795v3 351 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 566 BRADI_1g74790v3 140 BRADI_1g09890v3 0 BRADI_1g77505v3 110 BRADI_1g48960v3 0 SRR12897273 completed mapping pipeline successfully