Starting /dee2/code/volunteer_pipeline.sh SRR12897274 current disk space = 1543126626304 free memory = 1601411636 SRR12897274 SRAfilesize bfde88d3a8ef53590c26380c861efbf7 SRR12897274.sra SRR12897274.sra file validated SRR12897274 is single end SRR12897274 is conventional basespace SRR12897274 read1 length is 51-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897274_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6565 37.0 37.0 37.0 37.0 37.0 2 36.607 37.0 37.0 37.0 37.0 37.0 3 36.6595 37.0 37.0 37.0 37.0 37.0 4 36.7225 37.0 37.0 37.0 37.0 37.0 5 36.77 37.0 37.0 37.0 37.0 37.0 6 36.733 37.0 37.0 37.0 37.0 37.0 7 36.7585 37.0 37.0 37.0 37.0 37.0 8 36.703 37.0 37.0 37.0 37.0 37.0 9 36.6885 37.0 37.0 37.0 37.0 37.0 10-11 36.7765 37.0 37.0 37.0 37.0 37.0 12-13 36.6875 37.0 37.0 37.0 37.0 37.0 14-15 36.7265 37.0 37.0 37.0 37.0 37.0 16-17 36.68575 37.0 37.0 37.0 37.0 37.0 18-19 36.667500000000004 37.0 37.0 37.0 37.0 37.0 20-21 36.754 37.0 37.0 37.0 37.0 37.0 22-23 36.6555 37.0 37.0 37.0 37.0 37.0 24-25 36.66625 37.0 37.0 37.0 37.0 37.0 26-27 36.694 37.0 37.0 37.0 37.0 37.0 28-29 36.62625 37.0 37.0 37.0 37.0 37.0 30-31 36.69325 37.0 37.0 37.0 37.0 37.0 32-33 36.62925 37.0 37.0 37.0 37.0 37.0 34-35 36.66125 37.0 37.0 37.0 37.0 37.0 36-37 36.63375 37.0 37.0 37.0 37.0 37.0 38-39 36.6105 37.0 37.0 37.0 37.0 37.0 40-41 36.647999999999996 37.0 37.0 37.0 37.0 37.0 42-43 36.67175 37.0 37.0 37.0 37.0 37.0 44-45 36.63825 37.0 37.0 37.0 37.0 37.0 46-47 36.61575 37.0 37.0 37.0 37.0 37.0 48-49 36.5975 37.0 37.0 37.0 37.0 37.0 50-51 36.615 37.0 37.0 37.0 37.0 37.0 52-53 36.60590147536884 37.0 37.0 37.0 37.0 37.0 54-55 36.62490622655664 37.0 37.0 37.0 37.0 37.0 56-57 36.62965741435359 37.0 37.0 37.0 37.0 37.0 58-59 36.58089522380595 37.0 37.0 37.0 37.0 37.0 60-61 36.639159789947485 37.0 37.0 37.0 37.0 37.0 62-63 36.590248902284515 37.0 37.0 37.0 37.0 37.0 64-65 36.64464464464464 37.0 37.0 37.0 37.0 37.0 66-67 36.6072590738423 37.0 37.0 37.0 37.0 37.0 68-69 36.558839859616654 37.0 37.0 37.0 37.0 37.0 70-71 36.56092180604635 37.0 37.0 37.0 37.0 37.0 72-73 36.62875751503006 37.0 37.0 37.0 37.0 37.0 74-75 36.603608118266095 37.0 37.0 37.0 37.0 37.0 76-77 36.60736657479328 37.0 37.0 37.0 37.0 37.0 78-79 36.58577300178534 37.0 37.0 37.0 37.0 37.0 80-81 36.56106465407261 37.0 37.0 37.0 37.0 37.0 82-83 36.558155881682346 37.0 37.0 37.0 37.0 37.0 84-85 36.54719514223481 37.0 37.0 37.0 37.0 37.0 86-87 36.548623543425165 37.0 37.0 37.0 37.0 37.0 88-89 36.60447244115303 37.0 37.0 37.0 37.0 37.0 90-91 36.59376972754325 37.0 37.0 37.0 37.0 37.0 92-93 36.561401418795455 37.0 37.0 37.0 37.0 37.0 94-95 36.5231718545633 37.0 37.0 37.0 37.0 37.0 96-97 36.55457837236891 37.0 37.0 37.0 37.0 37.0 98-99 36.54913201080584 37.0 37.0 37.0 37.0 37.0 100-101 36.51722884016646 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 5.0 27 8.0 28 13.0 29 9.0 30 14.0 31 18.0 32 23.0 33 26.0 34 44.0 35 101.0 36 2032.0 37 1707.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.56778389194598 11.85592796398199 4.627313656828414 47.948974487243625 2 18.825 12.625 39.65 28.9 3 16.775000000000002 17.224999999999998 26.75 39.25 4 22.85 24.4 22.575 30.175 5 26.525 29.325000000000003 22.85 21.3 6 22.125 31.474999999999998 23.1 23.3 7 17.325 25.724999999999998 37.7 19.25 8 18.325 24.349999999999998 32.2 25.124999999999996 9 18.0 20.625 35.475 25.900000000000002 10-11 22.900000000000002 30.0 24.3875 22.7125 12-13 22.45 24.125 26.937499999999996 26.487500000000004 14-15 22.3 25.275 26.987499999999997 25.4375 16-17 24.349999999999998 24.837500000000002 25.474999999999998 25.337500000000002 18-19 22.0125 26.35 25.25 26.387500000000003 20-21 22.975 26.05 26.787499999999998 24.1875 22-23 23.35 26.424999999999997 25.0625 25.162499999999998 24-25 21.5375 26.3625 26.1 26.0 26-27 22.1 25.887500000000003 25.775 26.237500000000004 28-29 22.425 26.775 25.525 25.275 30-31 21.8 26.6625 25.724999999999998 25.8125 32-33 22.412499999999998 26.637499999999996 25.7 25.25 34-35 22.45 27.1375 25.45 24.962500000000002 36-37 21.75 26.6125 25.474999999999998 26.1625 38-39 21.987499999999997 25.7875 25.637500000000003 26.5875 40-41 23.075000000000003 26.8125 25.0375 25.074999999999996 42-43 21.825 24.95 26.650000000000002 26.575 44-45 22.4625 26.9625 25.4 25.174999999999997 46-47 23.075000000000003 26.375 25.1875 25.362499999999997 48-49 22.2 25.324999999999996 26.087500000000002 26.387500000000003 50-51 22.55 26.275 25.4875 25.687500000000004 52-53 22.88072018004501 25.93148287071768 25.418854713678417 25.76894223555889 54-55 23.068267066766694 25.51887971992998 25.93148287071768 25.481370342585645 56-57 22.755688922230558 25.63140785196299 25.881470367591895 25.731432858214554 58-59 22.918229557389346 25.756439109777446 25.531382845711427 25.79394848712178 60-61 23.218304576144035 25.918979744936234 24.5311327831958 26.331582895723933 62-63 22.013758599124454 27.15447154471545 25.74108818011257 25.090681676047527 64-65 22.62262262262262 26.651651651651655 26.001001001001 24.724724724724727 66-67 23.779724655819777 25.306633291614517 24.76846057571965 26.14518147684606 68-69 22.946920380570855 26.039058587881826 25.676014021031545 25.338007010515774 70-71 22.442078897933627 27.175954915466498 25.410144020037574 24.971822166562305 72-73 23.309118236472944 25.776553106212425 24.67434869739479 26.23997995991984 74-75 22.939113004259585 26.62240040090203 26.07116011024806 24.36732648459033 76-77 23.515409671761464 26.07116011024806 25.444750689050366 24.968679528940115 78-79 23.35546923944368 25.4479388547801 25.122165142212754 26.074426763563462 80-81 22.72385252069225 25.80887885628292 26.247805367444194 25.21946325558064 82-83 23.572235471319193 26.10769423873478 25.329484122003265 24.990586167942762 84-85 23.30694810905893 25.95803492901118 25.39263726598819 25.342379695941702 86-87 22.669518178387218 26.028431249213735 26.418417410995094 24.88363316140395 88-89 23.20393244265188 25.95160070582304 25.661709100075626 25.182757751449458 90-91 22.9127194644436 26.057850195781228 25.628394593911835 25.401035745863332 92-93 23.852282787403567 25.30669027444037 26.2678639180473 24.573163020108765 94-95 22.597007354805985 25.97007354805985 26.109561247780878 25.323357849353282 96-97 22.446903217601424 24.990461655856542 25.702658018567977 26.859977107974053 98-99 23.079911928506668 23.80520657945862 26.460303069550577 26.654578422484132 100-101 24.946973405123185 11.45374449339207 32.19122205906347 31.408060042421276 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 2.0 29 2.5 30 3.0 31 6.5 32 9.0 33 13.5 34 22.0 35 27.5 36 39.0 37 57.0 38 82.0 39 114.5 40 119.0 41 138.0 42 174.0 43 184.0 44 201.0 45 235.0 46 244.0 47 215.0 48 210.0 49 207.5 50 184.0 51 164.5 52 155.0 53 140.0 54 128.5 55 127.0 56 113.5 57 97.5 58 92.0 59 82.5 60 76.5 61 65.5 62 49.5 63 46.5 64 37.0 65 32.5 66 33.5 67 33.0 68 20.5 69 12.0 70 9.5 71 4.5 72 5.0 73 4.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 2.0 64-65 1.0 66-67 0.0 68-69 2.0 70-71 1.0 72-73 1.0 74-75 0.0 76-77 0.0 78-79 3.0 80-81 2.0 82-83 5.0 84-85 5.0 86-87 8.0 88-89 7.0 90-91 6.0 92-93 10.0 94-95 9.0 96-97 32.0 98-99 359.0 100-101 3545.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.87856388595564 89.85 2 4.672650475184794 8.85 3 0.42238648363252373 1.2 4 0.026399155227032733 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra Rejected 947686 READS because READLEN < 1 Read 947686 spots for SRR12897274.sra Written 947686 spots for SRR12897274.sra Rejected 947672 READS because READLEN < 1 Read 947672 spots for SRR12897274.sra Written 947672 spots for SRR12897274.sra SRR ids: ['SRR12897274.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zavalnt4 SRR12897274.sra spots: 18953454 blocks: [[1, 947672], [947673, 1895344], [1895345, 2843016], [2843017, 3790688], [3790689, 4738360], [4738361, 5686032], [5686033, 6633704], [6633705, 7581376], [7581377, 8529048], [8529049, 9476720], [9476721, 10424392], [10424393, 11372064], [11372065, 12319736], [12319737, 13267408], [13267409, 14215080], [14215081, 15162752], [15162753, 16110424], [16110425, 17058096], [17058097, 18005768], [18005769, 18953454]] SRR12897274 file size 4538380 SRR12897274 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897274 SRR12897274_1.fastq Input file: SRR12897274_1.fastq trimmed: SRR12897274-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:41:46 2024 >> started Sat Dec 7 12:41:55 2024 >> done (8.385s) 18953454 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 2480 ( 0.01%) empty reads filtered out after trimming by size control 18950974 (99.99%) reads available; of these: 246 ( 0.00%) trimmed reads available after processing 18950728 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 3 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 33 0.00% 36 49 0.00% 37 53 0.00% 38 62 0.00% 39 76 0.00% 40 74 0.00% 41 74 0.00% 42 104 0.00% 43 107 0.00% 44 67 0.00% 45 100 0.00% 46 137 0.00% 47 167 0.00% 48 197 0.00% 49 217 0.00% 50 256 0.00% 51 311 0.00% 52 354 0.00% 53 385 0.00% 54 346 0.00% 55 384 0.00% 56 453 0.00% 57 515 0.00% 58 610 0.00% 59 707 0.00% 60 872 0.00% 61 980 0.01% 62 1061 0.01% 63 1196 0.01% 64 1291 0.01% 65 1372 0.01% 66 1486 0.01% 67 1648 0.01% 68 1910 0.01% 69 2173 0.01% 70 2633 0.01% 71 2891 0.02% 72 3159 0.02% 73 3669 0.02% 74 4101 0.02% 75 4601 0.02% 76 4991 0.03% 77 5507 0.03% 78 6035 0.03% 79 6856 0.04% 80 7515 0.04% 81 8615 0.05% 82 9558 0.05% 83 10765 0.06% 84 12217 0.06% 85 13761 0.07% 86 14698 0.08% 87 15930 0.08% 88 17927 0.09% 89 19535 0.10% 90 21486 0.11% 91 23964 0.13% 92 24118 0.13% 93 26515 0.14% 94 30382 0.16% 95 34930 0.18% 96 58036 0.31% 97 125074 0.66% 98 385302 2.03% 99 1290463 6.81% 100 4491636 23.70% 101 12244268 64.61% 18950974 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=26 prefix-density=0.16 prefix-fanout=3.2 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=167.59 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=25.0 sequence=TCTTCTTCTTCC Started job on | Dec 07 12:42:15 Started mapping on | Dec 07 12:42:16 Finished on | Dec 07 12:42:49 Mapping speed, Million of reads per hour | 2067.38 Number of input reads | 18950974 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17677828 Uniquely mapped reads % | 93.28% Average mapped length | 100.02 Number of splices: Total | 6065559 Number of splices: Annotated (sjdb) | 5788864 Number of splices: GT/AG | 5979967 Number of splices: GC/AG | 72627 Number of splices: AT/AC | 3457 Number of splices: Non-canonical | 9508 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258108 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 207031 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.17% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1015038 1015038 1015038 N_multimapping 258108 258108 258108 N_noFeature 668542 17252884 779422 N_ambiguous 337212 1226 25282 UnstrandedReadsAssigned:16672074 PositiveStrandReadsAssigned:423718 NegativeStrandReadsAssigned:16873124 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897274 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897274-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,950,974 reads, 17,009,241 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR12897274.ke.tsv 35125 SRR12897274.se.tsv 88098 total ==> SRR12897274.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 141.152 16.9995 PNS24247 1044 945 49.4994 5.28009 PNS24249 1928 1829 23.9201 1.31832 PNS24246 1044 945 49.4994 5.28009 PNS24248 1044 945 49.4994 5.28009 PNS24244 1471 1372 210.429 15.4606 PNS24243 293 194 0 0 KQK14069 1603 1504 3122.15 209.257 KQK14071 474 375 106.745 28.6939 ==> SRR12897274.se.tsv <== BRADI_1g14170v3 3541 BRADI_1g53295v3 63 BRADI_1g59795v3 393 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 545 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 135 BRADI_1g48960v3 0 SRR12897274 completed mapping pipeline successfully