Starting /dee2/code/volunteer_pipeline.sh SRR12897275 current disk space = 1543013146624 free memory = 1599143564 SRR12897275 SRAfilesize 99cefdd90b95f422401e0fa76c5aa467 SRR12897275.sra SRR12897275.sra file validated SRR12897275 is single end SRR12897275 is conventional basespace SRR12897275 read1 length is 55-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897275_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.62875 37.0 37.0 37.0 37.0 37.0 2 36.6385 37.0 37.0 37.0 37.0 37.0 3 36.692 37.0 37.0 37.0 37.0 37.0 4 36.7215 37.0 37.0 37.0 37.0 37.0 5 36.784 37.0 37.0 37.0 37.0 37.0 6 36.7315 37.0 37.0 37.0 37.0 37.0 7 36.7195 37.0 37.0 37.0 37.0 37.0 8 36.739 37.0 37.0 37.0 37.0 37.0 9 36.738 37.0 37.0 37.0 37.0 37.0 10-11 36.781000000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.71525 37.0 37.0 37.0 37.0 37.0 14-15 36.7465 37.0 37.0 37.0 37.0 37.0 16-17 36.71525 37.0 37.0 37.0 37.0 37.0 18-19 36.763000000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.7535 37.0 37.0 37.0 37.0 37.0 22-23 36.748999999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.7355 37.0 37.0 37.0 37.0 37.0 26-27 36.72 37.0 37.0 37.0 37.0 37.0 28-29 36.7345 37.0 37.0 37.0 37.0 37.0 30-31 36.71325 37.0 37.0 37.0 37.0 37.0 32-33 36.689 37.0 37.0 37.0 37.0 37.0 34-35 36.7345 37.0 37.0 37.0 37.0 37.0 36-37 36.68575 37.0 37.0 37.0 37.0 37.0 38-39 36.6995 37.0 37.0 37.0 37.0 37.0 40-41 36.70725 37.0 37.0 37.0 37.0 37.0 42-43 36.66825 37.0 37.0 37.0 37.0 37.0 44-45 36.7025 37.0 37.0 37.0 37.0 37.0 46-47 36.661249999999995 37.0 37.0 37.0 37.0 37.0 48-49 36.638999999999996 37.0 37.0 37.0 37.0 37.0 50-51 36.6845 37.0 37.0 37.0 37.0 37.0 52-53 36.66025 37.0 37.0 37.0 37.0 37.0 54-55 36.7 37.0 37.0 37.0 37.0 37.0 56-57 36.65337463680577 37.0 37.0 37.0 37.0 37.0 58-59 36.65932966483241 37.0 37.0 37.0 37.0 37.0 60-61 36.67625719289467 37.0 37.0 37.0 37.0 37.0 62-63 36.65724293219915 37.0 37.0 37.0 37.0 37.0 64-65 36.698273705278964 37.0 37.0 37.0 37.0 37.0 66-67 36.62917051402165 37.0 37.0 37.0 37.0 37.0 68-69 36.710638297872336 37.0 37.0 37.0 37.0 37.0 70-71 36.663289991307366 37.0 37.0 37.0 37.0 37.0 72-73 36.6321475075122 37.0 37.0 37.0 37.0 37.0 74-75 36.63051102204409 37.0 37.0 37.0 37.0 37.0 76-77 36.66413089179842 37.0 37.0 37.0 37.0 37.0 78-79 36.589861302854615 37.0 37.0 37.0 37.0 37.0 80-81 36.621698017965265 37.0 37.0 37.0 37.0 37.0 82-83 36.607996015307535 37.0 37.0 37.0 37.0 37.0 84-85 36.59285950768684 37.0 37.0 37.0 37.0 37.0 86-87 36.60198471915953 37.0 37.0 37.0 37.0 37.0 88-89 36.63125529820383 37.0 37.0 37.0 37.0 37.0 90-91 36.587655312020104 37.0 37.0 37.0 37.0 37.0 92-93 36.65055115854059 37.0 37.0 37.0 37.0 37.0 94-95 36.59370566353205 37.0 37.0 37.0 37.0 37.0 96-97 36.5602779642111 37.0 37.0 37.0 37.0 37.0 98-99 36.60777877144035 37.0 37.0 37.0 37.0 37.0 100-101 36.612410249654175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 6.0 28 7.0 29 5.0 30 10.0 31 12.0 32 15.0 33 34.0 34 41.0 35 106.0 36 2086.0 37 1676.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.58377160030053 11.595291760581016 5.3844227397946405 49.43651389932381 2 19.525000000000002 12.15 39.1 29.225 3 17.224999999999998 13.975000000000001 26.125 42.675000000000004 4 23.775 23.425 21.175 31.624999999999996 5 27.875 27.325 22.775000000000002 22.025 6 22.25 32.7 22.075 22.975 7 18.099999999999998 25.15 37.55 19.2 8 18.75 22.075 32.95 26.224999999999998 9 19.55 20.95 33.35 26.150000000000002 10-11 22.225 31.337500000000002 22.650000000000002 23.7875 12-13 22.8375 24.1125 26.637499999999996 26.4125 14-15 21.4125 25.8625 26.6125 26.1125 16-17 22.45 25.874999999999996 25.4625 26.2125 18-19 24.224999999999998 24.712500000000002 25.35 25.7125 20-21 22.3 26.2625 25.525 25.912499999999998 22-23 23.6375 25.775 25.362499999999997 25.224999999999998 24-25 24.175 25.45 24.775 25.6 26-27 23.2625 26.0 25.587500000000002 25.15 28-29 22.2125 26.3625 25.025 26.400000000000002 30-31 23.0375 25.0125 25.0 26.950000000000003 32-33 22.05 24.462500000000002 25.6 27.8875 34-35 22.662499999999998 25.7375 25.45 26.150000000000002 36-37 22.4625 25.5125 25.0 27.025 38-39 22.6125 25.974999999999998 25.624999999999996 25.7875 40-41 23.0875 26.05 25.837500000000002 25.025 42-43 22.787499999999998 25.0125 25.0125 27.187499999999996 44-45 22.6 23.875 26.75 26.775 46-47 23.7125 25.324999999999996 25.5 25.4625 48-49 21.8625 26.1 25.412499999999998 26.625 50-51 22.25 25.662499999999998 25.775 26.3125 52-53 23.4125 26.650000000000002 25.7125 24.224999999999998 54-55 22.9375 25.4625 25.4375 26.1625 56-57 22.12079529823684 25.934725522070778 25.609603601350507 26.334875578341876 58-59 22.648824412206103 25.45022511255628 25.60030015007504 26.300650325162582 60-61 22.71703777833375 24.86865148861646 25.806855141356017 26.607455591693768 62-63 21.203402551913936 25.11883912934701 26.26970227670753 27.408056042031525 64-65 22.491868901676256 25.2064048036027 26.207155366524894 26.09457092819615 66-67 23.35793819592143 25.13449268109596 25.74752908795196 25.760040035030652 68-69 22.503128911138923 24.918648310387987 25.707133917396746 26.87108886107635 70-71 23.332081612216797 26.448867192389535 25.284766554011767 24.9342846413819 72-73 22.899712032052086 25.003130086390385 26.017278076874923 26.07987980468261 74-75 22.54509018036072 26.302605210420843 25.80160320641283 25.35070140280561 76-77 23.93783682165685 25.404185988219076 24.82767264068179 25.830304549442285 78-79 22.40060203185752 26.20092813244701 25.611438605292864 25.787031230402608 80-81 22.01708113539312 25.37050992213012 25.408188897261997 27.20422004521477 82-83 23.83706311289917 25.345737993462407 25.245159668091528 25.572039225546895 84-85 23.001384867178647 24.549918166939445 25.229762054639306 27.218934911242602 86-87 22.968197879858657 25.58051489146895 25.164058556284708 26.28722867238768 88-89 23.63199797801087 25.477063060786048 25.502337924933656 25.38860103626943 90-91 22.96099290780142 24.936676798378926 25.164640324214794 26.93768996960486 92-93 22.965412004069176 25.152594099694813 25.851983723296033 26.03001017293998 94-95 22.92490118577075 25.105189340813467 26.125207191125842 25.844702282289937 96-97 21.8293620292083 25.544452984883424 25.71099154496541 26.915193440942865 98-99 23.60062483728196 23.665712054152564 26.30825305909919 26.425410049466286 100-101 22.871994801819362 11.972059779077322 32.01754385964912 33.13840155945419 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 0.5 27 0.0 28 1.5 29 2.0 30 2.5 31 8.0 32 12.5 33 18.5 34 25.0 35 36.5 36 59.5 37 68.0 38 62.5 39 74.5 40 103.5 41 123.0 42 122.0 43 129.5 44 156.0 45 170.0 46 198.5 47 235.0 48 222.5 49 212.0 50 213.0 51 197.0 52 198.5 53 196.0 54 163.5 55 141.0 56 128.0 57 99.5 58 86.5 59 81.5 60 70.5 61 60.0 62 47.5 63 49.5 64 54.0 65 47.0 66 34.0 67 28.0 68 32.0 69 22.0 70 8.0 71 4.5 72 3.5 73 2.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 1.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 0.0 70 1.0 71 0.0 72 1.0 73 1.0 74 0.0 75 1.0 76 3.0 77 0.0 78 3.0 79 3.0 80 2.0 81 2.0 82 2.0 83 2.0 84 5.0 85 4.0 86 6.0 87 1.0 88 3.0 89 3.0 90 8.0 91 9.0 92 6.0 93 3.0 94 9.0 95 5.0 96 18.0 97 23.0 98 60.0 99 239.0 100 988.0 101 2584.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.91688089117395 79.57499999999999 2 6.312482147957726 11.05 3 1.5995429877177951 4.2 4 0.5141388174807198 1.7999999999999998 5 0.31419594401599543 1.375 6 0.17137960582690662 0.8999999999999999 7 0.11425307055127107 0.7000000000000001 8 0.057126535275635534 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTAT 8 0.2 No Hit CTCAAACTTCCGTCGCCTAAACGGCGATAGTCCCTCTAAGAAGCTAGCTG 8 0.2 No Hit CCTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAAT 7 0.17500000000000002 No Hit CGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACT 7 0.17500000000000002 No Hit CAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCGA 7 0.17500000000000002 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 7 0.17500000000000002 No Hit CTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGA 6 0.15 No Hit GTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAG 6 0.15 No Hit GCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCG 6 0.15 No Hit CCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCCCTATCCTACCAT 6 0.15 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 6 0.15 No Hit CCCTCTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAGCA 6 0.15 No Hit GTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCT 5 0.125 No Hit GTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTT 5 0.125 No Hit CCTCTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAGCAG 5 0.125 No Hit CTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCC 5 0.125 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit CTCTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAGCAGG 5 0.125 No Hit CTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACAC 5 0.125 No Hit CTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCACGT 5 0.125 No Hit CAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGC 5 0.125 No Hit CATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAAT 5 0.125 No Hit GTAGGAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002460 READS because READLEN < 1 Read 1002460 spots for SRR12897275.sra Written 1002460 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra Rejected 1002459 READS because READLEN < 1 Read 1002459 spots for SRR12897275.sra Written 1002459 spots for SRR12897275.sra SRR ids: ['SRR12897275.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rnbvblck SRR12897275.sra spots: 20049181 blocks: [[1, 1002459], [1002460, 2004918], [2004919, 3007377], [3007378, 4009836], [4009837, 5012295], [5012296, 6014754], [6014755, 7017213], [7017214, 8019672], [8019673, 9022131], [9022132, 10024590], [10024591, 11027049], [11027050, 12029508], [12029509, 13031967], [13031968, 14034426], [14034427, 15036885], [15036886, 16039344], [16039345, 17041803], [17041804, 18044262], [18044263, 19046721], [19046722, 20049181]] SRR12897275 file size 4799119 SRR12897275 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897275 SRR12897275_1.fastq Input file: SRR12897275_1.fastq trimmed: SRR12897275-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:44:13 2024 >> started Sat Dec 7 12:44:24 2024 >> done (10.611s) 20049181 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 3509 ( 0.02%) empty reads filtered out after trimming by size control 20045665 (99.98%) reads available; of these: 374 ( 0.00%) trimmed reads available after processing 20045291 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 2 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 1 0.00% 34 1 0.00% 35 60 0.00% 36 43 0.00% 37 57 0.00% 38 67 0.00% 39 95 0.00% 40 106 0.00% 41 125 0.00% 42 113 0.00% 43 127 0.00% 44 110 0.00% 45 129 0.00% 46 163 0.00% 47 211 0.00% 48 271 0.00% 49 328 0.00% 50 331 0.00% 51 419 0.00% 52 466 0.00% 53 447 0.00% 54 528 0.00% 55 548 0.00% 56 608 0.00% 57 713 0.00% 58 958 0.00% 59 1056 0.01% 60 1284 0.01% 61 1434 0.01% 62 1581 0.01% 63 1736 0.01% 64 1842 0.01% 65 1940 0.01% 66 2184 0.01% 67 2521 0.01% 68 2697 0.01% 69 3071 0.02% 70 3540 0.02% 71 4111 0.02% 72 4819 0.02% 73 5427 0.03% 74 5644 0.03% 75 6290 0.03% 76 7036 0.04% 77 7435 0.04% 78 8398 0.04% 79 9640 0.05% 80 10359 0.05% 81 11814 0.06% 82 13783 0.07% 83 14517 0.07% 84 16738 0.08% 85 18833 0.09% 86 20995 0.10% 87 23122 0.12% 88 24627 0.12% 89 26025 0.13% 90 29348 0.15% 91 31604 0.16% 92 32587 0.16% 93 36793 0.18% 94 40665 0.20% 95 46090 0.23% 96 67158 0.34% 97 129469 0.65% 98 370773 1.85% 99 1267144 6.32% 100 4796789 23.93% 101 12925708 64.48% 20045665 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=3.1 sequence=GATTCCCTTTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=42.30 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.0 sequence=CCGCAGCTGCAGCCATGGCCGGCCTCACCGGACTCGGCGGCCTCCTCAAACTGGGCCTTAGCAGGCGCAACGCCGAGGATCATGGTGGTGGCCTGCTGGGTGCCGCCGCTCTTCTCTGCCAAGTCAGGGTACATCTTGCCGCAGGTGCAGTTTGA Started job on | Dec 07 12:44:42 Started mapping on | Dec 07 12:44:42 Finished on | Dec 07 12:45:51 Mapping speed, Million of reads per hour | 1045.86 Number of input reads | 20045665 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14218543 Uniquely mapped reads % | 70.93% Average mapped length | 99.91 Number of splices: Total | 4688134 Number of splices: Annotated (sjdb) | 4466904 Number of splices: GT/AG | 4621088 Number of splices: GC/AG | 56128 Number of splices: AT/AC | 2612 Number of splices: Non-canonical | 8306 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234445 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 3801803 % of reads mapped to too many loci | 18.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.22% % of reads unmapped: other | 1.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5592677 5592677 5592677 N_multimapping 234445 234445 234445 N_noFeature 718344 13876535 821544 N_ambiguous 263173 961 26026 UnstrandedReadsAssigned:13237026 PositiveStrandReadsAssigned:341047 NegativeStrandReadsAssigned:13370973 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897275 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897275-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,045,665 reads, 13,463,952 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR12897275.ke.tsv 35125 SRR12897275.se.tsv 88098 total ==> SRR12897275.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 65.9498 10.0425 PNS24247 1044 945 45.3157 6.11181 PNS24249 1928 1829 20.7586 1.44656 PNS24246 1044 945 45.3157 6.11181 PNS24248 1044 945 45.3157 6.11181 PNS24244 1471 1372 172.344 16.0101 PNS24243 293 194 0 0 KQK14069 1603 1504 2606.2 220.858 KQK14071 474 375 75.615 25.6998 ==> SRR12897275.se.tsv <== BRADI_1g14170v3 2868 BRADI_1g53295v3 44 BRADI_1g59795v3 287 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 511 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 73 BRADI_1g48960v3 0 SRR12897275 completed mapping pipeline successfully