Starting /dee2/code/volunteer_pipeline.sh SRR12897276 current disk space = 1543131439104 free memory = 1604927672 SRR12897276 SRAfilesize 4b4c0d4d8dae6e92a198725d8e465238 SRR12897276.sra SRR12897276.sra file validated SRR12897276 is single end SRR12897276 is conventional basespace SRR12897276 read1 length is 40-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897276_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6335 37.0 37.0 37.0 37.0 37.0 2 36.7165 37.0 37.0 37.0 37.0 37.0 3 36.7365 37.0 37.0 37.0 37.0 37.0 4 36.7845 37.0 37.0 37.0 37.0 37.0 5 36.709 37.0 37.0 37.0 37.0 37.0 6 36.7505 37.0 37.0 37.0 37.0 37.0 7 36.704 37.0 37.0 37.0 37.0 37.0 8 36.769 37.0 37.0 37.0 37.0 37.0 9 36.744 37.0 37.0 37.0 37.0 37.0 10-11 36.766 37.0 37.0 37.0 37.0 37.0 12-13 36.7535 37.0 37.0 37.0 37.0 37.0 14-15 36.72725 37.0 37.0 37.0 37.0 37.0 16-17 36.7645 37.0 37.0 37.0 37.0 37.0 18-19 36.768 37.0 37.0 37.0 37.0 37.0 20-21 36.7445 37.0 37.0 37.0 37.0 37.0 22-23 36.7545 37.0 37.0 37.0 37.0 37.0 24-25 36.75 37.0 37.0 37.0 37.0 37.0 26-27 36.685249999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.75475 37.0 37.0 37.0 37.0 37.0 30-31 36.76225 37.0 37.0 37.0 37.0 37.0 32-33 36.71425 37.0 37.0 37.0 37.0 37.0 34-35 36.699250000000006 37.0 37.0 37.0 37.0 37.0 36-37 36.691 37.0 37.0 37.0 37.0 37.0 38-39 36.690250000000006 37.0 37.0 37.0 37.0 37.0 40-41 36.68171424106026 37.0 37.0 37.0 37.0 37.0 42-43 36.693173293323326 37.0 37.0 37.0 37.0 37.0 44-45 36.69017254313579 37.0 37.0 37.0 37.0 37.0 46-47 36.691172793198305 37.0 37.0 37.0 37.0 37.0 48-49 36.696924231057764 37.0 37.0 37.0 37.0 37.0 50-51 36.677419354838705 37.0 37.0 37.0 37.0 37.0 52-53 36.6568284142071 37.0 37.0 37.0 37.0 37.0 54-55 36.69409704852426 37.0 37.0 37.0 37.0 37.0 56-57 36.65232616308154 37.0 37.0 37.0 37.0 37.0 58-59 36.62756378189095 37.0 37.0 37.0 37.0 37.0 60-61 36.642571285642816 37.0 37.0 37.0 37.0 37.0 62-63 36.614807403701846 37.0 37.0 37.0 37.0 37.0 64-65 36.698808561148226 37.0 37.0 37.0 37.0 37.0 66-67 36.57807807807808 37.0 37.0 37.0 37.0 37.0 68-69 36.57732247975299 37.0 37.0 37.0 37.0 37.0 70-71 36.614536340852126 37.0 37.0 37.0 37.0 37.0 72-73 36.62396590624216 37.0 37.0 37.0 37.0 37.0 74-75 36.62072250368137 37.0 37.0 37.0 37.0 37.0 76-77 36.62017059708981 37.0 37.0 37.0 37.0 37.0 78-79 36.64308461526103 37.0 37.0 37.0 37.0 37.0 80-81 36.599101428692364 37.0 37.0 37.0 37.0 37.0 82-83 36.57031418506003 37.0 37.0 37.0 37.0 37.0 84-85 36.60362377938065 37.0 37.0 37.0 37.0 37.0 86-87 36.614100507767944 37.0 37.0 37.0 37.0 37.0 88-89 36.6523989029966 37.0 37.0 37.0 37.0 37.0 90-91 36.546724812357134 37.0 37.0 37.0 37.0 37.0 92-93 36.54978481795573 37.0 37.0 37.0 37.0 37.0 94-95 36.54148620336531 37.0 37.0 37.0 37.0 37.0 96-97 36.5695734416195 37.0 37.0 37.0 37.0 37.0 98-99 36.60969918386871 37.0 37.0 37.0 37.0 37.0 100-101 36.580299692358146 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 6.0 28 7.0 29 7.0 30 12.0 31 11.0 32 15.0 33 27.0 34 36.0 35 122.0 36 2152.0 37 1603.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.032032032032035 10.935935935935937 5.18018018018018 51.85185185185185 2 18.099999999999998 12.475 40.849999999999994 28.575 3 18.325 13.200000000000001 25.7 42.775 4 24.099999999999998 24.474999999999998 21.425 30.0 5 26.174999999999997 29.075 23.549999999999997 21.2 6 22.625 32.375 22.6 22.400000000000002 7 18.525 24.65 38.175 18.65 8 18.75 23.849999999999998 33.275 24.125 9 19.75 21.375 34.575 24.3 10-11 22.3125 31.075000000000003 24.1375 22.475 12-13 23.5625 24.099999999999998 26.7625 25.575 14-15 22.1375 25.650000000000002 26.5375 25.674999999999997 16-17 22.2625 26.387500000000003 25.324999999999996 26.025 18-19 22.650000000000002 25.412499999999998 25.525 26.4125 20-21 23.200000000000003 25.7375 25.674999999999997 25.387500000000003 22-23 22.775000000000002 27.437499999999996 25.0625 24.725 24-25 22.1875 25.724999999999998 26.0625 26.025 26-27 22.1875 26.0375 25.8 25.974999999999998 28-29 23.0625 26.987499999999997 25.3125 24.637500000000003 30-31 22.5 25.887500000000003 24.8625 26.75 32-33 22.8625 25.924999999999997 25.662499999999998 25.55 34-35 22.662499999999998 26.55 25.35 25.4375 36-37 22.225 26.575 24.675 26.525 38-39 22.225 25.9875 25.7375 26.05 40-41 22.702837854731843 25.890736342042754 25.51568946118265 25.890736342042754 42-43 22.330582645661416 26.744186046511626 25.343835958989747 25.581395348837212 44-45 23.118279569892472 26.081520380095025 25.44386096524131 25.35633908477119 46-47 22.543135783945985 26.269067266816705 25.881470367591895 25.30632658164541 48-49 23.418354588647162 25.131282820705174 25.906476619154787 25.543885971492873 50-51 22.255563890972745 25.693923480870218 25.51887971992998 26.531632908227053 52-53 23.1615807903952 25.975487743871934 26.43821910955478 24.424712356178087 54-55 23.19909954977489 26.20060030015007 25.6128064032016 24.987493746873437 56-57 21.72336168084042 25.887943971985994 26.88844422211106 25.50025012506253 58-59 23.024012006003 25.30015007503752 25.912956478239117 25.76288144072036 60-61 23.47423711855928 24.84992496248124 25.67533766883442 26.000500250125064 62-63 22.661330665332667 25.100050025012504 26.713356678339167 25.52526263131566 64-65 22.80175109443402 25.97873671044403 25.86616635397123 25.35334584115072 66-67 23.21071071071071 25.025025025025027 26.413913913913913 25.350350350350347 68-69 23.137598597721297 25.341179416551896 26.292725679228745 25.22849630649806 70-71 22.907268170426065 26.44110275689223 26.015037593984964 24.636591478696744 72-73 22.31135622963149 25.570318375532715 26.272248683880672 25.846076710955128 74-75 22.162297754922864 25.787031230402608 26.401605418286717 25.64906559638781 76-77 21.763672854992475 25.70245860511791 27.044656297039637 25.489212242849973 78-79 23.606927710843372 25.251004016064254 25.903614457831324 25.238453815261042 80-81 22.131456579112733 25.160236269950985 27.271584768128694 25.43672238280759 82-83 23.647798742138367 25.207547169811324 25.949685534591193 25.19496855345912 84-85 22.212422829784554 25.18583847801436 26.911931460249466 25.689807231951615 86-87 23.336279833312286 25.205202677105692 26.190175527213032 25.268341962368986 88-89 23.134328358208954 26.068808499873512 25.196053630154314 25.600809511763217 90-91 23.589808594245152 25.820763087843833 25.427810875903155 25.16161744200786 92-93 23.451608800712194 26.56746788757472 25.066768409004197 24.91415490270889 94-95 23.039591315453382 26.666666666666668 25.37675606641124 24.91698595146871 96-97 22.68595570349507 25.43848418896428 25.45128664703623 26.424273460504416 98-99 23.391508205261786 23.443605105496225 26.855952070851785 26.308934618390207 100-101 24.340804218853 11.519446275543837 32.16875411997363 31.97099538562953 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.5 26 1.0 27 1.0 28 1.5 29 5.5 30 8.0 31 9.0 32 11.5 33 17.0 34 29.5 35 39.0 36 47.0 37 59.0 38 83.0 39 108.5 40 137.0 41 160.0 42 168.0 43 178.0 44 195.5 45 203.5 46 216.5 47 219.0 48 189.0 49 187.0 50 181.5 51 146.5 52 150.0 53 153.5 54 136.0 55 117.0 56 100.0 57 92.5 58 81.0 59 79.0 60 72.5 61 69.5 62 62.0 63 59.0 64 55.5 65 47.5 66 43.5 67 31.5 68 23.5 69 15.5 70 9.0 71 6.5 72 5.0 73 3.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 2.0 66-67 1.0 68-69 5.0 70-71 1.0 72-73 2.0 74-75 1.0 76-77 1.0 78-79 5.0 80-81 4.0 82-83 3.0 84-85 11.0 86-87 7.0 88-89 9.0 90-91 11.0 92-93 17.0 94-95 9.0 96-97 32.0 98-99 365.0 100-101 3512.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.02985074626866 88.2 2 5.357142857142857 10.05 3 0.5863539445628998 1.6500000000000001 4 0.026652452025586353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030797 READS because READLEN < 1 Read 1030797 spots for SRR12897276.sra Written 1030797 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra Rejected 1030781 READS because READLEN < 1 Read 1030781 spots for SRR12897276.sra Written 1030781 spots for SRR12897276.sra SRR ids: ['SRR12897276.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bjvwf4h1 SRR12897276.sra spots: 20615636 blocks: [[1, 1030781], [1030782, 2061562], [2061563, 3092343], [3092344, 4123124], [4123125, 5153905], [5153906, 6184686], [6184687, 7215467], [7215468, 8246248], [8246249, 9277029], [9277030, 10307810], [10307811, 11338591], [11338592, 12369372], [12369373, 13400153], [13400154, 14430934], [14430935, 15461715], [15461716, 16492496], [16492497, 17523277], [17523278, 18554058], [18554059, 19584839], [19584840, 20615636]] SRR12897276 file size 4934833 SRR12897276 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897276 SRR12897276_1.fastq Input file: SRR12897276_1.fastq trimmed: SRR12897276-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:46:43 2024 >> started Sat Dec 7 12:46:53 2024 >> done (9.701s) 20615636 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 1869 ( 0.01%) empty reads filtered out after trimming by size control 20613759 (99.99%) reads available; of these: 348 ( 0.00%) trimmed reads available after processing 20613411 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 1 0.00% 34 2 0.00% 35 49 0.00% 36 46 0.00% 37 39 0.00% 38 64 0.00% 39 83 0.00% 40 87 0.00% 41 73 0.00% 42 113 0.00% 43 110 0.00% 44 105 0.00% 45 99 0.00% 46 163 0.00% 47 205 0.00% 48 236 0.00% 49 323 0.00% 50 351 0.00% 51 383 0.00% 52 420 0.00% 53 461 0.00% 54 455 0.00% 55 526 0.00% 56 523 0.00% 57 685 0.00% 58 864 0.00% 59 1005 0.00% 60 1212 0.01% 61 1408 0.01% 62 1507 0.01% 63 1701 0.01% 64 1786 0.01% 65 1871 0.01% 66 2099 0.01% 67 2342 0.01% 68 2665 0.01% 69 3150 0.02% 70 3504 0.02% 71 3915 0.02% 72 4425 0.02% 73 5126 0.02% 74 5771 0.03% 75 6255 0.03% 76 7053 0.03% 77 7632 0.04% 78 8845 0.04% 79 9789 0.05% 80 10653 0.05% 81 12001 0.06% 82 13765 0.07% 83 14903 0.07% 84 16954 0.08% 85 19202 0.09% 86 20531 0.10% 87 22576 0.11% 88 24910 0.12% 89 26858 0.13% 90 29345 0.14% 91 32519 0.16% 92 33740 0.16% 93 37365 0.18% 94 42574 0.21% 95 47811 0.23% 96 73612 0.36% 97 146396 0.71% 98 432388 2.10% 99 1408353 6.83% 100 4842463 23.49% 101 13215302 64.11% 20613759 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=35 prefix-density=0.26 prefix-fanout=2.1 sequence=GATCCACAGCTGCAAGACATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=386.11 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=34.1 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:47:09 Started mapping on | Dec 07 12:47:09 Finished on | Dec 07 12:47:39 Mapping speed, Million of reads per hour | 2473.65 Number of input reads | 20613759 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19471678 Uniquely mapped reads % | 94.46% Average mapped length | 99.94 Number of splices: Total | 6621266 Number of splices: Annotated (sjdb) | 6305183 Number of splices: GT/AG | 6525900 Number of splices: GC/AG | 82021 Number of splices: AT/AC | 3886 Number of splices: Non-canonical | 9459 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266091 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 230516 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 875990 875990 875990 N_multimapping 266091 266091 266091 N_noFeature 710200 18992478 828248 N_ambiguous 391303 1423 31841 UnstrandedReadsAssigned:18370175 PositiveStrandReadsAssigned:477777 NegativeStrandReadsAssigned:18611589 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897276 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897276-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,613,759 reads, 18,745,928 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR12897276.ke.tsv 35125 SRR12897276.se.tsv 88098 total ==> SRR12897276.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 157.843 17.4165 PNS24247 1044 945 62.5192 6.10999 PNS24249 1928 1829 41.1578 2.07825 PNS24246 1044 945 62.5192 6.10999 PNS24248 1044 945 62.5192 6.10999 PNS24244 1471 1372 172.441 11.6077 PNS24243 293 194 0 0 KQK14069 1603 1504 2439.46 149.798 KQK14071 474 375 97.2179 23.9428 ==> SRR12897276.se.tsv <== BRADI_1g14170v3 2840 BRADI_1g53295v3 44 BRADI_1g59795v3 340 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 840 BRADI_1g74790v3 104 BRADI_1g09890v3 0 BRADI_1g77505v3 109 BRADI_1g48960v3 0 SRR12897276 completed mapping pipeline successfully