Starting /dee2/code/volunteer_pipeline.sh SRR12897277 current disk space = 1543120752640 free memory = 1603437008 SRR12897277 SRAfilesize e169bc8e18e4261bf4d8f9114524146d SRR12897277.sra SRR12897277.sra file validated SRR12897277 is single end SRR12897277 is conventional basespace SRR12897277 read1 length is 58-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897277_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 58-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.62625 37.0 37.0 37.0 37.0 37.0 2 36.6805 37.0 37.0 37.0 37.0 37.0 3 36.739 37.0 37.0 37.0 37.0 37.0 4 36.74 37.0 37.0 37.0 37.0 37.0 5 36.832 37.0 37.0 37.0 37.0 37.0 6 36.71 37.0 37.0 37.0 37.0 37.0 7 36.7065 37.0 37.0 37.0 37.0 37.0 8 36.6945 37.0 37.0 37.0 37.0 37.0 9 36.7375 37.0 37.0 37.0 37.0 37.0 10-11 36.760000000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.741749999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.6695 37.0 37.0 37.0 37.0 37.0 16-17 36.77 37.0 37.0 37.0 37.0 37.0 18-19 36.740750000000006 37.0 37.0 37.0 37.0 37.0 20-21 36.7915 37.0 37.0 37.0 37.0 37.0 22-23 36.724999999999994 37.0 37.0 37.0 37.0 37.0 24-25 36.69825 37.0 37.0 37.0 37.0 37.0 26-27 36.653999999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.713 37.0 37.0 37.0 37.0 37.0 30-31 36.662499999999994 37.0 37.0 37.0 37.0 37.0 32-33 36.686 37.0 37.0 37.0 37.0 37.0 34-35 36.716 37.0 37.0 37.0 37.0 37.0 36-37 36.70125 37.0 37.0 37.0 37.0 37.0 38-39 36.69725 37.0 37.0 37.0 37.0 37.0 40-41 36.699 37.0 37.0 37.0 37.0 37.0 42-43 36.696 37.0 37.0 37.0 37.0 37.0 44-45 36.70325 37.0 37.0 37.0 37.0 37.0 46-47 36.6755 37.0 37.0 37.0 37.0 37.0 48-49 36.683499999999995 37.0 37.0 37.0 37.0 37.0 50-51 36.6 37.0 37.0 37.0 37.0 37.0 52-53 36.66 37.0 37.0 37.0 37.0 37.0 54-55 36.60425 37.0 37.0 37.0 37.0 37.0 56-57 36.613 37.0 37.0 37.0 37.0 37.0 58-59 36.65320367591898 37.0 37.0 37.0 37.0 37.0 60-61 36.667083541770886 37.0 37.0 37.0 37.0 37.0 62-63 36.6728364182091 37.0 37.0 37.0 37.0 37.0 64-65 36.61480740370185 37.0 37.0 37.0 37.0 37.0 66-67 36.632474355766824 37.0 37.0 37.0 37.0 37.0 68-69 36.671886216629645 37.0 37.0 37.0 37.0 37.0 70-71 36.61551939924906 37.0 37.0 37.0 37.0 37.0 72-73 36.63204005006258 37.0 37.0 37.0 37.0 37.0 74-75 36.634793491864826 37.0 37.0 37.0 37.0 37.0 76-77 36.62102628285356 37.0 37.0 37.0 37.0 37.0 78-79 36.549827717905586 37.0 37.0 37.0 37.0 37.0 80-81 36.60701754385965 37.0 37.0 37.0 37.0 37.0 82-83 36.58158234592922 37.0 37.0 37.0 37.0 37.0 84-85 36.59829644306643 37.0 37.0 37.0 37.0 37.0 86-87 36.617627489187775 37.0 37.0 37.0 37.0 37.0 88-89 36.59456173449069 37.0 37.0 37.0 37.0 37.0 90-91 36.53852269639658 37.0 37.0 37.0 37.0 37.0 92-93 36.52311230588792 37.0 37.0 37.0 37.0 37.0 94-95 36.55792064512937 37.0 37.0 37.0 37.0 37.0 96-97 36.57363585606706 37.0 37.0 37.0 37.0 37.0 98-99 36.61689022587788 37.0 37.0 37.0 37.0 37.0 100-101 36.52581303672915 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 3.0 28 4.0 29 7.0 30 14.0 31 20.0 32 20.0 33 35.0 34 33.0 35 112.0 36 2111.0 37 1639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.60865216304076 11.277819454863716 4.751187796949238 49.362340585146285 2 19.2 12.525 40.075 28.199999999999996 3 17.974999999999998 14.649999999999999 26.924999999999997 40.45 4 23.75 22.475 24.325 29.45 5 26.0 28.349999999999998 23.625 22.025 6 22.5 31.775 22.85 22.875 7 17.549999999999997 25.074999999999996 39.15 18.224999999999998 8 19.7 22.35 31.724999999999998 26.224999999999998 9 18.4 22.475 34.775 24.349999999999998 10-11 21.875 29.95 24.1125 24.0625 12-13 21.912499999999998 24.4125 27.2625 26.4125 14-15 21.725 24.75 27.675 25.85 16-17 22.625 25.2125 26.4125 25.75 18-19 22.35 26.275 26.275 25.1 20-21 21.8 25.387500000000003 27.0625 25.75 22-23 22.9375 25.85 26.437500000000004 24.775 24-25 21.9625 25.974999999999998 26.400000000000002 25.662499999999998 26-27 21.4 25.7875 26.825 25.9875 28-29 22.95 25.874999999999996 25.9625 25.2125 30-31 23.025000000000002 25.637500000000003 25.75 25.587500000000002 32-33 22.3625 25.575 26.5875 25.474999999999998 34-35 22.1375 25.974999999999998 26.3125 25.575 36-37 23.025000000000002 25.374999999999996 25.275 26.325 38-39 21.45 25.2 27.450000000000003 25.900000000000002 40-41 22.725 25.637500000000003 26.0 25.637500000000003 42-43 23.6625 25.55 25.974999999999998 24.8125 44-45 22.287499999999998 26.0375 26.5875 25.087500000000002 46-47 23.3 25.924999999999997 25.8125 24.962500000000002 48-49 21.6875 26.0625 26.05 26.200000000000003 50-51 22.1375 25.324999999999996 27.200000000000003 25.337500000000002 52-53 23.9875 26.375 24.85 24.7875 54-55 22.7 25.937500000000004 25.887500000000003 25.474999999999998 56-57 23.1125 26.187500000000004 25.837500000000002 24.8625 58-59 21.9777472184023 26.24078009751219 25.703212901612705 26.078259782472806 60-61 22.386193096548272 26.43821910955478 25.962981490745374 25.212606303151574 62-63 22.848924462231114 25.387693846923458 26.338169084542272 25.42521260630315 64-65 22.698849424712357 25.67533766883442 26.263131565782892 25.362681340670335 66-67 23.217413059794847 25.494120590442833 25.581686264698522 25.706780085063798 68-69 22.587911400325368 25.55374796646227 26.680015016894004 25.178325616318357 70-71 22.465581977471842 26.29536921151439 26.558197747183982 24.680851063829788 72-73 22.991239048811014 26.245306633291616 26.057571964956196 24.705882352941178 74-75 22.44055068836045 26.195244055068834 25.894868585732166 25.46933667083855 76-77 23.591989987484354 25.36921151439299 25.869837296620773 25.168961201501876 78-79 22.746619929894845 25.38808212318478 25.63845768652979 26.22684026039059 80-81 22.24310776942356 26.07769423558897 26.240601503759397 25.438596491228072 82-83 22.287721058572682 26.71516367741126 25.5863539445629 25.410761319453158 84-85 23.37646024368798 25.059665871121716 25.65004396432609 25.913829920864213 86-87 22.983008181246067 25.198237885462554 26.431718061674008 25.38703587161737 88-89 23.1951618999622 25.77800176389064 26.8867330225526 24.140103313594558 90-91 22.582681141125978 25.877303711184048 26.356980560464528 25.18303458722545 92-93 22.275661308695103 25.591697253512212 26.920642956587777 25.211998481204912 94-95 24.200507614213198 25.0 25.926395939086294 24.873096446700508 96-97 23.00140252454418 24.952186663266605 26.23995919928599 25.806451612903224 98-99 23.452938117524702 24.36297451898076 27.002080083203328 25.182007280291213 100-101 23.46938775510204 11.51603498542274 32.458697764820215 32.555879494655 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 1.0 27 1.5 28 3.5 29 3.5 30 6.5 31 8.0 32 11.5 33 22.0 34 27.0 35 38.5 36 59.5 37 71.5 38 80.0 39 98.5 40 131.5 41 140.0 42 154.0 43 208.0 44 219.0 45 216.5 46 228.0 47 207.0 48 196.0 49 182.0 50 174.0 51 178.5 52 159.0 53 131.5 54 116.0 55 121.0 56 105.5 57 94.0 58 83.5 59 65.5 60 65.0 61 63.5 62 56.0 63 57.0 64 55.5 65 43.0 66 32.5 67 29.0 68 23.5 69 15.0 70 11.0 71 7.5 72 5.0 73 1.0 74 0.5 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 58 1.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 2.0 79 3.0 80 0.0 81 1.0 82 5.0 83 2.0 84 3.0 85 4.0 86 5.0 87 1.0 88 1.0 89 5.0 90 4.0 91 7.0 92 3.0 93 5.0 94 8.0 95 7.0 96 15.0 97 28.0 98 80.0 99 243.0 100 952.0 101 2611.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.68253968253968 89.47500000000001 2 4.841269841269842 9.15 3 0.4497354497354497 1.275 4 0.026455026455026457 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921138 READS because READLEN < 1 Read 921138 spots for SRR12897277.sra Written 921138 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra Rejected 921124 READS because READLEN < 1 Read 921124 spots for SRR12897277.sra Written 921124 spots for SRR12897277.sra SRR ids: ['SRR12897277.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ybu49nq SRR12897277.sra spots: 18422494 blocks: [[1, 921124], [921125, 1842248], [1842249, 2763372], [2763373, 3684496], [3684497, 4605620], [4605621, 5526744], [5526745, 6447868], [6447869, 7368992], [7368993, 8290116], [8290117, 9211240], [9211241, 10132364], [10132365, 11053488], [11053489, 11974612], [11974613, 12895736], [12895737, 13816860], [13816861, 14737984], [14737985, 15659108], [15659109, 16580232], [16580233, 17501356], [17501357, 18422494]] SRR12897277 file size 4412178 SRR12897277 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897277 SRR12897277_1.fastq Input file: SRR12897277_1.fastq trimmed: SRR12897277-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:46:46 2024 >> started Sat Dec 7 12:46:55 2024 >> done (8.790s) 18422494 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 2033 ( 0.01%) empty reads filtered out after trimming by size control 18420458 (99.99%) reads available; of these: 231 ( 0.00%) trimmed reads available after processing 18420227 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 32 0.00% 36 48 0.00% 37 35 0.00% 38 61 0.00% 39 58 0.00% 40 70 0.00% 41 79 0.00% 42 103 0.00% 43 75 0.00% 44 97 0.00% 45 96 0.00% 46 129 0.00% 47 175 0.00% 48 168 0.00% 49 202 0.00% 50 240 0.00% 51 243 0.00% 52 306 0.00% 53 278 0.00% 54 309 0.00% 55 290 0.00% 56 357 0.00% 57 429 0.00% 58 469 0.00% 59 639 0.00% 60 738 0.00% 61 825 0.00% 62 947 0.01% 63 1022 0.01% 64 1029 0.01% 65 1094 0.01% 66 1167 0.01% 67 1354 0.01% 68 1560 0.01% 69 1820 0.01% 70 2093 0.01% 71 2416 0.01% 72 2691 0.01% 73 2991 0.02% 74 3296 0.02% 75 3582 0.02% 76 3989 0.02% 77 4581 0.02% 78 4999 0.03% 79 5432 0.03% 80 6348 0.03% 81 7039 0.04% 82 8023 0.04% 83 8761 0.05% 84 9996 0.05% 85 11104 0.06% 86 12342 0.07% 87 13517 0.07% 88 14827 0.08% 89 15916 0.09% 90 17911 0.10% 91 19899 0.11% 92 20755 0.11% 93 22627 0.12% 94 25865 0.14% 95 30418 0.17% 96 53122 0.29% 97 118332 0.64% 98 372251 2.02% 99 1253962 6.81% 100 4384930 23.80% 101 11939890 64.82% 18420458 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=33 prefix-density=0.13 prefix-fanout=2.2 sequence=CCGTGATCTTCTGGAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=397.58 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=33.9 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:47:12 Started mapping on | Dec 07 12:47:15 Finished on | Dec 07 12:47:45 Mapping speed, Million of reads per hour | 2210.45 Number of input reads | 18420458 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17269099 Uniquely mapped reads % | 93.75% Average mapped length | 100.06 Number of splices: Total | 5871078 Number of splices: Annotated (sjdb) | 5602492 Number of splices: GT/AG | 5785376 Number of splices: GC/AG | 73933 Number of splices: AT/AC | 3366 Number of splices: Non-canonical | 8403 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233978 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 196296 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 917381 917381 917381 N_multimapping 233978 233978 233978 N_noFeature 662064 16835883 767735 N_ambiguous 355173 1280 29244 UnstrandedReadsAssigned:16251862 PositiveStrandReadsAssigned:431936 NegativeStrandReadsAssigned:16472120 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897277 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897277-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,420,458 reads, 16,591,311 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR12897277.ke.tsv 35125 SRR12897277.se.tsv 88098 total ==> SRR12897277.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 103.231 13.0175 PNS24247 1044 945 52.878 5.9059 PNS24249 1928 1829 14.6845 0.847398 PNS24246 1044 945 52.878 5.9059 PNS24248 1044 945 52.878 5.9059 PNS24244 1471 1372 166.45 12.8048 PNS24243 293 194 0 0 KQK14069 1603 1504 1984.53 139.269 KQK14071 474 375 69.5224 19.5676 ==> SRR12897277.se.tsv <== BRADI_1g14170v3 2314 BRADI_1g53295v3 39 BRADI_1g59795v3 290 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 467 BRADI_1g74790v3 125 BRADI_1g09890v3 0 BRADI_1g77505v3 101 BRADI_1g48960v3 0 SRR12897277 completed mapping pipeline successfully