Starting /dee2/code/volunteer_pipeline.sh SRR12897278 current disk space = 1543101612032 free memory = 1603030124 SRR12897278 SRAfilesize 6d886a309cf2649f48331cfb0be8e3dd SRR12897278.sra SRR12897278.sra file validated SRR12897278 is single end SRR12897278 is conventional basespace SRR12897278 read1 length is 52-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897278_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.663 37.0 37.0 37.0 37.0 37.0 2 36.7775 37.0 37.0 37.0 37.0 37.0 3 36.7485 37.0 37.0 37.0 37.0 37.0 4 36.6875 37.0 37.0 37.0 37.0 37.0 5 36.7585 37.0 37.0 37.0 37.0 37.0 6 36.74 37.0 37.0 37.0 37.0 37.0 7 36.788 37.0 37.0 37.0 37.0 37.0 8 36.713 37.0 37.0 37.0 37.0 37.0 9 36.7855 37.0 37.0 37.0 37.0 37.0 10-11 36.7605 37.0 37.0 37.0 37.0 37.0 12-13 36.71775 37.0 37.0 37.0 37.0 37.0 14-15 36.7295 37.0 37.0 37.0 37.0 37.0 16-17 36.748999999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.7805 37.0 37.0 37.0 37.0 37.0 20-21 36.75875 37.0 37.0 37.0 37.0 37.0 22-23 36.748999999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.74725 37.0 37.0 37.0 37.0 37.0 26-27 36.701 37.0 37.0 37.0 37.0 37.0 28-29 36.704499999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.6755 37.0 37.0 37.0 37.0 37.0 32-33 36.67575 37.0 37.0 37.0 37.0 37.0 34-35 36.6995 37.0 37.0 37.0 37.0 37.0 36-37 36.6395 37.0 37.0 37.0 37.0 37.0 38-39 36.6695 37.0 37.0 37.0 37.0 37.0 40-41 36.683 37.0 37.0 37.0 37.0 37.0 42-43 36.706999999999994 37.0 37.0 37.0 37.0 37.0 44-45 36.712 37.0 37.0 37.0 37.0 37.0 46-47 36.60875 37.0 37.0 37.0 37.0 37.0 48-49 36.659000000000006 37.0 37.0 37.0 37.0 37.0 50-51 36.687 37.0 37.0 37.0 37.0 37.0 52-53 36.65596380345086 37.0 37.0 37.0 37.0 37.0 54-55 36.688672168042004 37.0 37.0 37.0 37.0 37.0 56-57 36.66491622905727 37.0 37.0 37.0 37.0 37.0 58-59 36.65466366591648 37.0 37.0 37.0 37.0 37.0 60-61 36.692173043260816 37.0 37.0 37.0 37.0 37.0 62-63 36.71731681452435 37.0 37.0 37.0 37.0 37.0 64-65 36.64273204903678 37.0 37.0 37.0 37.0 37.0 66-67 36.61240368464537 37.0 37.0 37.0 37.0 37.0 68-69 36.64559521975042 37.0 37.0 37.0 37.0 37.0 70-71 36.63870371397756 37.0 37.0 37.0 37.0 37.0 72-73 36.63148405115095 37.0 37.0 37.0 37.0 37.0 74-75 36.65191152841519 37.0 37.0 37.0 37.0 37.0 76-77 36.64341279799247 37.0 37.0 37.0 37.0 37.0 78-79 36.58288165207883 37.0 37.0 37.0 37.0 37.0 80-81 36.60879640721171 37.0 37.0 37.0 37.0 37.0 82-83 36.59783818541561 37.0 37.0 37.0 37.0 37.0 84-85 36.65433821096573 37.0 37.0 37.0 37.0 37.0 86-87 36.61205494293087 37.0 37.0 37.0 37.0 37.0 88-89 36.66164114360903 37.0 37.0 37.0 37.0 37.0 90-91 36.547980943636695 37.0 37.0 37.0 37.0 37.0 92-93 36.57481971060604 37.0 37.0 37.0 37.0 37.0 94-95 36.58453145951562 37.0 37.0 37.0 37.0 37.0 96-97 36.61969443781332 37.0 37.0 37.0 37.0 37.0 98-99 36.58742550419851 37.0 37.0 37.0 37.0 37.0 100-101 36.539366593510096 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 1.0 27 4.0 28 6.0 29 3.0 30 12.0 31 9.0 32 25.0 33 28.0 34 42.0 35 86.0 36 2162.0 37 1619.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.409409409409406 11.16116116116116 4.754754754754755 49.67467467467468 2 19.825 12.25 39.275 28.65 3 18.75 15.299999999999999 25.7 40.25 4 23.799999999999997 25.0 21.65 29.549999999999997 5 25.874999999999996 29.375 23.549999999999997 21.2 6 23.0 32.4 22.825 21.775 7 18.5 24.025 38.625 18.85 8 19.625 23.1 30.45 26.825 9 20.225 21.3 32.7 25.775 10-11 23.125 29.925 24.1125 22.8375 12-13 22.35 24.65 26.0625 26.937499999999996 14-15 22.1875 25.4 26.450000000000003 25.9625 16-17 22.8375 26.325 25.162499999999998 25.674999999999997 18-19 23.3875 25.912499999999998 25.937500000000004 24.762500000000003 20-21 23.4375 25.637500000000003 25.674999999999997 25.25 22-23 22.7375 25.662499999999998 25.95 25.650000000000002 24-25 23.125 25.3 24.95 26.625 26-27 23.150000000000002 26.3 25.35 25.2 28-29 22.7125 26.437500000000004 24.7875 26.0625 30-31 23.1125 25.624999999999996 25.275 25.9875 32-33 22.25 25.5 25.087500000000002 27.1625 34-35 22.912499999999998 25.837500000000002 25.474999999999998 25.775 36-37 23.4125 25.2125 24.9 26.474999999999998 38-39 22.55 25.525 26.174999999999997 25.75 40-41 23.025000000000002 25.674999999999997 26.337500000000002 24.962500000000002 42-43 23.0125 24.762500000000003 25.900000000000002 26.325 44-45 22.2625 25.162499999999998 26.950000000000003 25.624999999999996 46-47 23.625 25.224999999999998 26.087500000000002 25.0625 48-49 23.1875 25.674999999999997 24.712500000000002 26.424999999999997 50-51 23.400000000000002 25.587500000000002 25.75 25.2625 52-53 23.22790348793599 25.95324415551944 25.17814726840855 25.640705088136016 54-55 23.380845211302827 24.056014003500874 25.51887971992998 27.04426106526632 56-57 23.55588897224306 25.418854713678417 25.76894223555889 25.256314078519633 58-59 23.143285821455365 25.6064016004001 25.156289072268066 26.094023505876468 60-61 23.118279569892472 25.11877969492373 25.543885971492873 26.219054763690924 62-63 23.12695434646654 25.01563477173233 25.54096310193871 26.31644777986241 64-65 22.9672254190643 25.2064048036027 25.73179884913685 26.09457092819615 66-67 23.020142624796698 24.75916426873514 25.522332040535467 26.69836106593269 68-69 23.36378425728945 24.65273432611688 26.21699411838318 25.76648729821049 70-71 23.99849774661993 25.938908362543817 25.41311967951928 24.649474211316978 72-73 23.21383805465029 25.720732013035846 25.13161193281524 25.933817999498622 74-75 23.17241379310345 25.19122257053292 25.529780564263323 26.106583072100314 76-77 23.500627352572145 25.432873274780427 25.72145545796738 25.345043914680048 78-79 23.817292006525285 25.523905132388002 24.29413979169281 26.364663069393902 80-81 23.07788944723618 25.28894472361809 25.65326633165829 25.979899497487434 82-83 23.413346738720623 26.24104562020862 25.135101168782203 25.21050647228855 84-85 23.23766364551863 25.440584088620344 24.760825780463243 26.560926485397786 86-87 23.97528061546223 25.337369151217054 25.36259301299029 25.324757220330437 88-89 24.257738471257106 26.22867972204675 24.611497157296274 24.902084649399875 90-91 23.945267958950968 24.98416318256683 25.64297478778665 25.42759407069555 92-93 23.633358759216883 25.540300025425882 24.86651411136537 25.959827103991863 94-95 24.141452827779904 25.750031916251753 25.37980339588919 24.72871186007915 96-97 22.9901269393512 24.92627259905116 25.464803179894858 26.618797281702783 98-99 23.010696582311503 23.715105661361857 26.310983563788152 26.96321419253848 100-101 24.011252689061724 11.931160019857687 31.55717358927685 32.50041370180374 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.0 28 2.0 29 3.0 30 4.0 31 12.0 32 15.0 33 14.5 34 23.0 35 29.5 36 44.5 37 59.0 38 70.0 39 96.5 40 126.0 41 144.0 42 161.0 43 171.0 44 180.5 45 203.5 46 217.0 47 211.0 48 194.5 49 194.5 50 184.0 51 168.0 52 147.5 53 128.5 54 127.0 55 112.5 56 98.0 57 97.0 58 100.5 59 86.0 60 72.0 61 72.0 62 64.5 63 61.5 64 65.5 65 58.0 66 47.5 67 39.0 68 38.0 69 31.5 70 16.0 71 9.5 72 9.5 73 7.5 74 2.5 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52-53 1.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 1.0 64-65 0.0 66-67 1.0 68-69 1.0 70-71 5.0 72-73 2.0 74-75 3.0 76-77 0.0 78-79 4.0 80-81 2.0 82-83 5.0 84-85 7.0 86-87 5.0 88-89 12.0 90-91 12.0 92-93 17.0 94-95 16.0 96-97 36.0 98-99 370.0 100-101 3499.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.88261672381957 89.925 2 4.7217093115273014 8.95 3 0.3956739646531258 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942703 READS because READLEN < 1 Read 942703 spots for SRR12897278.sra Written 942703 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra Rejected 942702 READS because READLEN < 1 Read 942702 spots for SRR12897278.sra Written 942702 spots for SRR12897278.sra SRR ids: ['SRR12897278.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9fctdo69 SRR12897278.sra spots: 18854041 blocks: [[1, 942702], [942703, 1885404], [1885405, 2828106], [2828107, 3770808], [3770809, 4713510], [4713511, 5656212], [5656213, 6598914], [6598915, 7541616], [7541617, 8484318], [8484319, 9427020], [9427021, 10369722], [10369723, 11312424], [11312425, 12255126], [12255127, 13197828], [13197829, 14140530], [14140531, 15083232], [15083233, 16025934], [16025935, 16968636], [16968637, 17911338], [17911339, 18854041]] SRR12897278 file size 4513553 SRR12897278 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897278 SRR12897278_1.fastq Input file: SRR12897278_1.fastq trimmed: SRR12897278-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:46:53 2024 >> started Sat Dec 7 12:47:07 2024 >> done (13.967s) 18854041 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 2124 ( 0.01%) empty reads filtered out after trimming by size control 18851914 (99.99%) reads available; of these: 302 ( 0.00%) trimmed reads available after processing 18851612 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 0 0.00% 30 2 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 58 0.00% 36 40 0.00% 37 62 0.00% 38 80 0.00% 39 66 0.00% 40 115 0.00% 41 102 0.00% 42 113 0.00% 43 149 0.00% 44 129 0.00% 45 114 0.00% 46 160 0.00% 47 184 0.00% 48 199 0.00% 49 305 0.00% 50 312 0.00% 51 409 0.00% 52 382 0.00% 53 389 0.00% 54 384 0.00% 55 459 0.00% 56 514 0.00% 57 598 0.00% 58 644 0.00% 59 890 0.00% 60 978 0.01% 61 1098 0.01% 62 1191 0.01% 63 1321 0.01% 64 1466 0.01% 65 1577 0.01% 66 1747 0.01% 67 1802 0.01% 68 2106 0.01% 69 2331 0.01% 70 2725 0.01% 71 3101 0.02% 72 3457 0.02% 73 3963 0.02% 74 4515 0.02% 75 4913 0.03% 76 5488 0.03% 77 5962 0.03% 78 6465 0.03% 79 7489 0.04% 80 8170 0.04% 81 9267 0.05% 82 10700 0.06% 83 12077 0.06% 84 13373 0.07% 85 14898 0.08% 86 16306 0.09% 87 17425 0.09% 88 19228 0.10% 89 20654 0.11% 90 22931 0.12% 91 25322 0.13% 92 26258 0.14% 93 29447 0.16% 94 33406 0.18% 95 38660 0.21% 96 61027 0.32% 97 125892 0.67% 98 380505 2.02% 99 1272022 6.75% 100 4400863 23.34% 101 12222922 64.84% 18851914 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=35 prefix-density=0.13 prefix-fanout=2.0 sequence=GCCAAACTCCCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=173.92 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=25.9 sequence=TCTTCTTCTTCC Started job on | Dec 07 12:47:24 Started mapping on | Dec 07 12:47:25 Finished on | Dec 07 12:47:59 Mapping speed, Million of reads per hour | 1996.09 Number of input reads | 18851914 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17282411 Uniquely mapped reads % | 91.67% Average mapped length | 100.00 Number of splices: Total | 5670069 Number of splices: Annotated (sjdb) | 5399480 Number of splices: GT/AG | 5584863 Number of splices: GC/AG | 72792 Number of splices: AT/AC | 3324 Number of splices: Non-canonical | 9090 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235456 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 631453 % of reads mapped to too many loci | 3.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1334047 1334047 1334047 N_multimapping 235456 235456 235456 N_noFeature 630526 16853276 740522 N_ambiguous 345302 1191 27765 UnstrandedReadsAssigned:16306583 PositiveStrandReadsAssigned:427944 NegativeStrandReadsAssigned:16514124 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897278 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897278-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,851,914 reads, 16,628,787 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR12897278.ke.tsv 35125 SRR12897278.se.tsv 88098 total ==> SRR12897278.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 191.189 23.0605 PNS24247 1044 945 39.3511 4.20393 PNS24249 1928 1829 36.9569 2.03992 PNS24246 1044 945 39.3511 4.20393 PNS24248 1044 945 39.3511 4.20393 PNS24244 1471 1372 144.801 10.6548 PNS24243 293 194 0 0 KQK14069 1603 1504 2263.94 151.966 KQK14071 474 375 159.134 42.8413 ==> SRR12897278.se.tsv <== BRADI_1g14170v3 2677 BRADI_1g53295v3 36 BRADI_1g59795v3 237 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 555 BRADI_1g74790v3 111 BRADI_1g09890v3 0 BRADI_1g77505v3 107 BRADI_1g48960v3 0 SRR12897278 completed mapping pipeline successfully