Starting /dee2/code/volunteer_pipeline.sh SRR12897279 current disk space = 1543131537408 free memory = 1599367532 SRR12897279 SRAfilesize 63a248c92e843aa28061f1e4647499ac SRR12897279.sra SRR12897279.sra file validated SRR12897279 is single end SRR12897279 is conventional basespace SRR12897279 read1 length is 51-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897279_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.72675 37.0 37.0 37.0 37.0 37.0 2 36.651 37.0 37.0 37.0 37.0 37.0 3 36.7735 37.0 37.0 37.0 37.0 37.0 4 36.7335 37.0 37.0 37.0 37.0 37.0 5 36.7415 37.0 37.0 37.0 37.0 37.0 6 36.6965 37.0 37.0 37.0 37.0 37.0 7 36.7335 37.0 37.0 37.0 37.0 37.0 8 36.737 37.0 37.0 37.0 37.0 37.0 9 36.7575 37.0 37.0 37.0 37.0 37.0 10-11 36.766000000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.75025 37.0 37.0 37.0 37.0 37.0 14-15 36.68725 37.0 37.0 37.0 37.0 37.0 16-17 36.75475 37.0 37.0 37.0 37.0 37.0 18-19 36.7205 37.0 37.0 37.0 37.0 37.0 20-21 36.702749999999995 37.0 37.0 37.0 37.0 37.0 22-23 36.68675 37.0 37.0 37.0 37.0 37.0 24-25 36.673 37.0 37.0 37.0 37.0 37.0 26-27 36.6495 37.0 37.0 37.0 37.0 37.0 28-29 36.665499999999994 37.0 37.0 37.0 37.0 37.0 30-31 36.698 37.0 37.0 37.0 37.0 37.0 32-33 36.69825 37.0 37.0 37.0 37.0 37.0 34-35 36.65275 37.0 37.0 37.0 37.0 37.0 36-37 36.681749999999994 37.0 37.0 37.0 37.0 37.0 38-39 36.683 37.0 37.0 37.0 37.0 37.0 40-41 36.7255 37.0 37.0 37.0 37.0 37.0 42-43 36.667500000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.65075 37.0 37.0 37.0 37.0 37.0 46-47 36.72025 37.0 37.0 37.0 37.0 37.0 48-49 36.67775 37.0 37.0 37.0 37.0 37.0 50-51 36.666250000000005 37.0 37.0 37.0 37.0 37.0 52-53 36.66707882875147 37.0 37.0 37.0 37.0 37.0 54-55 36.67750813109832 37.0 37.0 37.0 37.0 37.0 56-57 36.6077057793345 37.0 37.0 37.0 37.0 37.0 58-59 36.61270953214911 37.0 37.0 37.0 37.0 37.0 60-61 36.62371778834125 37.0 37.0 37.0 37.0 37.0 62-63 36.616712534400804 37.0 37.0 37.0 37.0 37.0 64-65 36.697272954716034 37.0 37.0 37.0 37.0 37.0 66-67 36.64093359058333 37.0 37.0 37.0 37.0 37.0 68-69 36.53603603603604 37.0 37.0 37.0 37.0 37.0 70-71 36.601804745922394 37.0 37.0 37.0 37.0 37.0 72-73 36.59414413270784 37.0 37.0 37.0 37.0 37.0 74-75 36.6143823603107 37.0 37.0 37.0 37.0 37.0 76-77 36.61515206375608 37.0 37.0 37.0 37.0 37.0 78-79 36.55934755332497 37.0 37.0 37.0 37.0 37.0 80-81 36.5459040689382 37.0 37.0 37.0 37.0 37.0 82-83 36.61477871892764 37.0 37.0 37.0 37.0 37.0 84-85 36.54012578616352 37.0 37.0 37.0 37.0 37.0 86-87 36.585461707555524 37.0 37.0 37.0 37.0 37.0 88-89 36.59503926279041 37.0 37.0 37.0 37.0 37.0 90-91 36.55941260684245 37.0 37.0 37.0 37.0 37.0 92-93 36.57852393471285 37.0 37.0 37.0 37.0 37.0 94-95 36.56301280011253 37.0 37.0 37.0 37.0 37.0 96-97 36.57148841022769 37.0 37.0 37.0 37.0 37.0 98-99 36.521656650038636 37.0 37.0 37.0 37.0 37.0 100-101 36.588261300305604 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 1.0 26 1.0 27 4.0 28 8.0 29 10.0 30 18.0 31 10.0 32 31.0 33 26.0 34 37.0 35 102.0 36 2075.0 37 1675.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.83320830207552 9.527381845461365 5.501375343835959 52.13803450862715 2 18.675 12.45 38.9 29.975 3 18.475 15.125 26.075 40.325 4 26.174999999999997 22.775000000000002 20.925 30.125 5 25.474999999999998 28.625 24.125 21.775 6 21.825 32.25 22.2 23.724999999999998 7 17.0 25.0 39.900000000000006 18.099999999999998 8 19.650000000000002 23.925 31.125000000000004 25.3 9 19.35 21.125 35.275 24.25 10-11 22.5125 30.225 23.9875 23.275000000000002 12-13 22.5 23.5875 27.1625 26.75 14-15 22.025 24.95 27.2625 25.7625 16-17 23.1 25.45 25.5 25.95 18-19 22.3875 25.937500000000004 25.912499999999998 25.7625 20-21 22.5625 25.575 27.025 24.837500000000002 22-23 22.75 26.05 25.7125 25.4875 24-25 22.5125 25.2625 25.825 26.400000000000002 26-27 22.725 25.025 26.55 25.7 28-29 22.6 26.075 25.8125 25.5125 30-31 23.0625 25.825 25.0125 26.1 32-33 23.275000000000002 25.7375 26.1125 24.875 34-35 22.7125 26.337500000000002 25.687500000000004 25.2625 36-37 22.3625 25.8125 25.387500000000003 26.437500000000004 38-39 22.8875 25.275 25.775 26.0625 40-41 23.2875 26.0375 25.7875 24.887500000000003 42-43 22.7375 25.912499999999998 25.087500000000002 26.2625 44-45 23.3 25.924999999999997 25.8625 24.9125 46-47 23.2625 25.974999999999998 25.05 25.7125 48-49 22.7 27.474999999999998 24.837500000000002 24.9875 50-51 22.412499999999998 25.3125 26.1 26.174999999999997 52-53 23.74937468734367 25.125062531265634 26.125562781390695 25.0 54-55 23.179884913685264 25.55666750062547 25.706780085063798 25.55666750062547 56-57 22.354265699274457 25.83187390542907 25.65674255691769 26.157117838378785 58-59 22.52939704778584 26.70753064798599 25.606705028771582 25.156367275456592 60-61 22.71703777833375 25.093820365273956 26.10708031023267 26.08206154615962 62-63 22.566925193895422 25.356517388041034 25.881911433575183 26.194645984488368 64-65 23.555166374781088 25.11883912934701 25.91943957968476 25.40655491618714 66-67 22.119354435130738 25.59739772300763 26.135368447391468 26.147879394470163 68-69 22.12212212212212 25.813313313313312 26.013513513513516 26.05105105105105 70-71 23.176073082217492 25.916656238268054 26.029282943311227 24.877987736203227 72-73 22.8843264897346 25.701051577366048 25.250375563345017 26.164246369554334 74-75 22.90152843898772 25.59508895013781 25.507391631170133 25.995990979704338 76-77 23.79340604237182 26.31315030713301 25.122226400902598 24.771217249592578 78-79 23.676286072772896 25.131744040150565 26.12296110414053 25.06900878293601 80-81 23.131985432625896 26.14592490267487 25.65615973879191 25.06592992590732 82-83 24.513129790174645 25.844955396406583 24.450307827616534 25.191606985802235 84-85 23.132075471698112 25.78616352201258 25.534591194968552 25.547169811320753 86-87 23.412298387096776 25.289818548387093 26.29788306451613 25.0 88-89 22.851365015166834 26.567239635995954 25.45500505561173 25.12639029322548 90-91 23.003922561052764 25.230924965203087 25.52195368847273 26.243198785271417 92-93 23.397232448901867 26.06322203884728 25.987050907705978 24.55249460454488 94-95 23.374475124061586 26.25015905331467 24.926835475251305 25.44853034737244 96-97 23.02480184096139 25.31321912554334 25.594477115827154 26.067501917668118 98-99 23.215686274509803 25.22875816993464 26.01307189542484 25.54248366013072 100-101 24.349258649093905 12.240527182866556 31.532125205930804 31.87808896210873 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 0.5 27 0.0 28 1.5 29 2.5 30 5.5 31 9.0 32 13.0 33 20.0 34 28.0 35 34.5 36 47.0 37 61.5 38 77.5 39 100.5 40 113.5 41 144.5 42 169.5 43 189.0 44 227.0 45 237.0 46 212.5 47 193.5 48 204.0 49 196.5 50 169.0 51 156.0 52 150.0 53 137.0 54 124.0 55 115.5 56 98.5 57 90.0 58 84.0 59 68.5 60 70.0 61 61.5 62 51.0 63 57.0 64 65.0 65 66.5 66 52.5 67 34.5 68 24.0 69 18.5 70 10.0 71 9.0 72 7.5 73 4.0 74 3.0 75 1.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 1.0 52-53 2.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 1.0 68-69 0.0 70-71 1.0 72-73 4.0 74-75 1.0 76-77 5.0 78-79 3.0 80-81 2.0 82-83 5.0 84-85 2.0 86-87 15.0 88-89 4.0 90-91 14.0 92-93 7.0 94-95 14.0 96-97 48.0 98-99 362.0 100-101 3509.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.9627659574468 88.325 2 5.718085106382978 10.75 3 0.2925531914893617 0.8250000000000001 4 0.026595744680851064 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883529 READS because READLEN < 1 Read 883529 spots for SRR12897279.sra Written 883529 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra Rejected 883510 READS because READLEN < 1 Read 883510 spots for SRR12897279.sra Written 883510 spots for SRR12897279.sra SRR ids: ['SRR12897279.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_awqlofd7 SRR12897279.sra spots: 17670219 blocks: [[1, 883510], [883511, 1767020], [1767021, 2650530], [2650531, 3534040], [3534041, 4417550], [4417551, 5301060], [5301061, 6184570], [6184571, 7068080], [7068081, 7951590], [7951591, 8835100], [8835101, 9718610], [9718611, 10602120], [10602121, 11485630], [11485631, 12369140], [12369141, 13252650], [13252651, 14136160], [14136161, 15019670], [15019671, 15903180], [15903181, 16786690], [16786691, 17670219]] SRR12897279 file size 4227812 SRR12897279 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897279 SRR12897279_1.fastq Input file: SRR12897279_1.fastq trimmed: SRR12897279-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:48:30 2024 >> started Sat Dec 7 12:48:39 2024 >> done (9.050s) 17670219 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 3909 ( 0.02%) empty reads filtered out after trimming by size control 17666308 (99.98%) reads available; of these: 287 ( 0.00%) trimmed reads available after processing 17666021 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 2 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 2 0.00% 35 43 0.00% 36 43 0.00% 37 55 0.00% 38 51 0.00% 39 53 0.00% 40 103 0.00% 41 107 0.00% 42 114 0.00% 43 113 0.00% 44 106 0.00% 45 108 0.00% 46 155 0.00% 47 161 0.00% 48 209 0.00% 49 262 0.00% 50 288 0.00% 51 334 0.00% 52 328 0.00% 53 409 0.00% 54 352 0.00% 55 409 0.00% 56 454 0.00% 57 518 0.00% 58 660 0.00% 59 760 0.00% 60 841 0.00% 61 1007 0.01% 62 1128 0.01% 63 1293 0.01% 64 1354 0.01% 65 1471 0.01% 66 1691 0.01% 67 1844 0.01% 68 1956 0.01% 69 2260 0.01% 70 2677 0.02% 71 2981 0.02% 72 3405 0.02% 73 4075 0.02% 74 4397 0.02% 75 4963 0.03% 76 5529 0.03% 77 5995 0.03% 78 6804 0.04% 79 7469 0.04% 80 8260 0.05% 81 9401 0.05% 82 10683 0.06% 83 11981 0.07% 84 13650 0.08% 85 15098 0.09% 86 16568 0.09% 87 18144 0.10% 88 19860 0.11% 89 21289 0.12% 90 23305 0.13% 91 25687 0.15% 92 26665 0.15% 93 29950 0.17% 94 33932 0.19% 95 38776 0.22% 96 61005 0.35% 97 123003 0.70% 98 367358 2.08% 99 1202787 6.81% 100 4131248 23.38% 101 11388310 64.46% 17666308 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=36 prefix-density=0.14 prefix-fanout=2.0 sequence=GTTCGTCACCACCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=386.33 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=32.7 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:48:55 Started mapping on | Dec 07 12:48:56 Finished on | Dec 07 12:49:36 Mapping speed, Million of reads per hour | 1589.97 Number of input reads | 17666308 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16198413 Uniquely mapped reads % | 91.69% Average mapped length | 99.97 Number of splices: Total | 5408047 Number of splices: Annotated (sjdb) | 5133668 Number of splices: GT/AG | 5327702 Number of splices: GC/AG | 68939 Number of splices: AT/AC | 3503 Number of splices: Non-canonical | 7903 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236848 % of reads mapped to multiple loci | 1.34% Number of reads mapped to too many loci | 104196 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.34% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1231047 1231047 1231047 N_multimapping 236848 236848 236848 N_noFeature 664132 15789695 773890 N_ambiguous 323517 1316 25749 UnstrandedReadsAssigned:15210764 PositiveStrandReadsAssigned:407402 NegativeStrandReadsAssigned:15398774 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897279 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897279-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,666,308 reads, 15,518,426 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR12897279.ke.tsv 35125 SRR12897279.se.tsv 88098 total ==> SRR12897279.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 151.76 20.2531 PNS24247 1044 945 33.3424 3.94116 PNS24249 1928 1829 28.0572 1.71352 PNS24246 1044 945 33.3424 3.94116 PNS24248 1044 945 33.3424 3.94116 PNS24244 1471 1372 170.156 13.8533 PNS24243 293 194 0 0 KQK14069 1603 1504 3795.81 281.914 KQK14071 474 375 136.195 40.5685 ==> SRR12897279.se.tsv <== BRADI_1g14170v3 4141 BRADI_1g53295v3 79 BRADI_1g59795v3 335 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 504 BRADI_1g74790v3 113 BRADI_1g09890v3 0 BRADI_1g77505v3 144 BRADI_1g48960v3 0 SRR12897279 completed mapping pipeline successfully