Starting /dee2/code/volunteer_pipeline.sh SRR12897280 current disk space = 1543148613632 free memory = 1601758512 SRR12897280 SRAfilesize c35c597a58cbf73d88ca6b856c1d60b7 SRR12897280.sra SRR12897280.sra file validated SRR12897280 is single end SRR12897280 is conventional basespace SRR12897280 read1 length is 51-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897280_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66525 37.0 37.0 37.0 37.0 37.0 2 36.6105 37.0 37.0 37.0 37.0 37.0 3 36.7465 37.0 37.0 37.0 37.0 37.0 4 36.6945 37.0 37.0 37.0 37.0 37.0 5 36.7985 37.0 37.0 37.0 37.0 37.0 6 36.741 37.0 37.0 37.0 37.0 37.0 7 36.7335 37.0 37.0 37.0 37.0 37.0 8 36.721 37.0 37.0 37.0 37.0 37.0 9 36.703 37.0 37.0 37.0 37.0 37.0 10-11 36.7235 37.0 37.0 37.0 37.0 37.0 12-13 36.73225 37.0 37.0 37.0 37.0 37.0 14-15 36.697500000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.77275 37.0 37.0 37.0 37.0 37.0 18-19 36.7285 37.0 37.0 37.0 37.0 37.0 20-21 36.71025 37.0 37.0 37.0 37.0 37.0 22-23 36.77075 37.0 37.0 37.0 37.0 37.0 24-25 36.7115 37.0 37.0 37.0 37.0 37.0 26-27 36.650000000000006 37.0 37.0 37.0 37.0 37.0 28-29 36.668 37.0 37.0 37.0 37.0 37.0 30-31 36.651250000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.6795 37.0 37.0 37.0 37.0 37.0 34-35 36.715500000000006 37.0 37.0 37.0 37.0 37.0 36-37 36.672 37.0 37.0 37.0 37.0 37.0 38-39 36.65375 37.0 37.0 37.0 37.0 37.0 40-41 36.679 37.0 37.0 37.0 37.0 37.0 42-43 36.66875 37.0 37.0 37.0 37.0 37.0 44-45 36.700500000000005 37.0 37.0 37.0 37.0 37.0 46-47 36.676 37.0 37.0 37.0 37.0 37.0 48-49 36.590500000000006 37.0 37.0 37.0 37.0 37.0 50-51 36.66975 37.0 37.0 37.0 37.0 37.0 52-53 36.64216054013504 37.0 37.0 37.0 37.0 37.0 54-55 36.63865966491623 37.0 37.0 37.0 37.0 37.0 56-57 36.60280140070035 37.0 37.0 37.0 37.0 37.0 58-59 36.64198148611459 37.0 37.0 37.0 37.0 37.0 60-61 36.57793345008756 37.0 37.0 37.0 37.0 37.0 62-63 36.6056570706308 37.0 37.0 37.0 37.0 37.0 64-65 36.66041041041041 37.0 37.0 37.0 37.0 37.0 66-67 36.677096370463076 37.0 37.0 37.0 37.0 37.0 68-69 36.6360450563204 37.0 37.0 37.0 37.0 37.0 70-71 36.649433642073426 37.0 37.0 37.0 37.0 37.0 72-73 36.667619298200705 37.0 37.0 37.0 37.0 37.0 74-75 36.649456054967075 37.0 37.0 37.0 37.0 37.0 76-77 36.637042656779826 37.0 37.0 37.0 37.0 37.0 78-79 36.54115662603587 37.0 37.0 37.0 37.0 37.0 80-81 36.55027891643452 37.0 37.0 37.0 37.0 37.0 82-83 36.56236552014026 37.0 37.0 37.0 37.0 37.0 84-85 36.57745464091482 37.0 37.0 37.0 37.0 37.0 86-87 36.60830387911248 37.0 37.0 37.0 37.0 37.0 88-89 36.58730621792114 37.0 37.0 37.0 37.0 37.0 90-91 36.58720928142128 37.0 37.0 37.0 37.0 37.0 92-93 36.55506319393744 37.0 37.0 37.0 37.0 37.0 94-95 36.55001217722995 37.0 37.0 37.0 37.0 37.0 96-97 36.52481693671166 37.0 37.0 37.0 37.0 37.0 98-99 36.51462076819348 37.0 37.0 37.0 37.0 37.0 100-101 36.47794919382902 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 4.0 27 4.0 28 7.0 29 13.0 30 5.0 31 20.0 32 14.0 33 27.0 34 47.0 35 104.0 36 2159.0 37 1594.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.277958468851644 11.883912934701026 5.228921691268451 45.60920690517889 2 20.775 12.025 38.75 28.449999999999996 3 18.175 15.299999999999999 25.45 41.075 4 24.175 22.975 22.3 30.55 5 27.450000000000003 27.750000000000004 23.400000000000002 21.4 6 22.275 32.074999999999996 23.3 22.35 7 18.95 24.95 38.475 17.625 8 19.55 24.05 31.55 24.85 9 18.8 22.475 33.1 25.624999999999996 10-11 22.8 30.837500000000002 24.224999999999998 22.1375 12-13 22.35 24.6625 26.75 26.237500000000004 14-15 22.2125 25.362499999999997 26.9625 25.4625 16-17 23.849999999999998 25.45 25.324999999999996 25.374999999999996 18-19 22.825 26.125 25.7 25.35 20-21 23.3 25.8 25.900000000000002 25.0 22-23 23.5625 26.55 25.2625 24.625 24-25 23.175 25.412499999999998 25.387500000000003 26.025 26-27 22.425 25.3 26.55 25.724999999999998 28-29 22.225 26.5 26.200000000000003 25.074999999999996 30-31 22.237499999999997 25.662499999999998 25.924999999999997 26.174999999999997 32-33 22.287499999999998 26.3625 26.1625 25.1875 34-35 23.35 26.125 25.2625 25.2625 36-37 22.45 26.3625 25.337500000000002 25.85 38-39 22.112499999999997 25.912499999999998 26.450000000000003 25.525 40-41 23.599999999999998 26.35 25.5 24.55 42-43 22.45 25.9625 25.85 25.7375 44-45 22.625 26.400000000000002 26.174999999999997 24.8 46-47 23.4625 25.525 25.775 25.2375 48-49 22.15 26.087500000000002 25.275 26.487500000000004 50-51 22.775000000000002 26.6125 25.05 25.5625 52-53 23.280820205051263 26.081520380095025 26.18154538634659 24.456114028507127 54-55 23.50587646911728 26.506626656664167 24.781195298824706 25.206301575393848 56-57 22.998999499749875 25.53776888444222 27.363681840920464 24.099549774887443 58-59 22.354265699274457 26.344758568926697 25.093820365273956 26.207155366524894 60-61 22.554415811858895 26.46985238929197 25.23142356767576 25.74430823117338 62-63 22.407106217940697 25.960215188289755 26.122857500312772 25.509821093456775 64-65 23.173173173173172 26.063563563563562 24.96246246246246 25.8008008008008 66-67 23.09136420525657 25.519399249061326 26.408010012515643 24.98122653316646 68-69 23.103879849812266 25.96996245306633 26.320400500625784 24.60575719649562 70-71 23.600851383498185 26.129961186928757 25.654188055590332 24.61499937398272 72-73 23.118346900438322 26.48716343143394 25.0093926111459 25.38509705698184 74-75 22.688549235780506 25.945878226008517 26.772738661989475 24.592833876221498 76-77 22.960270710615365 25.69244266198772 25.579646572252162 25.767640055144753 78-79 23.01806322127446 25.301053687907675 25.68991470145509 25.990968389362767 80-81 23.113622096672945 26.252354048964214 25.021971123666038 25.6120527306968 82-83 23.288531591508605 25.687727672402964 25.22296193945484 25.80077879663359 84-85 23.46579476861167 26.735412474849095 25.088028169014088 24.71076458752515 86-87 23.07304785894207 25.289672544080606 26.183879093198993 25.45340050377834 88-89 22.691092861655086 27.605811749842076 25.533796588755525 24.169298799747317 90-91 23.628531610287595 25.541619156214367 24.553401748384644 26.27644748511339 92-93 23.71501272264631 25.96692111959287 25.712468193384225 24.605597964376592 94-95 23.5211447553341 24.811549763638688 26.549124824326054 25.11818065670116 96-97 23.151950718685832 24.948665297741275 26.386036960985628 25.51334702258727 98-99 23.557126030624264 24.682633163198535 26.043711556079046 25.71652925009815 100-101 24.04100529100529 12.086640211640212 32.53968253968254 31.33267195767196 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 3.0 29 7.0 30 8.5 31 10.0 32 10.5 33 11.0 34 26.5 35 42.5 36 47.0 37 50.5 38 70.0 39 101.0 40 123.5 41 151.5 42 171.0 43 180.5 44 212.5 45 233.5 46 226.5 47 213.0 48 194.0 49 184.5 50 175.5 51 162.5 52 161.5 53 149.5 54 137.5 55 137.0 56 116.5 57 96.0 58 84.5 59 67.5 60 65.0 61 55.0 62 42.0 63 50.0 64 53.5 65 46.5 66 36.5 67 33.5 68 26.0 69 14.5 70 12.5 71 9.5 72 4.0 73 2.0 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 1.0 52-53 0.0 54-55 1.0 56-57 1.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 1.0 66-67 0.0 68-69 1.0 70-71 1.0 72-73 1.0 74-75 2.0 76-77 3.0 78-79 4.0 80-81 2.0 82-83 4.0 84-85 6.0 86-87 10.0 88-89 12.0 90-91 11.0 92-93 21.0 94-95 14.0 96-97 38.0 98-99 370.0 100-101 3495.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57671957671958 89.375 2 5.079365079365079 9.6 3 0.291005291005291 0.8250000000000001 4 0.052910052910052914 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra Rejected 851438 READS because READLEN < 1 Read 851438 spots for SRR12897280.sra Written 851438 spots for SRR12897280.sra Rejected 851435 READS because READLEN < 1 Read 851435 spots for SRR12897280.sra Written 851435 spots for SRR12897280.sra SRR ids: ['SRR12897280.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bhh3341 SRR12897280.sra spots: 17028703 blocks: [[1, 851435], [851436, 1702870], [1702871, 2554305], [2554306, 3405740], [3405741, 4257175], [4257176, 5108610], [5108611, 5960045], [5960046, 6811480], [6811481, 7662915], [7662916, 8514350], [8514351, 9365785], [9365786, 10217220], [10217221, 11068655], [11068656, 11920090], [11920091, 12771525], [12771526, 13622960], [13622961, 14474395], [14474396, 15325830], [15325831, 16177265], [16177266, 17028703]] SRR12897280 file size 4071173 SRR12897280 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897280 SRR12897280_1.fastq Input file: SRR12897280_1.fastq trimmed: SRR12897280-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:48:52 2024 >> started Sat Dec 7 12:49:00 2024 >> done (8.667s) 17028703 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 1614 ( 0.01%) empty reads filtered out after trimming by size control 17027086 (99.99%) reads available; of these: 337 ( 0.00%) trimmed reads available after processing 17026749 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 5 0.00% 33 2 0.00% 34 0 0.00% 35 34 0.00% 36 49 0.00% 37 61 0.00% 38 70 0.00% 39 94 0.00% 40 71 0.00% 41 95 0.00% 42 110 0.00% 43 92 0.00% 44 128 0.00% 45 145 0.00% 46 163 0.00% 47 193 0.00% 48 221 0.00% 49 321 0.00% 50 369 0.00% 51 426 0.00% 52 468 0.00% 53 423 0.00% 54 464 0.00% 55 510 0.00% 56 554 0.00% 57 690 0.00% 58 837 0.00% 59 965 0.01% 60 1167 0.01% 61 1342 0.01% 62 1494 0.01% 63 1586 0.01% 64 1723 0.01% 65 1868 0.01% 66 2126 0.01% 67 2297 0.01% 68 2568 0.02% 69 2950 0.02% 70 3486 0.02% 71 3850 0.02% 72 4308 0.03% 73 4866 0.03% 74 5330 0.03% 75 5917 0.03% 76 6567 0.04% 77 7060 0.04% 78 7988 0.05% 79 8773 0.05% 80 9719 0.06% 81 10868 0.06% 82 12588 0.07% 83 13600 0.08% 84 15425 0.09% 85 16918 0.10% 86 18441 0.11% 87 20096 0.12% 88 22094 0.13% 89 23783 0.14% 90 25933 0.15% 91 28906 0.17% 92 29301 0.17% 93 32117 0.19% 94 36476 0.21% 95 40602 0.24% 96 62082 0.36% 97 122906 0.72% 98 359155 2.11% 99 1157361 6.80% 100 3992099 23.45% 101 10891780 63.97% 17027086 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=31 prefix-density=0.14 prefix-fanout=2.9 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=379.28 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=32.9 sequence=CTTCTTCTTCCT Started job on | Dec 07 12:49:23 Started mapping on | Dec 07 12:49:24 Finished on | Dec 07 12:50:00 Mapping speed, Million of reads per hour | 1702.71 Number of input reads | 17027086 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15694994 Uniquely mapped reads % | 92.18% Average mapped length | 99.89 Number of splices: Total | 5229763 Number of splices: Annotated (sjdb) | 4958871 Number of splices: GT/AG | 5151106 Number of splices: GC/AG | 67847 Number of splices: AT/AC | 3267 Number of splices: Non-canonical | 7543 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224706 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 57305 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.14% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1107386 1107386 1107386 N_multimapping 224706 224706 224706 N_noFeature 696596 15286193 806562 N_ambiguous 323681 1181 26072 UnstrandedReadsAssigned:14674717 PositiveStrandReadsAssigned:407620 NegativeStrandReadsAssigned:14862360 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897280 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897280-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,027,086 reads, 14,970,420 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR12897280.ke.tsv 35125 SRR12897280.se.tsv 88098 total ==> SRR12897280.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 143.993 20.1006 PNS24247 1044 945 40.9085 5.05794 PNS24249 1928 1829 26.5861 1.69838 PNS24246 1044 945 40.9085 5.05794 PNS24248 1044 945 40.9085 5.05794 PNS24244 1471 1372 111.695 9.51202 PNS24243 293 194 0 0 KQK14069 1603 1504 4456.29 346.193 KQK14071 474 375 173.706 54.1222 ==> SRR12897280.se.tsv <== BRADI_1g14170v3 4975 BRADI_1g53295v3 74 BRADI_1g59795v3 332 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 449 BRADI_1g74790v3 137 BRADI_1g09890v3 0 BRADI_1g77505v3 138 BRADI_1g48960v3 0 SRR12897280 completed mapping pipeline successfully