Starting /dee2/code/volunteer_pipeline.sh SRR12897281 current disk space = 1543302811648 free memory = 1604629144 SRR12897281 SRAfilesize 348474867251d6154700ae8e28026888 SRR12897281.sra SRR12897281.sra file validated SRR12897281 is single end SRR12897281 is conventional basespace SRR12897281 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897281_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5965 37.0 37.0 37.0 37.0 37.0 2 36.52225 37.0 37.0 37.0 37.0 37.0 3 36.60375 37.0 37.0 37.0 37.0 37.0 4 36.73425 37.0 37.0 37.0 37.0 37.0 5 36.71725 37.0 37.0 37.0 37.0 37.0 6 36.73075 37.0 37.0 37.0 37.0 37.0 7 36.68525 37.0 37.0 37.0 37.0 37.0 8 36.69975 37.0 37.0 37.0 37.0 37.0 9 36.61025 37.0 37.0 37.0 37.0 37.0 10-11 36.698499999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.68825 37.0 37.0 37.0 37.0 37.0 14-15 36.702749999999995 37.0 37.0 37.0 37.0 37.0 16-17 36.733000000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.71275 37.0 37.0 37.0 37.0 37.0 20-21 36.7355 37.0 37.0 37.0 37.0 37.0 22-23 36.682249999999996 37.0 37.0 37.0 37.0 37.0 24-25 36.711 37.0 37.0 37.0 37.0 37.0 26-27 36.65775 37.0 37.0 37.0 37.0 37.0 28-29 36.657 37.0 37.0 37.0 37.0 37.0 30-31 36.62325 37.0 37.0 37.0 37.0 37.0 32-33 36.64925 37.0 37.0 37.0 37.0 37.0 34-35 36.66325 37.0 37.0 37.0 37.0 37.0 36-37 36.68192048012003 37.0 37.0 37.0 37.0 37.0 38-39 36.65391347836959 37.0 37.0 37.0 37.0 37.0 40-41 36.65066266566642 37.0 37.0 37.0 37.0 37.0 42-43 36.60865216304076 37.0 37.0 37.0 37.0 37.0 44-45 36.65816454113528 37.0 37.0 37.0 37.0 37.0 46-47 36.61190297574393 37.0 37.0 37.0 37.0 37.0 48-49 36.65636544203585 37.0 37.0 37.0 37.0 37.0 50-51 36.64532266133067 37.0 37.0 37.0 37.0 37.0 52-53 36.624812406203105 37.0 37.0 37.0 37.0 37.0 54-55 36.61430715357679 37.0 37.0 37.0 37.0 37.0 56-57 36.63872904678509 37.0 37.0 37.0 37.0 37.0 58-59 36.65298974230673 37.0 37.0 37.0 37.0 37.0 60-61 36.58723404255319 37.0 37.0 37.0 37.0 37.0 62-63 36.60425531914893 37.0 37.0 37.0 37.0 37.0 64-65 36.66078109655096 37.0 37.0 37.0 37.0 37.0 66-67 36.663786041137655 37.0 37.0 37.0 37.0 37.0 68-69 36.64996241543473 37.0 37.0 37.0 37.0 37.0 70-71 36.52199331369285 37.0 37.0 37.0 37.0 37.0 72-73 36.647029330659315 37.0 37.0 37.0 37.0 37.0 74-75 36.616498391310415 37.0 37.0 37.0 37.0 37.0 76-77 36.65110250559861 37.0 37.0 37.0 37.0 37.0 78-79 36.58212102515823 37.0 37.0 37.0 37.0 37.0 80-81 36.57783893076844 37.0 37.0 37.0 37.0 37.0 82-83 36.58187143656127 37.0 37.0 37.0 37.0 37.0 84-85 36.66352594013741 37.0 37.0 37.0 37.0 37.0 86-87 36.52741436754272 37.0 37.0 37.0 37.0 37.0 88-89 36.564262179622624 37.0 37.0 37.0 37.0 37.0 90-91 36.59153193030306 37.0 37.0 37.0 37.0 37.0 92-93 36.56816615308847 37.0 37.0 37.0 37.0 37.0 94-95 36.548866800408426 37.0 37.0 37.0 37.0 37.0 96-97 36.60301151086529 37.0 37.0 37.0 37.0 37.0 98-99 36.64110714042147 37.0 37.0 37.0 37.0 37.0 100-101 36.539166178427315 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 4.0 26 1.0 27 8.0 28 6.0 29 12.0 30 12.0 31 16.0 32 15.0 33 23.0 34 47.0 35 116.0 36 2088.0 37 1650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.33933933933934 13.263263263263264 4.804804804804805 42.592592592592595 2 20.38009502375594 12.278069517379345 37.70942735683921 29.632408102025504 3 17.37934483620905 16.25406351587897 27.431857964491122 38.93473368342086 4 23.005751437859466 24.356089022255563 23.25581395348837 29.382345586396596 5 26.981745436359088 28.207051762940733 23.15578894723681 21.655413853463365 6 21.980495123780948 31.682920730182545 22.680670167541887 23.655913978494624 7 16.52913228307077 24.58114528632158 40.960240060015 17.92948237059265 8 18.179544886221557 24.131032758189548 31.357839459864966 26.331582895723933 9 17.029257314328582 22.930732683170792 35.35883970992748 24.681170292573142 10-11 22.118029507376843 29.969992498124533 24.281070267566893 23.63090772693173 12-13 21.75543885971493 24.293573393348336 27.494373593398347 26.456614153538382 14-15 22.455613903475868 25.068767191797946 27.25681420355089 25.218804701175294 16-17 22.705676419104776 26.019004751187797 26.39409852463116 24.88122030507627 18-19 21.842960740185045 25.63140785196299 25.6064016004001 26.91922980745186 20-21 21.9679919979995 26.131532883220803 26.85671417854464 25.04376094023506 22-23 21.94298574643661 26.056514128532132 26.806701675418854 25.1937984496124 24-25 22.50562640660165 25.131282820705174 25.95648912228057 26.406601650412604 26-27 22.255563890972745 26.556639159789945 25.11877969492373 26.069017254313575 28-29 23.093273318329583 25.218804701175294 25.668917229307326 26.019004751187797 30-31 22.930732683170792 26.881720430107524 24.681170292573142 25.506376594148538 32-33 22.405601400350086 27.04426106526632 24.968742185546386 25.581395348837212 34-35 22.83070767691923 26.494123530882717 25.593898474618655 25.081270317579396 36-37 23.418354588647162 25.431357839459867 24.918729682420604 26.231557889472366 38-39 21.655413853463365 26.63165791447862 26.831707926981746 24.88122030507627 40-41 22.455613903475868 26.144036009002253 25.63140785196299 25.76894223555889 42-43 23.40585146286572 25.156289072268066 25.893973493373345 25.543885971492873 44-45 22.393098274568644 26.544136034008503 25.693923480870218 25.36884221055264 46-47 22.468117029257314 26.79419854963741 25.44386096524131 25.29382345586397 48-49 21.645617106414903 26.43491309240965 25.872202075778418 26.04726772539702 50-51 22.623811905952977 26.338169084542272 25.975487743871934 25.062531265632813 52-53 22.098549274637318 26.638319159579787 25.212606303151574 26.050525262631314 54-55 22.26113056528264 26.600800400200097 24.79989994997499 26.338169084542272 56-57 22.141606204653492 25.55666750062547 26.194645984488368 26.10708031023267 58-59 22.992244183137352 25.69427070302727 26.36977733299975 24.943707780835627 60-61 22.966207759699625 25.431789737171464 25.96996245306633 25.632040050062578 62-63 22.678347934918648 25.556946182728414 25.769712140175223 25.994993742177723 64-65 23.00663412191764 25.86055826761797 26.236074602578547 24.896733007885842 66-67 23.562570462232244 25.078291369159462 25.829888513090317 25.529249655517976 68-69 22.25006264094212 26.45953395139063 25.119017790027563 26.171385617639693 70-71 22.922672014036845 27.071061536533403 25.166060909888454 24.840205539541298 72-73 22.724993732765103 25.670594133868136 24.943594885936324 26.660817247430437 74-75 22.04665161775771 26.799598695761222 25.99699021820918 25.156759468271883 76-77 23.807730923694777 26.92018072289157 25.27610441767068 23.99598393574297 78-79 22.564038171772978 26.406328478151682 25.23857358111502 25.791059768960324 80-81 22.72898605352431 26.385224274406333 25.64392511622063 25.241864555848725 82-83 23.04594084329767 25.601006922592827 25.8275645059786 25.5254877281309 84-85 23.402646502835537 25.79710144927536 24.24700693131695 26.55324511657215 86-87 22.921405104877433 26.497346474601972 25.928733889310084 24.652514531210514 88-89 23.6082995951417 26.18927125506073 24.493927125506072 25.708502024291498 90-91 23.210439630051948 25.351577347016345 25.402255162802483 26.035727860129228 92-93 22.645825390773926 25.657643919176515 26.36929724234337 25.32723344770619 94-95 23.053396202370333 25.67860328788072 26.825538422327007 24.442462087421944 96-97 23.256111608857033 25.406373992064506 26.25111992832459 25.08639447075387 98-99 22.757540148844495 24.833529181355267 26.21752186969578 26.191408800104455 100-101 24.33366238894373 11.994076999012833 31.178019085225404 32.49424152681803 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 2.5 27 4.5 28 3.0 29 6.0 30 9.0 31 8.5 32 12.5 33 15.0 34 25.5 35 35.5 36 50.0 37 70.0 38 86.0 39 103.5 40 123.0 41 149.0 42 159.5 43 179.0 44 208.5 45 218.0 46 218.0 47 211.0 48 211.5 49 218.0 50 185.5 51 163.5 52 152.5 53 135.0 54 127.0 55 111.0 56 94.5 57 82.0 58 78.0 59 69.5 60 73.0 61 73.5 62 63.5 63 57.5 64 47.0 65 42.0 66 40.0 67 32.0 68 21.0 69 13.0 70 10.5 71 6.5 72 5.5 73 4.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 1.0 50-51 0.0 52-53 0.0 54-55 1.0 56-57 0.0 58-59 2.0 60-61 0.0 62-63 0.0 64-65 3.0 66-67 1.0 68-69 1.0 70-71 1.0 72-73 1.0 74-75 3.0 76-77 2.0 78-79 3.0 80-81 6.0 82-83 4.0 84-85 12.0 86-87 4.0 88-89 6.0 90-91 10.0 92-93 12.0 94-95 14.0 96-97 37.0 98-99 376.0 100-101 3499.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.4768985661179 88.94999999999999 2 4.938927243759958 9.3 3 0.5045140732873075 1.425 4 0.05310674455655868 0.2 5 0.02655337227827934 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTTGTCAACCCCAAGTGACTGAGAGATCTCGAAGTAACTCCTTGCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817717 READS because READLEN < 1 Read 817717 spots for SRR12897281.sra Written 817717 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra Rejected 817706 READS because READLEN < 1 Read 817706 spots for SRR12897281.sra Written 817706 spots for SRR12897281.sra SRR ids: ['SRR12897281.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_941kauop SRR12897281.sra spots: 16354131 blocks: [[1, 817706], [817707, 1635412], [1635413, 2453118], [2453119, 3270824], [3270825, 4088530], [4088531, 4906236], [4906237, 5723942], [5723943, 6541648], [6541649, 7359354], [7359355, 8177060], [8177061, 8994766], [8994767, 9812472], [9812473, 10630178], [10630179, 11447884], [11447885, 12265590], [12265591, 13083296], [13083297, 13901002], [13901003, 14718708], [14718709, 15536414], [15536415, 16354131]] SRR12897281 file size 3910669 SRR12897281 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897281 SRR12897281_1.fastq Input file: SRR12897281_1.fastq trimmed: SRR12897281-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:52:00 2024 >> started Sat Dec 7 12:52:08 2024 >> done (7.859s) 16354131 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 2187 ( 0.01%) empty reads filtered out after trimming by size control 16351939 (99.99%) reads available; of these: 323 ( 0.00%) trimmed reads available after processing 16351616 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 0 0.00% 32 2 0.00% 33 3 0.00% 34 1 0.00% 35 38 0.00% 36 34 0.00% 37 54 0.00% 38 60 0.00% 39 70 0.00% 40 84 0.00% 41 96 0.00% 42 91 0.00% 43 96 0.00% 44 115 0.00% 45 121 0.00% 46 164 0.00% 47 163 0.00% 48 199 0.00% 49 275 0.00% 50 328 0.00% 51 362 0.00% 52 367 0.00% 53 403 0.00% 54 429 0.00% 55 467 0.00% 56 508 0.00% 57 573 0.00% 58 698 0.00% 59 823 0.01% 60 1033 0.01% 61 1135 0.01% 62 1244 0.01% 63 1324 0.01% 64 1518 0.01% 65 1505 0.01% 66 1651 0.01% 67 1936 0.01% 68 2137 0.01% 69 2435 0.01% 70 2805 0.02% 71 3069 0.02% 72 3789 0.02% 73 4002 0.02% 74 4294 0.03% 75 5012 0.03% 76 5413 0.03% 77 5775 0.04% 78 6537 0.04% 79 7454 0.05% 80 8011 0.05% 81 9201 0.06% 82 10325 0.06% 83 11432 0.07% 84 12842 0.08% 85 14355 0.09% 86 15328 0.09% 87 17244 0.11% 88 18661 0.11% 89 19938 0.12% 90 22095 0.14% 91 24285 0.15% 92 24692 0.15% 93 27349 0.17% 94 30680 0.19% 95 34992 0.21% 96 55592 0.34% 97 115157 0.70% 98 340619 2.08% 99 1115492 6.82% 100 3872433 23.68% 101 10480519 64.09% 16351939 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.42 prefix-fanout=2.0 sequence=GTGCAGTTTGAGCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=45.99 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=13.1 sequence=TCCTCTTCTTCCTCCT Started job on | Dec 07 12:52:24 Started mapping on | Dec 07 12:52:24 Finished on | Dec 07 12:52:45 Mapping speed, Million of reads per hour | 2803.19 Number of input reads | 16351939 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15601312 Uniquely mapped reads % | 95.41% Average mapped length | 99.94 Number of splices: Total | 5151257 Number of splices: Annotated (sjdb) | 4882438 Number of splices: GT/AG | 5067042 Number of splices: GC/AG | 73816 Number of splices: AT/AC | 2972 Number of splices: Non-canonical | 7427 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227393 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 101357 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 523234 523234 523234 N_multimapping 227393 227393 227393 N_noFeature 692989 15165277 809537 N_ambiguous 342390 1107 23647 UnstrandedReadsAssigned:14565933 PositiveStrandReadsAssigned:434928 NegativeStrandReadsAssigned:14768128 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897281 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897281-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,351,939 reads, 14,880,423 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 SRR12897281.ke.tsv 35125 SRR12897281.se.tsv 88098 total ==> SRR12897281.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 147.006 20.4471 PNS24247 1044 945 43.6155 5.37317 PNS24249 1928 1829 27.2318 1.73335 PNS24246 1044 945 43.6155 5.37317 PNS24248 1044 945 43.6155 5.37317 PNS24244 1471 1372 187.916 15.9453 PNS24243 293 194 0 0 KQK14069 1603 1504 11827.9 915.551 KQK14071 474 375 491.945 152.724 ==> SRR12897281.se.tsv <== BRADI_1g14170v3 13259 BRADI_1g53295v3 47 BRADI_1g59795v3 357 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 338 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 156 BRADI_1g48960v3 0 SRR12897281 completed mapping pipeline successfully