Starting /dee2/code/volunteer_pipeline.sh SRR12897282 current disk space = 1543301337088 free memory = 1603255948 SRR12897282 SRAfilesize 9ab1074595d85a32ecf6af62dfbc21b9 SRR12897282.sra SRR12897282.sra file validated SRR12897282 is single end SRR12897282 is conventional basespace SRR12897282 read1 length is 57-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12897282_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 57-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.673 37.0 37.0 37.0 37.0 37.0 2 36.603 37.0 37.0 37.0 37.0 37.0 3 36.691 37.0 37.0 37.0 37.0 37.0 4 36.7105 37.0 37.0 37.0 37.0 37.0 5 36.732 37.0 37.0 37.0 37.0 37.0 6 36.6865 37.0 37.0 37.0 37.0 37.0 7 36.6765 37.0 37.0 37.0 37.0 37.0 8 36.737 37.0 37.0 37.0 37.0 37.0 9 36.6925 37.0 37.0 37.0 37.0 37.0 10-11 36.750249999999994 37.0 37.0 37.0 37.0 37.0 12-13 36.68375 37.0 37.0 37.0 37.0 37.0 14-15 36.70575 37.0 37.0 37.0 37.0 37.0 16-17 36.67575 37.0 37.0 37.0 37.0 37.0 18-19 36.73650000000001 37.0 37.0 37.0 37.0 37.0 20-21 36.745000000000005 37.0 37.0 37.0 37.0 37.0 22-23 36.68025 37.0 37.0 37.0 37.0 37.0 24-25 36.65775 37.0 37.0 37.0 37.0 37.0 26-27 36.628249999999994 37.0 37.0 37.0 37.0 37.0 28-29 36.656499999999994 37.0 37.0 37.0 37.0 37.0 30-31 36.690749999999994 37.0 37.0 37.0 37.0 37.0 32-33 36.6255 37.0 37.0 37.0 37.0 37.0 34-35 36.7025 37.0 37.0 37.0 37.0 37.0 36-37 36.641 37.0 37.0 37.0 37.0 37.0 38-39 36.6055 37.0 37.0 37.0 37.0 37.0 40-41 36.61775 37.0 37.0 37.0 37.0 37.0 42-43 36.6465 37.0 37.0 37.0 37.0 37.0 44-45 36.5965 37.0 37.0 37.0 37.0 37.0 46-47 36.6065 37.0 37.0 37.0 37.0 37.0 48-49 36.657 37.0 37.0 37.0 37.0 37.0 50-51 36.60625 37.0 37.0 37.0 37.0 37.0 52-53 36.6225 37.0 37.0 37.0 37.0 37.0 54-55 36.62475 37.0 37.0 37.0 37.0 37.0 56-57 36.643249999999995 37.0 37.0 37.0 37.0 37.0 58-59 36.576644161040264 37.0 37.0 37.0 37.0 37.0 60-61 36.582645661415356 37.0 37.0 37.0 37.0 37.0 62-63 36.58834162017243 37.0 37.0 37.0 37.0 37.0 64-65 36.62781390695348 37.0 37.0 37.0 37.0 37.0 66-67 36.568534267133565 37.0 37.0 37.0 37.0 37.0 68-69 36.59174351999617 37.0 37.0 37.0 37.0 37.0 70-71 36.57267950963222 37.0 37.0 37.0 37.0 37.0 72-73 36.59429373052652 37.0 37.0 37.0 37.0 37.0 74-75 36.60751398865851 37.0 37.0 37.0 37.0 37.0 76-77 36.5407887354385 37.0 37.0 37.0 37.0 37.0 78-79 36.53191405686142 37.0 37.0 37.0 37.0 37.0 80-81 36.56485853096279 37.0 37.0 37.0 37.0 37.0 82-83 36.64522613065327 37.0 37.0 37.0 37.0 37.0 84-85 36.62085651632843 37.0 37.0 37.0 37.0 37.0 86-87 36.571831048632944 37.0 37.0 37.0 37.0 37.0 88-89 36.53764816992888 37.0 37.0 37.0 37.0 37.0 90-91 36.554716978233444 37.0 37.0 37.0 37.0 37.0 92-93 36.52032188215992 37.0 37.0 37.0 37.0 37.0 94-95 36.553478984306906 37.0 37.0 37.0 37.0 37.0 96-97 36.592560742755836 37.0 37.0 37.0 37.0 37.0 98-99 36.55825504728334 37.0 37.0 37.0 37.0 37.0 100-101 36.47299900533557 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 0.0 26 4.0 27 7.0 28 10.0 29 8.0 30 13.0 31 15.0 32 24.0 33 35.0 34 45.0 35 106.0 36 2091.0 37 1640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.73673673673674 11.336336336336336 6.331331331331332 45.5955955955956 2 21.5 11.875 36.325 30.3 3 18.75 14.45 25.45 41.349999999999994 4 24.7 22.900000000000002 21.525 30.875000000000004 5 27.575 27.950000000000003 22.625 21.85 6 21.85 31.4 22.85 23.9 7 18.825 24.15 38.6 18.425 8 19.8 23.25 30.8 26.150000000000002 9 18.4 21.099999999999998 35.85 24.65 10-11 23.6625 30.4 23.6125 22.325 12-13 22.5625 23.200000000000003 27.35 26.887499999999996 14-15 22.6125 24.3 27.8375 25.25 16-17 23.962500000000002 24.087500000000002 26.437500000000004 25.5125 18-19 22.787499999999998 25.687500000000004 25.5625 25.9625 20-21 23.0125 25.825 26.075 25.087500000000002 22-23 22.9625 26.5375 25.6125 24.887500000000003 24-25 22.5 25.2625 26.1125 26.125 26-27 21.6625 25.6125 26.387500000000003 26.337500000000002 28-29 22.9375 25.5 25.7625 25.8 30-31 22.425 25.974999999999998 25.0 26.6 32-33 22.925 26.387500000000003 25.937500000000004 24.75 34-35 24.55 24.725 25.3 25.424999999999997 36-37 22.4875 26.1125 25.575 25.825 38-39 22.775000000000002 25.7 26.3 25.224999999999998 40-41 23.0 25.650000000000002 25.637500000000003 25.7125 42-43 22.6 25.874999999999996 24.75 26.775 44-45 23.3625 25.5375 25.8 25.3 46-47 23.125 25.95 25.6 25.324999999999996 48-49 22.175 25.362499999999997 25.85 26.6125 50-51 21.25 26.0625 27.1625 25.525 52-53 23.3 26.2875 24.95 25.4625 54-55 22.2 25.4375 25.5375 26.825 56-57 22.6125 26.55 25.7 25.137500000000003 58-59 22.943235808952238 25.6064016004001 25.406351587896975 26.04401100275069 60-61 23.468367091772944 25.506376594148538 25.918979744936234 25.10627656914228 62-63 22.2708515693385 26.447417781668126 25.196948855820935 26.08478179317244 64-65 22.686343171585793 25.962981490745374 25.512756378189096 25.83791895947974 66-67 23.574287143571787 25.550275137568786 25.65032516258129 25.22511255627814 68-69 23.151969981238274 26.12883051907442 25.25328330206379 25.465916197623518 70-71 22.52939704778584 26.08206154615962 25.74430823117338 25.64423317488116 72-73 22.70053810536854 25.76648729821049 25.090727067951445 26.442247528469526 74-75 22.316844082654978 26.374452097683154 26.938008766437072 24.370695053224797 76-77 23.398922170698082 25.730041358566236 24.877804236119815 25.993232234615864 78-79 23.36636146996112 25.92499686441741 24.557882854634393 26.150758810987078 80-81 22.97365119196989 25.345043914680048 25.796737766624844 25.884567126725223 82-83 23.479899497487438 25.678391959798997 25.791457286432163 25.05025125628141 84-85 23.356379635449404 25.29226901319925 25.29226901319925 26.059082338152106 86-87 23.81312177307644 25.475380934391133 25.22352348570709 25.487973806825337 88-89 23.193340900491865 25.96796569554799 25.75356287047547 25.08513053348468 90-91 23.516761543327007 25.426944971537 25.75585072738773 25.30044275774826 92-93 23.004575495678697 25.457549567869854 26.34722928317234 25.190645653279102 94-95 23.742017879948914 25.54278416347382 25.057471264367813 25.657726692209447 96-97 24.15434083601286 25.64630225080386 25.401929260450164 24.79742765273312 98-99 23.607843137254903 23.869281045751634 26.588235294117645 25.934640522875817 100-101 24.30839744639057 11.458503846783435 31.903748567687018 32.329350139138974 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 0.5 28 1.0 29 2.5 30 6.0 31 14.0 32 16.5 33 13.5 34 18.0 35 28.5 36 38.0 37 54.5 38 91.0 39 103.5 40 117.0 41 148.5 42 173.5 43 201.0 44 205.0 45 191.5 46 186.0 47 207.5 48 216.0 49 191.0 50 178.0 51 168.5 52 152.0 53 141.5 54 127.0 55 111.0 56 107.5 57 93.5 58 84.0 59 86.0 60 74.0 61 63.0 62 58.0 63 53.5 64 48.5 65 49.5 66 49.5 67 45.5 68 32.5 69 17.5 70 13.0 71 11.5 72 7.5 73 5.0 74 4.0 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 2.0 74 1.0 75 2.0 76 1.0 77 2.0 78 1.0 79 0.0 80 2.0 81 4.0 82 0.0 83 1.0 84 3.0 85 4.0 86 3.0 87 3.0 88 3.0 89 5.0 90 11.0 91 10.0 92 6.0 93 10.0 94 12.0 95 13.0 96 17.0 97 17.0 98 74.0 99 276.0 100 915.0 101 2597.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.99077247561297 90.075 2 4.5873978381228575 8.7 3 0.3954653308726601 1.125 4 0.02636435539151068 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844042 READS because READLEN < 1 Read 844042 spots for SRR12897282.sra Written 844042 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra Rejected 844040 READS because READLEN < 1 Read 844040 spots for SRR12897282.sra Written 844040 spots for SRR12897282.sra SRR ids: ['SRR12897282.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c_jq4yj1 SRR12897282.sra spots: 16880802 blocks: [[1, 844040], [844041, 1688080], [1688081, 2532120], [2532121, 3376160], [3376161, 4220200], [4220201, 5064240], [5064241, 5908280], [5908281, 6752320], [6752321, 7596360], [7596361, 8440400], [8440401, 9284440], [9284441, 10128480], [10128481, 10972520], [10972521, 11816560], [11816561, 12660600], [12660601, 13504640], [13504641, 14348680], [14348681, 15192720], [15192721, 16036760], [16036761, 16880802]] SRR12897282 file size 4035245 SRR12897282 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12897282 SRR12897282_1.fastq Input file: SRR12897282_1.fastq trimmed: SRR12897282-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:51:58 2024 >> started Sat Dec 7 12:52:07 2024 >> done (8.784s) 16880802 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 3751 ( 0.02%) empty reads filtered out after trimming by size control 16877048 (99.98%) reads available; of these: 310 ( 0.00%) trimmed reads available after processing 16876738 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 2 0.00% 35 37 0.00% 36 34 0.00% 37 48 0.00% 38 54 0.00% 39 52 0.00% 40 68 0.00% 41 90 0.00% 42 102 0.00% 43 101 0.00% 44 82 0.00% 45 88 0.00% 46 134 0.00% 47 190 0.00% 48 203 0.00% 49 270 0.00% 50 298 0.00% 51 339 0.00% 52 412 0.00% 53 423 0.00% 54 435 0.00% 55 414 0.00% 56 541 0.00% 57 586 0.00% 58 746 0.00% 59 889 0.01% 60 1133 0.01% 61 1273 0.01% 62 1483 0.01% 63 1582 0.01% 64 1632 0.01% 65 1878 0.01% 66 2021 0.01% 67 2258 0.01% 68 2551 0.02% 69 2837 0.02% 70 3487 0.02% 71 3964 0.02% 72 4443 0.03% 73 4949 0.03% 74 5471 0.03% 75 5938 0.04% 76 6673 0.04% 77 7468 0.04% 78 8166 0.05% 79 8989 0.05% 80 10128 0.06% 81 11257 0.07% 82 12674 0.08% 83 14148 0.08% 84 15889 0.09% 85 17542 0.10% 86 19146 0.11% 87 21124 0.13% 88 22654 0.13% 89 24602 0.15% 90 27363 0.16% 91 29199 0.17% 92 30622 0.18% 93 33621 0.20% 94 37901 0.22% 95 42202 0.25% 96 62708 0.37% 97 123794 0.73% 98 357431 2.12% 99 1152134 6.83% 100 3936447 23.32% 101 10789616 63.93% 16877048 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=31 prefix-density=0.41 prefix-fanout=2.0 sequence=GTGCAGTTTGAGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=59.02 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.0 sequence=CCTCCTCCTTGCC Started job on | Dec 07 12:52:23 Started mapping on | Dec 07 12:52:23 Finished on | Dec 07 12:52:49 Mapping speed, Million of reads per hour | 2336.82 Number of input reads | 16877048 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16133731 Uniquely mapped reads % | 95.60% Average mapped length | 99.88 Number of splices: Total | 5283746 Number of splices: Annotated (sjdb) | 4999391 Number of splices: GT/AG | 5194557 Number of splices: GC/AG | 78514 Number of splices: AT/AC | 3034 Number of splices: Non-canonical | 7641 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237071 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 98682 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 506246 506246 506246 N_multimapping 237071 237071 237071 N_noFeature 682297 15692415 799832 N_ambiguous 347347 1108 24207 UnstrandedReadsAssigned:15104087 PositiveStrandReadsAssigned:440208 NegativeStrandReadsAssigned:15309692 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR12897282 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR12897282-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,877,048 reads, 15,428,790 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52973 SRR12897282.ke.tsv 35125 SRR12897282.se.tsv 88098 total ==> SRR12897282.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 70.7712 9.39676 PNS24247 1044 945 61.8113 7.26914 PNS24249 1928 1829 34.0387 2.06826 PNS24246 1044 945 61.8113 7.26914 PNS24248 1044 945 61.8113 7.26914 PNS24244 1471 1372 154.756 12.5355 PNS24243 293 194 0 0 KQK14069 1603 1504 13391 989.491 KQK14071 474 375 602.278 178.489 ==> SRR12897282.se.tsv <== BRADI_1g14170v3 15245 BRADI_1g53295v3 54 BRADI_1g59795v3 334 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 383 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 153 BRADI_1g48960v3 0 SRR12897282 completed mapping pipeline successfully