Starting /dee2/code/volunteer_pipeline.sh SRR12949783 current disk space = 1543994552320 free memory = 1595022224 SRR12949783 SRAfilesize 46d89ffbd9d8369d1e1b4c9ba1636107 SRR12949783.sra SRR12949783.sra file validated SRR12949783 is paired end SRR12949783 is conventional basespace SRR12949783 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949783_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.254 37.0 37.0 37.0 37.0 37.0 2 35.7175 37.0 37.0 37.0 37.0 37.0 3 36.3335 37.0 37.0 37.0 37.0 37.0 4 36.4345 37.0 37.0 37.0 37.0 37.0 5 36.485 37.0 37.0 37.0 37.0 37.0 6 36.4905 37.0 37.0 37.0 37.0 37.0 7 36.5 37.0 37.0 37.0 37.0 37.0 8 36.5005 37.0 37.0 37.0 37.0 37.0 9 36.4295 37.0 37.0 37.0 37.0 37.0 10-14 36.53959999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.509100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4932 37.0 37.0 37.0 37.0 37.0 25-29 36.43429999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.4622 37.0 37.0 37.0 37.0 37.0 35-39 36.4362 37.0 37.0 37.0 37.0 37.0 40-44 36.4113 37.0 37.0 37.0 37.0 37.0 45-49 36.376400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.34779999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3707 37.0 37.0 37.0 37.0 37.0 60-64 36.3084 37.0 37.0 37.0 37.0 37.0 65-69 36.2782 37.0 37.0 37.0 37.0 37.0 70-74 36.237 37.0 37.0 37.0 37.0 37.0 75-79 36.2372 37.0 37.0 37.0 37.0 37.0 80-84 36.1668 37.0 37.0 37.0 37.0 37.0 85-89 36.1329 37.0 37.0 37.0 37.0 37.0 90-94 36.170899999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.13779999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1082 37.0 37.0 37.0 37.0 37.0 105-109 36.0372 37.0 37.0 37.0 37.0 37.0 110-114 35.9765 37.0 37.0 37.0 37.0 37.0 115-119 35.9756 37.0 37.0 37.0 37.0 37.0 120-124 35.9324 37.0 37.0 37.0 37.0 37.0 125-129 35.907 37.0 37.0 37.0 37.0 37.0 130-134 35.760299999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.7144 37.0 37.0 37.0 37.0 37.0 140-144 35.5182 37.0 37.0 37.0 37.0 37.0 145-149 35.51780000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.39775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 2.0 24 3.0 25 5.0 26 8.0 27 9.0 28 16.0 29 18.0 30 25.0 31 35.0 32 45.0 33 97.0 34 156.0 35 411.0 36 2705.0 37 463.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.4 8.774999999999999 7.1499999999999995 35.675000000000004 2 23.748103186646432 9.585230146686898 32.144663631765305 34.52200303490137 3 21.825 14.924999999999999 24.349999999999998 38.9 4 26.75 20.05 21.425 31.775 5 27.925 25.974999999999998 22.875 23.225 6 26.35 29.099999999999998 21.175 23.375 7 19.525000000000002 24.425 37.925 18.125 8 20.424999999999997 25.424999999999997 29.675 24.474999999999998 9 21.175 20.775 32.6 25.45 10-14 24.265 26.119999999999997 25.085 24.529999999999998 15-19 23.815 24.36 25.430000000000003 26.395000000000003 20-24 24.22 24.415 25.365 26.0 25-29 24.044999999999998 25.035 24.495 26.424999999999997 30-34 24.345 24.875 24.525 26.255 35-39 23.87 24.654999999999998 24.695 26.779999999999998 40-44 24.265 25.28 24.41 26.045 45-49 24.2 24.91 24.595 26.295 50-54 23.845 24.62 25.314999999999998 26.22 55-59 24.595 24.515 24.65 26.240000000000002 60-64 24.04 24.58 24.560000000000002 26.82 65-69 24.0 24.94 24.72 26.340000000000003 70-74 25.035 24.625 24.235 26.105 75-79 24.355 24.785 24.775 26.085 80-84 24.11 24.779999999999998 25.124999999999996 25.985000000000003 85-89 25.05 24.474999999999998 24.33 26.145000000000003 90-94 24.38 24.275 24.64 26.705000000000002 95-99 24.34 24.490000000000002 24.685000000000002 26.484999999999996 100-104 24.47 24.04 24.565 26.924999999999997 105-109 24.95 24.585 24.055 26.41 110-114 24.154999999999998 24.875 24.395 26.575 115-119 25.259999999999998 24.165 24.39 26.185000000000002 120-124 25.11 24.335 24.095 26.46 125-129 24.975 24.5 24.165 26.36 130-134 24.855 24.855 23.76 26.529999999999998 135-139 25.424999999999997 24.635 24.25 25.69 140-144 24.68 23.995 24.740000000000002 26.584999999999997 145-149 25.41 24.955 23.325000000000003 26.31 150-151 25.837500000000002 24.1125 24.55 25.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 2.5 27 4.5 28 5.0 29 3.0 30 5.0 31 8.5 32 12.5 33 18.0 34 22.5 35 33.5 36 47.0 37 61.0 38 75.5 39 107.5 40 130.0 41 130.5 42 141.0 43 162.0 44 173.0 45 180.0 46 191.0 47 184.0 48 153.0 49 128.0 50 137.0 51 145.5 52 141.5 53 113.0 54 98.0 55 104.0 56 97.0 57 88.5 58 83.0 59 76.0 60 71.0 61 82.0 62 83.0 63 73.0 64 70.5 65 69.5 66 70.0 67 74.5 68 68.0 69 53.5 70 45.5 71 44.0 72 38.5 73 24.5 74 17.0 75 12.0 76 11.5 77 12.5 78 7.0 79 3.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.93990838049044 86.225 2 6.4672594987873895 12.0 3 0.4850444624090542 1.35 4 0.08084074373484236 0.3 5 0.026946914578280787 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.15 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.2 0.0 0.0 0.0 0.0 124-125 4.4625 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.199999999999999 0.0 0.0 0.0 0.0 138-139 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 30 0.0014452472 24.162498 10-14 >>END_MODULE SRR12949783 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949783_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.132 37.0 37.0 37.0 37.0 37.0 2 36.1625 37.0 37.0 37.0 37.0 37.0 3 36.182 37.0 37.0 37.0 37.0 37.0 4 36.18 37.0 37.0 37.0 37.0 37.0 5 36.2415 37.0 37.0 37.0 37.0 37.0 6 36.087 37.0 37.0 37.0 37.0 37.0 7 36.209 37.0 37.0 37.0 37.0 37.0 8 36.1905 37.0 37.0 37.0 37.0 37.0 9 36.202 37.0 37.0 37.0 37.0 37.0 10-14 36.2509 37.0 37.0 37.0 37.0 37.0 15-19 36.2003 37.0 37.0 37.0 37.0 37.0 20-24 36.2257 37.0 37.0 37.0 37.0 37.0 25-29 36.1687 37.0 37.0 37.0 37.0 37.0 30-34 36.072500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.0945 37.0 37.0 37.0 37.0 37.0 40-44 36.0375 37.0 37.0 37.0 37.0 37.0 45-49 36.0563 37.0 37.0 37.0 37.0 37.0 50-54 35.98480000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.998400000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9156 37.0 37.0 37.0 37.0 37.0 65-69 35.9375 37.0 37.0 37.0 37.0 37.0 70-74 35.8818 37.0 37.0 37.0 37.0 37.0 75-79 35.847300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.871500000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.831599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.786 37.0 37.0 37.0 37.0 37.0 95-99 35.7701 37.0 37.0 37.0 37.0 37.0 100-104 35.778099999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.742900000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.67569999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.688700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5457 37.0 37.0 37.0 37.0 37.0 125-129 35.594199999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.4614 37.0 37.0 37.0 37.0 37.0 135-139 35.3935 37.0 37.0 37.0 34.6 37.0 140-144 35.3423 37.0 37.0 37.0 34.6 37.0 145-149 35.2194 37.0 37.0 37.0 32.2 37.0 150-151 34.899249999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 1.0 16 0.0 17 2.0 18 4.0 19 2.0 20 1.0 21 2.0 22 3.0 23 6.0 24 7.0 25 13.0 26 9.0 27 16.0 28 14.0 29 20.0 30 28.0 31 41.0 32 65.0 33 114.0 34 217.0 35 552.0 36 2578.0 37 300.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.4 17.375 9.049999999999999 30.175 2 31.125000000000004 20.325 26.05 22.5 3 24.175 24.0 28.625 23.200000000000003 4 27.900000000000002 28.299999999999997 19.7 24.099999999999998 5 30.15 31.0 19.225 19.625 6 24.349999999999998 34.075 19.325 22.25 7 23.025000000000002 19.8 32.275 24.9 8 23.200000000000003 22.875 24.85 29.075 9 24.6 21.45 26.1 27.85 10-14 26.165 24.94 22.545 26.35 15-19 26.095000000000002 24.52 23.369999999999997 26.015 20-24 25.91 24.695 23.685000000000002 25.71 25-29 26.565 24.404999999999998 23.31 25.72 30-34 26.19 24.575 23.66 25.575 35-39 26.545 25.064999999999998 23.205000000000002 25.185000000000002 40-44 26.815 24.099999999999998 23.965 25.119999999999997 45-49 26.229999999999997 24.58 23.385 25.805 50-54 26.700000000000003 24.73 23.555 25.014999999999997 55-59 26.169999999999998 24.154999999999998 23.78 25.895000000000003 60-64 26.235000000000003 24.37 23.66 25.735000000000003 65-69 26.905 23.575 23.825 25.695 70-74 26.265 24.65 23.525 25.56 75-79 26.185000000000002 24.325 23.885 25.605 80-84 27.38 24.11 23.365 25.145 85-89 27.015 24.26 23.52 25.205 90-94 26.284999999999997 24.66 23.59 25.465 95-99 27.38 24.3 23.66 24.66 100-104 27.38 24.025 23.7 24.895 105-109 26.784999999999997 24.7 23.765 24.75 110-114 26.790000000000003 24.85 23.79 24.57 115-119 27.355 24.995 23.119999999999997 24.529999999999998 120-124 27.450000000000003 24.85 23.669999999999998 24.03 125-129 27.76 24.29 23.335 24.615000000000002 130-134 27.62 24.51 23.465 24.404999999999998 135-139 28.12 24.27 24.060000000000002 23.549999999999997 140-144 28.110000000000003 24.975 23.105 23.810000000000002 145-149 28.675 25.005 23.005 23.315 150-151 27.800000000000004 24.95 23.425 23.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.5 26 2.5 27 2.5 28 2.0 29 5.0 30 6.5 31 12.0 32 15.0 33 18.5 34 24.5 35 28.5 36 40.0 37 53.5 38 65.5 39 79.0 40 90.0 41 116.5 42 139.5 43 137.5 44 158.5 45 167.5 46 160.0 47 153.0 48 153.0 49 160.0 50 149.0 51 123.5 52 101.0 53 97.5 54 107.5 55 104.0 56 95.5 57 105.5 58 104.0 59 99.0 60 88.0 61 82.5 62 96.0 63 94.0 64 86.5 65 87.5 66 75.0 67 72.5 68 69.0 69 56.0 70 58.5 71 57.5 72 46.0 73 38.0 74 31.0 75 23.0 76 15.5 77 9.0 78 9.0 79 6.0 80 2.0 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 1.0 89 1.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5945945945946 85.65 2 6.729729729729731 12.45 3 0.6486486486486486 1.7999999999999998 4 0.02702702702702703 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7250000000000001 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.15 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.2 0.0 0.0 0.0 0.0 124-125 4.4625 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 4.862500000000001 0.0 0.0 0.0 0.0 130-131 5.2125 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.199999999999999 0.0 0.0 0.0 0.0 138-139 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTATCA 10 0.006830828 145.0 8 >>END_MODULE Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865930 spots for SRR12949783.sra Written 1865930 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra Read 1865920 spots for SRR12949783.sra Written 1865920 spots for SRR12949783.sra SRR ids: ['SRR12949783.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0zfjdckj SRR12949783.sra spots: 37318410 blocks: [[1, 1865920], [1865921, 3731840], [3731841, 5597760], [5597761, 7463680], [7463681, 9329600], [9329601, 11195520], [11195521, 13061440], [13061441, 14927360], [14927361, 16793280], [16793281, 18659200], [18659201, 20525120], [20525121, 22391040], [22391041, 24256960], [24256961, 26122880], [26122881, 27988800], [27988801, 29854720], [29854721, 31720640], [31720641, 33586560], [33586561, 35452480], [35452481, 37318410]] SRR12949783 file size 12660728 SRR12949783 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949783 SRR12949783_1.fastq SRR12949783_2.fastq Input file: SRR12949783_1.fastq Paired file: SRR12949783_2.fastq trimmed: SRR12949783-trimmed-pair1.fastq, SRR12949783-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:52:59 2024 >> started Sat Dec 7 09:53:54 2024 >> done (55.085s) 37318410 read pairs processed; of these: 174 ( 0.00%) short read pairs filtered out after trimming by size control 27926 ( 0.07%) empty read pairs filtered out after trimming by size control 37290310 (99.92%) read pairs available; of these: 4146656 (11.12%) trimmed read pairs available after processing 33143654 (88.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 17 0.00% 21 16 0.00% 22 30 0.00% 23 24 0.00% 24 27 0.00% 25 35 0.00% 26 29 0.00% 27 39 0.00% 28 47 0.00% 29 57 0.00% 30 52 0.00% 31 66 0.00% 32 72 0.00% 33 56 0.00% 34 68 0.00% 35 61 0.00% 36 74 0.00% 37 108 0.00% 38 85 0.00% 39 85 0.00% 40 105 0.00% 41 117 0.00% 42 146 0.00% 43 145 0.00% 44 130 0.00% 45 127 0.00% 46 182 0.00% 47 201 0.00% 48 204 0.00% 49 256 0.00% 50 292 0.00% 51 344 0.00% 52 373 0.00% 53 394 0.00% 54 438 0.00% 55 515 0.00% 56 531 0.00% 57 600 0.00% 58 728 0.00% 59 885 0.00% 60 1083 0.00% 61 1226 0.00% 62 1343 0.00% 63 1488 0.00% 64 1700 0.00% 65 1844 0.00% 66 2078 0.01% 67 2445 0.01% 68 2631 0.01% 69 3072 0.01% 70 3557 0.01% 71 4050 0.01% 72 4505 0.01% 73 5015 0.01% 74 5403 0.01% 75 6213 0.02% 76 6598 0.02% 77 7276 0.02% 78 7876 0.02% 79 8622 0.02% 80 9252 0.02% 81 9873 0.03% 82 11201 0.03% 83 11872 0.03% 84 13112 0.04% 85 13958 0.04% 86 14842 0.04% 87 15658 0.04% 88 16808 0.05% 89 17456 0.05% 90 18234 0.05% 91 19481 0.05% 92 20291 0.05% 93 21493 0.06% 94 22841 0.06% 95 24040 0.06% 96 25431 0.07% 97 26660 0.07% 98 27629 0.07% 99 29049 0.08% 100 30521 0.08% 101 30805 0.08% 102 32279 0.09% 103 33559 0.09% 104 34496 0.09% 105 36343 0.10% 106 38475 0.10% 107 39822 0.11% 108 41834 0.11% 109 43134 0.12% 110 44044 0.12% 111 45350 0.12% 112 47073 0.13% 113 48046 0.13% 114 50470 0.14% 115 52685 0.14% 116 54667 0.15% 117 56488 0.15% 118 58975 0.16% 119 59460 0.16% 120 61802 0.17% 121 63541 0.17% 122 65197 0.17% 123 66566 0.18% 124 68686 0.18% 125 70843 0.19% 126 73372 0.20% 127 75422 0.20% 128 76308 0.20% 129 79868 0.21% 130 81673 0.22% 131 83017 0.22% 132 85887 0.23% 133 87330 0.23% 134 88193 0.24% 135 90155 0.24% 136 93067 0.25% 137 93590 0.25% 138 95369 0.26% 139 99774 0.27% 140 100210 0.27% 141 103604 0.28% 142 105761 0.28% 143 106348 0.29% 144 108181 0.29% 145 109860 0.29% 146 111537 0.30% 147 114229 0.31% 148 115693 0.31% 149 118173 0.32% 150 119882 0.32% 151 33143654 88.88% 37290310 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=19 prefix-density=0.48 prefix-fanout=3.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.16 sequence-density-rank=15 fanout-score=51.47 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=11.6 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=32 prefix-density=0.38 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=55.21 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12949783 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:54:36 Started mapping on | Dec 07 09:54:36 Finished on | Dec 07 09:57:16 Mapping speed, Million of reads per hour | 839.03 Number of input reads | 37290310 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 35680283 Uniquely mapped reads % | 95.68% Average mapped length | 295.54 Number of splices: Total | 35025609 Number of splices: Annotated (sjdb) | 32805075 Number of splices: GT/AG | 34564053 Number of splices: GC/AG | 406416 Number of splices: AT/AC | 13717 Number of splices: Non-canonical | 41423 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468817 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 70228 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1141210 1141210 1141210 N_multimapping 468817 468817 468817 N_noFeature 1382800 34673412 1678251 N_ambiguous 867859 5835 156904 UnstrandedReadsAssigned:33429624 PositiveStrandReadsAssigned:1001036 NegativeStrandReadsAssigned:33845128 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949783 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949783-trimmed-pair1.fastq SRR12949783-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,290,310 reads, 34,242,891 reads pseudoaligned [quant] estimated average fragment length: 279.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR12949783.ke.tsv 35125 SRR12949783.se.tsv 88098 total ==> SRR12949783.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.611 0 0 PNS24247 1044 765.915 168.955 9.46312 PNS24249 1928 1649.91 263.781 6.85845 PNS24246 1044 765.915 168.955 9.46312 PNS24248 1044 765.915 168.955 9.46312 PNS24244 1471 1192.91 215.354 7.7444 PNS24243 293 96.944 0 0 KQK14069 1603 1324.91 23649.2 765.725 KQK14071 474 228.305 807.492 151.728 ==> SRR12949783.se.tsv <== BRADI_1g14170v3 28863 BRADI_1g53295v3 167 BRADI_1g59795v3 1036 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 491 BRADI_1g74790v3 283 BRADI_1g09890v3 0 BRADI_1g77505v3 357 BRADI_1g48960v3 0 SRR12949783 completed mapping pipeline successfully