Starting /dee2/code/volunteer_pipeline.sh SRR12949784 current disk space = 1544031793152 free memory = 1603929704 SRR12949784 SRAfilesize 067f2152bbeab1cbe6b332f8c3b647fd SRR12949784.sra SRR12949784.sra file validated SRR12949784 is paired end SRR12949784 is conventional basespace SRR12949784 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949784_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.521 37.0 37.0 37.0 37.0 37.0 2 35.828 37.0 37.0 37.0 37.0 37.0 3 36.481 37.0 37.0 37.0 37.0 37.0 4 36.5625 37.0 37.0 37.0 37.0 37.0 5 36.6105 37.0 37.0 37.0 37.0 37.0 6 36.5875 37.0 37.0 37.0 37.0 37.0 7 36.5305 37.0 37.0 37.0 37.0 37.0 8 36.6185 37.0 37.0 37.0 37.0 37.0 9 36.5845 37.0 37.0 37.0 37.0 37.0 10-14 36.6475 37.0 37.0 37.0 37.0 37.0 15-19 36.6528 37.0 37.0 37.0 37.0 37.0 20-24 36.6136 37.0 37.0 37.0 37.0 37.0 25-29 36.5807 37.0 37.0 37.0 37.0 37.0 30-34 36.5551 37.0 37.0 37.0 37.0 37.0 35-39 36.557500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.54209999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.51989999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4784 37.0 37.0 37.0 37.0 37.0 55-59 36.518299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4494 37.0 37.0 37.0 37.0 37.0 65-69 36.421800000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.4174 37.0 37.0 37.0 37.0 37.0 75-79 36.3879 37.0 37.0 37.0 37.0 37.0 80-84 36.3489 37.0 37.0 37.0 37.0 37.0 85-89 36.330400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.341499999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.273799999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.26950000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.176 37.0 37.0 37.0 37.0 37.0 110-114 36.1901 37.0 37.0 37.0 37.0 37.0 115-119 36.0852 37.0 37.0 37.0 37.0 37.0 120-124 36.1148 37.0 37.0 37.0 37.0 37.0 125-129 36.0347 37.0 37.0 37.0 37.0 37.0 130-134 36.0338 37.0 37.0 37.0 37.0 37.0 135-139 36.0116 37.0 37.0 37.0 37.0 37.0 140-144 35.93730000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.922399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.768 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 1.0 26 0.0 27 2.0 28 14.0 29 17.0 30 19.0 31 25.0 32 45.0 33 71.0 34 125.0 35 310.0 36 2834.0 37 534.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.075 9.925 5.425 32.574999999999996 2 23.152834008097166 10.172064777327936 32.034412955465584 34.64068825910931 3 22.875 14.274999999999999 25.224999999999998 37.625 4 27.900000000000002 18.275 21.975 31.85 5 29.9 25.15 22.225 22.725 6 25.825 29.075 21.45 23.65 7 19.825 23.65 37.25 19.275000000000002 8 20.0 24.2 29.299999999999997 26.5 9 21.55 20.625 32.300000000000004 25.525 10-14 23.755000000000003 26.02 25.655 24.57 15-19 24.115000000000002 24.37 25.21 26.305 20-24 24.26 24.115000000000002 24.88 26.745 25-29 24.41 24.175 25.580000000000002 25.835 30-34 24.985 23.35 25.405 26.26 35-39 23.905 24.05 25.4 26.645000000000003 40-44 24.29 25.2 24.45 26.06 45-49 24.59 24.22 25.11 26.08 50-54 24.44 23.974999999999998 24.740000000000002 26.845000000000002 55-59 24.215 24.775 24.834999999999997 26.174999999999997 60-64 24.349999999999998 24.375 24.57 26.705000000000002 65-69 24.279999999999998 24.349999999999998 24.29 27.08 70-74 24.41 24.585 24.26 26.745 75-79 24.955 24.03 24.915000000000003 26.1 80-84 25.095 24.09 23.97 26.845000000000002 85-89 24.349999999999998 24.34 24.705 26.605 90-94 25.874999999999996 23.76 24.099999999999998 26.265 95-99 24.779999999999998 23.765 24.92 26.534999999999997 100-104 25.055 24.685000000000002 24.3 25.96 105-109 25.115 24.46 24.195 26.229999999999997 110-114 25.2 24.165 24.404999999999998 26.229999999999997 115-119 25.66 23.835 24.305 26.200000000000003 120-124 25.16 23.794999999999998 24.705 26.340000000000003 125-129 24.92 23.91 24.63 26.540000000000003 130-134 25.455 23.78 24.775 25.990000000000002 135-139 25.83 24.16 24.01 26.0 140-144 25.575 23.59 24.12 26.715 145-149 25.180000000000003 24.19 23.98 26.650000000000002 150-151 24.975 23.125 25.112499999999997 26.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.0 27 3.5 28 3.5 29 3.5 30 6.5 31 8.0 32 10.0 33 16.0 34 20.0 35 22.0 36 30.5 37 46.5 38 64.5 39 77.5 40 100.5 41 134.5 42 155.0 43 163.0 44 172.5 45 182.0 46 194.0 47 184.0 48 175.5 49 157.0 50 143.5 51 146.0 52 132.0 53 119.0 54 102.5 55 93.0 56 93.0 57 91.5 58 90.0 59 90.0 60 89.5 61 90.0 62 80.5 63 72.5 64 70.5 65 71.5 66 78.0 67 79.5 68 68.0 69 62.5 70 55.5 71 40.5 72 31.0 73 27.5 74 21.5 75 10.0 76 6.0 77 4.5 78 2.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.69625785304561 83.92500000000001 2 7.53892379131385 13.8 3 0.6009287080032778 1.6500000000000001 4 0.13657470636438132 0.5 5 0.027314941272876262 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.7874999999999996 0.0 0.0 0.0 0.0 134-135 4.112500000000001 0.0 0.0 0.0 0.0 136-137 4.387499999999999 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCATC 10 0.006830828 145.0 1 CTTGACA 10 0.006830828 145.0 2 >>END_MODULE SRR12949784 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949784_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.132 37.0 37.0 37.0 37.0 37.0 2 36.121 37.0 37.0 37.0 37.0 37.0 3 36.1345 37.0 37.0 37.0 37.0 37.0 4 36.1245 37.0 37.0 37.0 37.0 37.0 5 36.261 37.0 37.0 37.0 37.0 37.0 6 36.139 37.0 37.0 37.0 37.0 37.0 7 36.177 37.0 37.0 37.0 37.0 37.0 8 36.2335 37.0 37.0 37.0 37.0 37.0 9 36.209 37.0 37.0 37.0 37.0 37.0 10-14 36.2763 37.0 37.0 37.0 37.0 37.0 15-19 36.2173 37.0 37.0 37.0 37.0 37.0 20-24 36.2081 37.0 37.0 37.0 37.0 37.0 25-29 36.1819 37.0 37.0 37.0 37.0 37.0 30-34 36.083000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.1009 37.0 37.0 37.0 37.0 37.0 40-44 36.063599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0851 37.0 37.0 37.0 37.0 37.0 50-54 36.0298 37.0 37.0 37.0 37.0 37.0 55-59 36.0135 37.0 37.0 37.0 37.0 37.0 60-64 36.0142 37.0 37.0 37.0 37.0 37.0 65-69 35.9843 37.0 37.0 37.0 37.0 37.0 70-74 36.0316 37.0 37.0 37.0 37.0 37.0 75-79 35.9367 37.0 37.0 37.0 37.0 37.0 80-84 35.8886 37.0 37.0 37.0 37.0 37.0 85-89 35.8889 37.0 37.0 37.0 37.0 37.0 90-94 35.8491 37.0 37.0 37.0 37.0 37.0 95-99 35.8103 37.0 37.0 37.0 37.0 37.0 100-104 35.7945 37.0 37.0 37.0 37.0 37.0 105-109 35.8193 37.0 37.0 37.0 37.0 37.0 110-114 35.755399999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.776700000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.6337 37.0 37.0 37.0 37.0 37.0 125-129 35.64659999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.5764 37.0 37.0 37.0 37.0 37.0 135-139 35.5357 37.0 37.0 37.0 37.0 37.0 140-144 35.5279 37.0 37.0 37.0 37.0 37.0 145-149 35.4903 37.0 37.0 37.0 37.0 37.0 150-151 35.284 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 10.0 15 4.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 4.0 22 5.0 23 9.0 24 5.0 25 7.0 26 9.0 27 12.0 28 5.0 29 11.0 30 28.0 31 46.0 32 40.0 33 109.0 34 170.0 35 470.0 36 2614.0 37 429.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.95 18.875 7.7 27.474999999999998 2 30.85 22.475 24.85 21.825 3 23.575 23.75 29.2 23.474999999999998 4 28.575 28.225 19.85 23.35 5 30.15 30.575000000000003 18.425 20.849999999999998 6 23.45 34.599999999999994 18.325 23.625 7 25.8 20.025000000000002 31.474999999999998 22.7 8 23.35 23.724999999999998 24.2 28.725 9 24.625 22.15 25.0 28.225 10-14 26.44 25.074999999999996 22.245 26.240000000000002 15-19 26.450000000000003 23.815 23.755000000000003 25.979999999999997 20-24 26.174999999999997 24.875 23.0 25.95 25-29 26.33 24.195 22.525000000000002 26.950000000000003 30-34 26.44 24.245 23.165 26.150000000000002 35-39 26.540000000000003 24.654999999999998 23.044999999999998 25.759999999999998 40-44 26.905 24.32 23.305 25.47 45-49 25.569999999999997 24.65 23.71 26.07 50-54 27.105 24.185000000000002 22.845 25.865 55-59 27.245 23.810000000000002 22.73 26.215 60-64 26.340000000000003 23.86 23.47 26.33 65-69 26.540000000000003 24.67 23.325000000000003 25.465 70-74 27.08 23.905 22.99 26.025 75-79 26.19 24.099999999999998 22.89 26.82 80-84 26.265 24.46 23.294999999999998 25.979999999999997 85-89 26.445 24.795 23.095 25.665 90-94 26.77 24.625 22.95 25.655 95-99 27.474999999999998 24.445 22.74 25.34 100-104 26.715 24.42 23.285 25.580000000000002 105-109 27.055 24.25 23.04 25.655 110-114 27.315 24.67 23.03 24.985 115-119 26.805 24.529999999999998 23.02 25.645 120-124 27.034999999999997 24.73 22.945 25.290000000000003 125-129 27.73 24.535 23.0 24.735 130-134 27.3 24.52 22.95 25.230000000000004 135-139 27.6 24.465 23.07 24.865000000000002 140-144 27.32 24.6 23.505000000000003 24.575 145-149 28.065 24.615000000000002 22.86 24.46 150-151 28.025 25.637500000000003 22.175 24.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 3.5 27 3.5 28 3.5 29 5.5 30 5.0 31 8.0 32 12.0 33 13.5 34 17.5 35 26.5 36 37.0 37 43.0 38 50.5 39 73.0 40 97.5 41 105.5 42 125.0 43 138.0 44 149.5 45 169.0 46 170.0 47 148.0 48 139.5 49 151.5 50 141.5 51 128.5 52 105.5 53 87.5 54 104.5 55 113.5 56 95.5 57 104.0 58 113.0 59 105.0 60 103.0 61 92.0 62 98.0 63 111.0 64 97.5 65 86.5 66 84.5 67 84.5 68 86.5 69 75.5 70 66.0 71 57.0 72 51.0 73 41.0 74 18.5 75 8.0 76 7.0 77 6.0 78 6.0 79 3.0 80 1.0 81 0.5 82 0.0 83 1.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 1.0 94 1.5 95 1.5 96 1.5 97 0.5 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.43409781707655 82.72500000000001 2 7.211936999171041 13.05 3 0.8842221608179055 2.4 4 0.3868471953578337 1.4000000000000001 5 0.027631942525559547 0.125 6 0.055263885051119094 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CGTACGTACCACCATATTGCAGCCGCGAGCAGAACAACAGCTAGCTCACA 6 0.15 No Hit CCAGCCACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.5875000000000004 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCTC 10 0.006830828 145.0 9 GGGGGGG 20 0.00593511 29.0 125-129 >>END_MODULE Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948220 spots for SRR12949784.sra Written 1948220 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra Read 1948218 spots for SRR12949784.sra Written 1948218 spots for SRR12949784.sra SRR ids: ['SRR12949784.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o6mpgd5b SRR12949784.sra spots: 38964362 blocks: [[1, 1948218], [1948219, 3896436], [3896437, 5844654], [5844655, 7792872], [7792873, 9741090], [9741091, 11689308], [11689309, 13637526], [13637527, 15585744], [15585745, 17533962], [17533963, 19482180], [19482181, 21430398], [21430399, 23378616], [23378617, 25326834], [25326835, 27275052], [27275053, 29223270], [29223271, 31171488], [31171489, 33119706], [33119707, 35067924], [35067925, 37016142], [37016143, 38964362]] SRR12949784 file size 13220094 SRR12949784 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949784 SRR12949784_1.fastq SRR12949784_2.fastq Input file: SRR12949784_1.fastq Paired file: SRR12949784_2.fastq trimmed: SRR12949784-trimmed-pair1.fastq, SRR12949784-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:56:43 2024 >> started Sat Dec 7 09:57:23 2024 >> done (40.021s) 38964362 read pairs processed; of these: 184 ( 0.00%) short read pairs filtered out after trimming by size control 12194 ( 0.03%) empty read pairs filtered out after trimming by size control 38951984 (99.97%) read pairs available; of these: 2631414 ( 6.76%) trimmed read pairs available after processing 36320570 (93.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 22 0.00% 20 13 0.00% 21 19 0.00% 22 33 0.00% 23 27 0.00% 24 39 0.00% 25 33 0.00% 26 40 0.00% 27 48 0.00% 28 58 0.00% 29 51 0.00% 30 56 0.00% 31 35 0.00% 32 79 0.00% 33 57 0.00% 34 70 0.00% 35 68 0.00% 36 65 0.00% 37 80 0.00% 38 97 0.00% 39 87 0.00% 40 89 0.00% 41 111 0.00% 42 105 0.00% 43 114 0.00% 44 94 0.00% 45 110 0.00% 46 116 0.00% 47 147 0.00% 48 184 0.00% 49 190 0.00% 50 222 0.00% 51 235 0.00% 52 223 0.00% 53 310 0.00% 54 297 0.00% 55 316 0.00% 56 368 0.00% 57 425 0.00% 58 458 0.00% 59 579 0.00% 60 653 0.00% 61 759 0.00% 62 883 0.00% 63 935 0.00% 64 981 0.00% 65 1110 0.00% 66 1308 0.00% 67 1418 0.00% 68 1585 0.00% 69 1820 0.00% 70 2045 0.01% 71 2256 0.01% 72 2520 0.01% 73 3011 0.01% 74 3363 0.01% 75 3730 0.01% 76 3865 0.01% 77 4141 0.01% 78 4655 0.01% 79 5005 0.01% 80 5500 0.01% 81 6096 0.02% 82 6651 0.02% 83 7243 0.02% 84 7838 0.02% 85 8589 0.02% 86 8785 0.02% 87 9743 0.03% 88 10270 0.03% 89 10680 0.03% 90 11227 0.03% 91 11943 0.03% 92 12578 0.03% 93 13387 0.03% 94 14315 0.04% 95 14862 0.04% 96 15598 0.04% 97 16589 0.04% 98 17339 0.04% 99 17930 0.05% 100 18653 0.05% 101 19212 0.05% 102 19730 0.05% 103 20870 0.05% 104 21311 0.05% 105 22439 0.06% 106 23668 0.06% 107 24787 0.06% 108 25597 0.07% 109 26468 0.07% 110 27546 0.07% 111 28076 0.07% 112 28899 0.07% 113 30005 0.08% 114 31314 0.08% 115 32743 0.08% 116 34152 0.09% 117 35170 0.09% 118 36441 0.09% 119 37195 0.10% 120 39200 0.10% 121 38778 0.10% 122 40100 0.10% 123 41210 0.11% 124 42636 0.11% 125 43942 0.11% 126 45362 0.12% 127 46727 0.12% 128 48396 0.12% 129 50276 0.13% 130 50832 0.13% 131 52283 0.13% 132 54255 0.14% 133 55008 0.14% 134 56095 0.14% 135 57497 0.15% 136 58919 0.15% 137 60120 0.15% 138 60932 0.16% 139 63864 0.16% 140 64735 0.17% 141 66780 0.17% 142 68472 0.18% 143 69620 0.18% 144 71736 0.18% 145 72386 0.19% 146 72941 0.19% 147 76291 0.20% 148 78174 0.20% 149 79575 0.20% 150 81009 0.21% 151 36320570 93.24% 38951984 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=31 prefix-density=0.89 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=36.15 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=18 prefix-density=0.52 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=114.44 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=4.2 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR12949784 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:58:17 Started mapping on | Dec 07 09:58:18 Finished on | Dec 07 10:01:02 Mapping speed, Million of reads per hour | 855.04 Number of input reads | 38951984 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 37203502 Uniquely mapped reads % | 95.51% Average mapped length | 297.74 Number of splices: Total | 37895941 Number of splices: Annotated (sjdb) | 35689822 Number of splices: GT/AG | 37383209 Number of splices: GC/AG | 457473 Number of splices: AT/AC | 13301 Number of splices: Non-canonical | 41958 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458782 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 77220 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1289700 1289700 1289700 N_multimapping 458782 458782 458782 N_noFeature 1554316 36086270 1833239 N_ambiguous 1008870 5987 171825 UnstrandedReadsAssigned:34640316 PositiveStrandReadsAssigned:1111245 NegativeStrandReadsAssigned:35198438 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949784 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949784-trimmed-pair1.fastq SRR12949784-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,951,984 reads, 35,530,395 reads pseudoaligned [quant] estimated average fragment length: 302.528 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR12949784.ke.tsv 35125 SRR12949784.se.tsv 88098 total ==> SRR12949784.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 635.238 0 0 PNS24247 1044 742.472 85.2643 4.3487 PNS24249 1928 1626.47 87.9623 2.04796 PNS24246 1044 742.472 85.2643 4.3487 PNS24248 1044 742.472 85.2643 4.3487 PNS24244 1471 1169.47 99.2448 3.21359 PNS24243 293 86.1453 0 0 KQK14069 1603 1301.47 9066.79 263.81 KQK14071 474 212.498 163.753 29.1814 ==> SRR12949784.se.tsv <== BRADI_1g14170v3 10336 BRADI_1g53295v3 189 BRADI_1g59795v3 1698 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 624 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 401 BRADI_1g48960v3 0 SRR12949784 completed mapping pipeline successfully