Starting /dee2/code/volunteer_pipeline.sh SRR12949785 current disk space = 1543984521216 free memory = 1419865124 SRR12949785 SRAfilesize d3e01fb217a2ec1de9d7b46e5fe1019e SRR12949785.sra SRR12949785.sra file validated SRR12949785 is paired end SRR12949785 is conventional basespace SRR12949785 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949785_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5465 37.0 37.0 37.0 37.0 37.0 2 36.07425 37.0 37.0 37.0 37.0 37.0 3 36.51 37.0 37.0 37.0 37.0 37.0 4 36.5665 37.0 37.0 37.0 37.0 37.0 5 36.5705 37.0 37.0 37.0 37.0 37.0 6 36.648 37.0 37.0 37.0 37.0 37.0 7 36.5935 37.0 37.0 37.0 37.0 37.0 8 36.542 37.0 37.0 37.0 37.0 37.0 9 36.591 37.0 37.0 37.0 37.0 37.0 10-14 36.623400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6274 37.0 37.0 37.0 37.0 37.0 20-24 36.62330000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.596 37.0 37.0 37.0 37.0 37.0 30-34 36.557300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.520300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.5039 37.0 37.0 37.0 37.0 37.0 45-49 36.351600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3638 37.0 37.0 37.0 37.0 37.0 55-59 36.3298 37.0 37.0 37.0 37.0 37.0 60-64 36.2077 37.0 37.0 37.0 37.0 37.0 65-69 36.1493 37.0 37.0 37.0 37.0 37.0 70-74 36.1718 37.0 37.0 37.0 37.0 37.0 75-79 36.378 37.0 37.0 37.0 37.0 37.0 80-84 36.3199 37.0 37.0 37.0 37.0 37.0 85-89 36.252599999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.3095 37.0 37.0 37.0 37.0 37.0 95-99 36.2615 37.0 37.0 37.0 37.0 37.0 100-104 36.236900000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.148 37.0 37.0 37.0 37.0 37.0 110-114 36.147400000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.1334 37.0 37.0 37.0 37.0 37.0 120-124 36.1635 37.0 37.0 37.0 37.0 37.0 125-129 36.1049 37.0 37.0 37.0 37.0 37.0 130-134 35.9701 37.0 37.0 37.0 37.0 37.0 135-139 36.034400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8384 37.0 37.0 37.0 37.0 37.0 145-149 35.9296 37.0 37.0 37.0 37.0 37.0 150-151 35.78725 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 3.0 26 8.0 27 5.0 28 18.0 29 9.0 30 19.0 31 35.0 32 37.0 33 85.0 34 146.0 35 295.0 36 2775.0 37 562.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.724999999999994 12.325 6.05 30.9 2 24.18581166372128 11.38601363292098 30.29537995455693 34.13279474880081 3 21.8 12.625 25.05 40.525 4 24.55 18.625 22.075 34.75 5 29.65 22.7 22.375 25.275 6 28.499999999999996 27.575 20.375 23.549999999999997 7 20.225 26.1 35.525 18.15 8 20.925 25.424999999999997 27.55 26.1 9 22.3 20.75 32.0 24.95 10-14 24.285 26.064999999999998 24.705 24.945 15-19 24.5 23.919999999999998 25.035 26.545 20-24 24.88 24.2 24.41 26.51 25-29 25.215 24.044999999999998 24.035 26.705000000000002 30-34 24.474999999999998 23.56 25.115 26.85 35-39 24.015 24.455 25.009999999999998 26.52 40-44 24.529999999999998 23.549999999999997 24.785 27.134999999999998 45-49 24.86 23.085 24.560000000000002 27.495000000000005 50-54 25.34 23.805 24.11 26.745 55-59 24.445 23.605 24.83 27.12 60-64 25.485000000000003 23.125 24.66 26.729999999999997 65-69 25.295 24.57 23.29 26.845000000000002 70-74 26.345000000000002 23.465 23.49 26.700000000000003 75-79 26.700000000000003 23.515 23.21 26.575 80-84 26.055 23.82 23.75 26.375 85-89 25.825 23.93 23.575 26.669999999999998 90-94 26.945000000000004 22.650000000000002 23.64 26.765 95-99 26.275 22.814999999999998 24.240000000000002 26.669999999999998 100-104 26.375 23.275000000000002 24.14 26.21 105-109 27.025 23.369999999999997 23.47 26.135 110-114 26.995 23.62 23.14 26.245 115-119 26.165 23.755000000000003 23.175 26.905 120-124 27.08 23.87 22.825 26.224999999999998 125-129 26.755000000000003 23.265 23.005 26.974999999999998 130-134 26.405 22.884999999999998 23.505000000000003 27.205000000000002 135-139 26.840000000000003 23.265 23.265 26.63 140-144 26.884999999999998 23.380000000000003 23.165 26.57 145-149 27.015 23.385 23.14 26.46 150-151 27.3 22.875 23.025000000000002 26.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 3.0 29 5.5 30 6.0 31 8.0 32 9.0 33 14.0 34 18.0 35 28.0 36 40.5 37 41.5 38 57.0 39 77.0 40 98.5 41 121.0 42 121.5 43 130.0 44 150.0 45 167.0 46 169.0 47 156.0 48 148.0 49 159.0 50 158.0 51 132.0 52 135.0 53 131.0 54 114.5 55 115.0 56 116.0 57 118.5 58 103.5 59 86.5 60 92.0 61 88.5 62 69.5 63 61.0 64 72.5 65 85.0 66 82.5 67 74.5 68 75.5 69 68.5 70 54.0 71 47.5 72 41.0 73 38.0 74 33.0 75 21.0 76 14.0 77 10.5 78 10.5 79 10.0 80 5.0 81 2.0 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.975 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.43569844789357 82.475 2 7.677383592017738 13.850000000000001 3 0.6097560975609756 1.6500000000000001 4 0.19401330376940135 0.7000000000000001 5 0.02771618625277162 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02771618625277162 0.22499999999999998 >10 0.02771618625277162 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCAAGATCATCTCGTAT 39 0.975 TruSeq Adapter, Index 6 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCAAGATCATCGCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 37bp) GCCAGGTAATGCGAGTGTTTCAGTTGGAGTCAAACTGTTCCCGACAGCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.4625 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.1125 0.0 0.0 0.0 0.0 124-125 4.45 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 5.9875 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 6.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCGCTC 10 0.006830828 145.0 2 TGGTAAG 10 0.006830828 145.0 145 CGCTCTT 10 0.006830828 145.0 4 CTCTTGA 10 0.006830828 145.0 6 GCGCTCT 10 0.006830828 145.0 3 TTGACAG 10 0.006830828 145.0 9 GTGCGCT 10 0.006830828 145.0 1 CTTGACA 10 0.006830828 145.0 8 >>END_MODULE SRR12949785 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949785_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.39 37.0 37.0 37.0 37.0 37.0 2 36.1305 37.0 37.0 37.0 37.0 37.0 3 36.3275 37.0 37.0 37.0 37.0 37.0 4 36.335 37.0 37.0 37.0 37.0 37.0 5 36.3485 37.0 37.0 37.0 37.0 37.0 6 36.233 37.0 37.0 37.0 37.0 37.0 7 36.313 37.0 37.0 37.0 37.0 37.0 8 36.268 37.0 37.0 37.0 37.0 37.0 9 36.1535 37.0 37.0 37.0 37.0 37.0 10-14 36.1665 37.0 37.0 37.0 37.0 37.0 15-19 36.150099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.0347 37.0 37.0 37.0 37.0 37.0 25-29 35.951699999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.8054 37.0 37.0 37.0 37.0 37.0 35-39 35.789 37.0 37.0 37.0 37.0 37.0 40-44 35.727900000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.7304 37.0 37.0 37.0 37.0 37.0 50-54 35.7804 37.0 37.0 37.0 37.0 37.0 55-59 35.853699999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.838100000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8738 37.0 37.0 37.0 37.0 37.0 70-74 35.819399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.7077 37.0 37.0 37.0 37.0 37.0 80-84 35.688900000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.762899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.7291 37.0 37.0 37.0 37.0 37.0 95-99 35.708299999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7128 37.0 37.0 37.0 37.0 37.0 105-109 35.702200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7143 37.0 37.0 37.0 37.0 37.0 115-119 35.7502 37.0 37.0 37.0 37.0 37.0 120-124 35.646699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.66180000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5505 37.0 37.0 37.0 37.0 37.0 135-139 35.5094 37.0 37.0 37.0 37.0 37.0 140-144 35.5097 37.0 37.0 37.0 37.0 37.0 145-149 35.471199999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.15525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 5.0 15 13.0 16 9.0 17 2.0 18 1.0 19 4.0 20 9.0 21 5.0 22 9.0 23 9.0 24 13.0 25 15.0 26 7.0 27 8.0 28 19.0 29 23.0 30 19.0 31 38.0 32 35.0 33 81.0 34 153.0 35 412.0 36 2655.0 37 449.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.275 21.15 7.375 26.200000000000003 2 32.0 21.3 23.200000000000003 23.5 3 26.575 23.775 27.150000000000002 22.5 4 29.725 28.599999999999998 19.400000000000002 22.275 5 29.775000000000002 30.425 18.325 21.475 6 26.400000000000002 33.45 18.475 21.675 7 27.425 18.925 30.25 23.400000000000002 8 27.275 21.875 21.75 29.099999999999998 9 27.425 22.45 23.474999999999998 26.650000000000002 10-14 28.599999999999998 24.740000000000002 21.39 25.27 15-19 28.205000000000002 23.474999999999998 22.325 25.995 20-24 28.305000000000003 24.5 21.89 25.305 25-29 28.144999999999996 23.025000000000002 22.39 26.44 30-34 27.54 24.125 22.475 25.86 35-39 27.495000000000005 24.215 22.43 25.86 40-44 27.77 23.94 21.985 26.305 45-49 28.01 23.919999999999998 22.7 25.369999999999997 50-54 28.65 24.005000000000003 22.56 24.785 55-59 28.410000000000004 24.005000000000003 21.935 25.650000000000002 60-64 28.265 23.005 23.005 25.724999999999998 65-69 27.865000000000002 23.835 22.35 25.95 70-74 28.23 22.89 22.335 26.545 75-79 27.889999999999997 23.325000000000003 22.355 26.43 80-84 27.79 23.53 23.064999999999998 25.615 85-89 28.425 23.645 22.27 25.66 90-94 28.64 23.23 22.155 25.974999999999998 95-99 28.549999999999997 23.799999999999997 22.145 25.505 100-104 28.395 23.465 22.165000000000003 25.974999999999998 105-109 28.744999999999997 23.580000000000002 22.525000000000002 25.15 110-114 27.82 24.205 21.93 26.045 115-119 29.080000000000002 24.18 21.39 25.35 120-124 28.62 24.125 22.040000000000003 25.215 125-129 29.035 24.215 21.535 25.215 130-134 29.265 24.709999999999997 21.07 24.955 135-139 29.515 24.42 21.895 24.169999999999998 140-144 30.45 24.154999999999998 21.355 24.04 145-149 30.009999999999998 24.15 21.865000000000002 23.974999999999998 150-151 31.025000000000002 24.775 21.512500000000003 22.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 1.0 12 1.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 0.0 26 0.5 27 1.0 28 2.5 29 5.0 30 6.5 31 8.5 32 9.0 33 11.0 34 18.0 35 27.0 36 36.0 37 43.5 38 53.5 39 62.5 40 78.5 41 106.0 42 118.5 43 129.5 44 132.5 45 139.5 46 145.0 47 142.5 48 145.5 49 140.5 50 132.5 51 136.0 52 127.5 53 106.5 54 96.5 55 99.0 56 107.0 57 100.0 58 92.0 59 100.0 60 106.5 61 91.0 62 97.0 63 97.5 64 97.5 65 97.5 66 75.0 67 77.5 68 93.0 69 92.0 70 78.5 71 61.0 72 46.5 73 39.0 74 34.5 75 25.0 76 15.5 77 10.5 78 9.0 79 8.5 80 6.0 81 4.0 82 1.0 83 0.5 84 1.0 85 1.0 86 1.5 87 1.0 88 0.5 89 1.0 90 1.0 91 1.0 92 0.5 93 1.0 94 3.5 95 5.0 96 3.5 97 3.0 98 6.0 99 9.0 100 16.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64368450082736 83.075 2 7.308328736900166 13.25 3 0.7722007722007722 2.1 4 0.19305019305019305 0.7000000000000001 5 0.027578599007170437 0.125 6 0.027578599007170437 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027578599007170437 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGG 6 0.15 No Hit GAGAAGCCTCATGGGAATGAGGGTGTTGCATGGGCACCAGTTAAGCCACC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.175000000000001 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.0875 0.0 0.0 0.0 0.0 136-137 6.5 0.0 0.0 0.0 0.0 138-139 6.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTCA 10 0.006830828 145.0 9 CAGCCAC 10 0.006830828 145.0 2 AGCCACC 10 0.006830828 145.0 3 CCAGACA 10 0.006830828 145.0 9 CGCATCA 10 0.006830828 145.0 145 >>END_MODULE Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689773 spots for SRR12949785.sra Written 1689773 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra Read 1689770 spots for SRR12949785.sra Written 1689770 spots for SRR12949785.sra SRR ids: ['SRR12949785.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yn5oxhql SRR12949785.sra spots: 33795403 blocks: [[1, 1689770], [1689771, 3379540], [3379541, 5069310], [5069311, 6759080], [6759081, 8448850], [8448851, 10138620], [10138621, 11828390], [11828391, 13518160], [13518161, 15207930], [15207931, 16897700], [16897701, 18587470], [18587471, 20277240], [20277241, 21967010], [21967011, 23656780], [23656781, 25346550], [25346551, 27036320], [27036321, 28726090], [28726091, 30415860], [30415861, 32105630], [32105631, 33795403]] SRR12949785 file size 11463456 SRR12949785 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949785 SRR12949785_1.fastq SRR12949785_2.fastq Input file: SRR12949785_1.fastq Paired file: SRR12949785_2.fastq trimmed: SRR12949785-trimmed-pair1.fastq, SRR12949785-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:02:46 2024 >> started Sat Dec 7 10:07:00 2024 >> done (253.460s) 33795403 read pairs processed; of these: 154 ( 0.00%) short read pairs filtered out after trimming by size control 392581 ( 1.16%) empty read pairs filtered out after trimming by size control 33402668 (98.84%) read pairs available; of these: 3470803 (10.39%) trimmed read pairs available after processing 29931865 (89.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 9 0.00% 20 26 0.00% 21 24 0.00% 22 44 0.00% 23 48 0.00% 24 88 0.00% 25 36 0.00% 26 49 0.00% 27 41 0.00% 28 61 0.00% 29 55 0.00% 30 62 0.00% 31 73 0.00% 32 79 0.00% 33 69 0.00% 34 68 0.00% 35 80 0.00% 36 62 0.00% 37 91 0.00% 38 94 0.00% 39 92 0.00% 40 101 0.00% 41 94 0.00% 42 124 0.00% 43 118 0.00% 44 143 0.00% 45 143 0.00% 46 146 0.00% 47 129 0.00% 48 148 0.00% 49 191 0.00% 50 208 0.00% 51 245 0.00% 52 268 0.00% 53 308 0.00% 54 312 0.00% 55 374 0.00% 56 405 0.00% 57 403 0.00% 58 514 0.00% 59 562 0.00% 60 689 0.00% 61 769 0.00% 62 878 0.00% 63 930 0.00% 64 1066 0.00% 65 1146 0.00% 66 1236 0.00% 67 1421 0.00% 68 1608 0.00% 69 1699 0.01% 70 2064 0.01% 71 2339 0.01% 72 2767 0.01% 73 3054 0.01% 74 3259 0.01% 75 3747 0.01% 76 4219 0.01% 77 4401 0.01% 78 4969 0.01% 79 5663 0.02% 80 5944 0.02% 81 6432 0.02% 82 7125 0.02% 83 8003 0.02% 84 8780 0.03% 85 9915 0.03% 86 10495 0.03% 87 10983 0.03% 88 11803 0.04% 89 12565 0.04% 90 13258 0.04% 91 14402 0.04% 92 15075 0.05% 93 16412 0.05% 94 17556 0.05% 95 19088 0.06% 96 19961 0.06% 97 20862 0.06% 98 21893 0.07% 99 23096 0.07% 100 24073 0.07% 101 24926 0.07% 102 26174 0.08% 103 27415 0.08% 104 28722 0.09% 105 30320 0.09% 106 31645 0.09% 107 33096 0.10% 108 34494 0.10% 109 36334 0.11% 110 36722 0.11% 111 38276 0.11% 112 39887 0.12% 113 40822 0.12% 114 42454 0.13% 115 44667 0.13% 116 46858 0.14% 117 48115 0.14% 118 49669 0.15% 119 50678 0.15% 120 53079 0.16% 121 53933 0.16% 122 55394 0.17% 123 56462 0.17% 124 59141 0.18% 125 60705 0.18% 126 62887 0.19% 127 64910 0.19% 128 66716 0.20% 129 68817 0.21% 130 69894 0.21% 131 70759 0.21% 132 73155 0.22% 133 74463 0.22% 134 76188 0.23% 135 78080 0.23% 136 79300 0.24% 137 80783 0.24% 138 81927 0.25% 139 85606 0.26% 140 85952 0.26% 141 87803 0.26% 142 90620 0.27% 143 89915 0.27% 144 92514 0.28% 145 95158 0.28% 146 95864 0.29% 147 97295 0.29% 148 97276 0.29% 149 100093 0.30% 150 102991 0.31% 151 29931865 89.61% 33402668 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=20 prefix-density=0.79 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=19.00 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=19 prefix-density=0.71 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=51.39 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTC SRR12949785 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:12:38 Started mapping on | Dec 07 10:12:39 Finished on | Dec 07 11:16:41 Mapping speed, Million of reads per hour | 31.30 Number of input reads | 33402668 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 28404163 Uniquely mapped reads % | 85.04% Average mapped length | 292.78 Number of splices: Total | 27723931 Number of splices: Annotated (sjdb) | 26220515 Number of splices: GT/AG | 27322738 Number of splices: GC/AG | 328764 Number of splices: AT/AC | 9606 Number of splices: Non-canonical | 62823 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1188837 % of reads mapped to multiple loci | 3.56% Number of reads mapped to too many loci | 114012 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.02% % of reads unmapped: other | 2.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3809668 3809668 3809668 N_multimapping 1188837 1188837 1188837 N_noFeature 1370431 27591776 1563126 N_ambiguous 790249 4262 172786 UnstrandedReadsAssigned:26243483 PositiveStrandReadsAssigned:808125 NegativeStrandReadsAssigned:26668251 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949785 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949785-trimmed-pair1.fastq SRR12949785-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,402,668 reads, 28,370,848 reads pseudoaligned [quant] estimated average fragment length: 282.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR12949785.ke.tsv 35125 SRR12949785.se.tsv 88098 total ==> SRR12949785.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.783 0 0 PNS24247 1044 762.21 62.1357 3.76912 PNS24249 1928 1646.21 148.768 4.17828 PNS24246 1044 762.21 62.1357 3.76912 PNS24248 1044 762.21 62.1357 3.76912 PNS24244 1471 1189.21 81.825 3.18127 PNS24243 293 95.3345 0 0 KQK14069 1603 1321.21 13303.4 465.549 KQK14071 474 225.532 203.739 41.7676 ==> SRR12949785.se.tsv <== BRADI_1g14170v3 14103 BRADI_1g53295v3 78 BRADI_1g59795v3 842 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 271 BRADI_1g74790v3 251 BRADI_1g09890v3 0 BRADI_1g77505v3 351 BRADI_1g48960v3 0 SRR12949785 completed mapping pipeline successfully