Starting /dee2/code/volunteer_pipeline.sh SRR12949787 current disk space = 1543908278272 free memory = 1598660508 SRR12949787 SRAfilesize c8b8de508b8cb7c447132a42f59473e5 SRR12949787.sra SRR12949787.sra file validated SRR12949787 is paired end SRR12949787 is conventional basespace SRR12949787 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949787_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5285 37.0 37.0 37.0 37.0 37.0 2 36.055 37.0 37.0 37.0 37.0 37.0 3 36.5595 37.0 37.0 37.0 37.0 37.0 4 36.5065 37.0 37.0 37.0 37.0 37.0 5 36.683 37.0 37.0 37.0 37.0 37.0 6 36.568 37.0 37.0 37.0 37.0 37.0 7 36.482 37.0 37.0 37.0 37.0 37.0 8 36.6015 37.0 37.0 37.0 37.0 37.0 9 36.596 37.0 37.0 37.0 37.0 37.0 10-14 36.622 37.0 37.0 37.0 37.0 37.0 15-19 36.576 37.0 37.0 37.0 37.0 37.0 20-24 36.59439999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.516200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.501799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.46339999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4282 37.0 37.0 37.0 37.0 37.0 45-49 36.389599999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3914 37.0 37.0 37.0 37.0 37.0 55-59 36.3496 37.0 37.0 37.0 37.0 37.0 60-64 36.329899999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3243 37.0 37.0 37.0 37.0 37.0 70-74 36.311099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.283300000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2595 37.0 37.0 37.0 37.0 37.0 85-89 36.2385 37.0 37.0 37.0 37.0 37.0 90-94 36.1498 37.0 37.0 37.0 37.0 37.0 95-99 36.1767 37.0 37.0 37.0 37.0 37.0 100-104 36.136399999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1034 37.0 37.0 37.0 37.0 37.0 110-114 36.0702 37.0 37.0 37.0 37.0 37.0 115-119 36.0242 37.0 37.0 37.0 37.0 37.0 120-124 35.9606 37.0 37.0 37.0 37.0 37.0 125-129 35.902499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.8418 37.0 37.0 37.0 37.0 37.0 135-139 35.773199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.511199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.5202 37.0 37.0 37.0 37.0 37.0 150-151 35.46125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 2.0 23 3.0 24 1.0 25 6.0 26 6.0 27 6.0 28 16.0 29 15.0 30 16.0 31 41.0 32 59.0 33 88.0 34 133.0 35 297.0 36 2814.0 37 493.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 58.575 9.35 5.025 27.05 2 24.230963187090268 8.598083711548158 32.85426122037317 34.3166918809884 3 21.8 13.750000000000002 24.975 39.475 4 26.85 19.2 22.5 31.45 5 29.049999999999997 25.224999999999998 22.875 22.85 6 25.25 27.474999999999998 21.875 25.4 7 22.225 24.975 36.125 16.675 8 20.925 23.175 30.2 25.7 9 21.775 21.3 31.775 25.15 10-14 24.625 24.745 25.825 24.805 15-19 24.72 23.84 25.185000000000002 26.255 20-24 24.474999999999998 24.29 25.259999999999998 25.974999999999998 25-29 25.629999999999995 23.915 24.779999999999998 25.674999999999997 30-34 24.515 24.135 24.845 26.505000000000003 35-39 24.505 24.285 24.87 26.340000000000003 40-44 24.865000000000002 24.46 24.404999999999998 26.27 45-49 24.67 23.974999999999998 24.88 26.474999999999998 50-54 24.565 24.595 24.23 26.61 55-59 24.5 24.175 24.94 26.384999999999998 60-64 24.685000000000002 24.33 24.27 26.715 65-69 24.695 24.044999999999998 24.41 26.85 70-74 25.135 24.02 23.945 26.900000000000002 75-79 25.785000000000004 23.665 24.2 26.35 80-84 25.275 24.525 24.055 26.145000000000003 85-89 25.669999999999998 24.505 23.335 26.490000000000002 90-94 25.130000000000003 24.315 24.555 26.0 95-99 25.124999999999996 23.985 24.545 26.345000000000002 100-104 25.845000000000002 24.27 24.22 25.665 105-109 25.185000000000002 24.21 24.545 26.06 110-114 24.990000000000002 24.13 24.265 26.615 115-119 25.540000000000003 24.375 23.925 26.16 120-124 25.31 24.245 24.135 26.31 125-129 25.025 24.25 24.08 26.645000000000003 130-134 25.424999999999997 24.445 23.715 26.415 135-139 26.14 24.705 22.945 26.21 140-144 24.985 24.279999999999998 24.39 26.345000000000002 145-149 25.874999999999996 24.12 23.825 26.179999999999996 150-151 25.900000000000002 23.474999999999998 24.1625 26.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.5 5 0.5 6 1.0 7 1.0 8 0.5 9 1.5 10 1.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 1.0 25 0.5 26 1.5 27 2.0 28 2.5 29 2.0 30 2.5 31 11.0 32 13.0 33 15.0 34 23.5 35 30.0 36 39.0 37 53.0 38 63.5 39 74.0 40 93.5 41 119.5 42 140.5 43 146.0 44 148.5 45 165.0 46 172.0 47 175.5 48 174.5 49 158.5 50 154.0 51 150.0 52 134.0 53 104.5 54 100.0 55 105.0 56 100.5 57 97.5 58 87.0 59 87.5 60 95.5 61 95.0 62 91.0 63 75.5 64 74.0 65 89.5 66 85.5 67 74.0 68 64.5 69 55.5 70 50.0 71 44.0 72 33.5 73 28.5 74 27.0 75 17.5 76 11.0 77 9.5 78 5.5 79 3.0 80 3.5 81 2.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.76814734561214 85.625 2 6.310942578548212 11.65 3 0.8125677139761647 2.25 4 0.027085590465872153 0.1 5 0.08125677139761647 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CCGGCATATTCGTATCATCTTCACCATTTCCAGAAGACGTTGGATCCGCA 5 0.125 No Hit GGGCGATGTAGAAGCCTCCCATGGTGTTGTCGAAGTCGTACTTCCTTAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.1749999999999998 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.55 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.4125 0.0 0.0 0.0 0.0 104-105 2.6625 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.7 0.0 0.0 0.0 0.0 112-113 4.1625 0.0 0.0 0.0 0.0 114-115 4.449999999999999 0.0 0.0 0.0 0.0 116-117 4.75 0.0 0.0 0.0 0.0 118-119 5.05 0.0 0.0 0.0 0.0 120-121 5.4875 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.4875 0.0 0.0 0.0 0.0 126-127 6.949999999999999 0.0 0.0 0.0 0.0 128-129 7.475 0.0 0.0 0.0 0.0 130-131 8.0625 0.0 0.0 0.0 0.0 132-133 8.662500000000001 0.0 0.0 0.0 0.0 134-135 9.212499999999999 0.0 0.0 0.0 0.0 136-137 9.725000000000001 0.0 0.0 0.0 0.0 138-139 10.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCCAC 10 0.006830828 145.0 5 >>END_MODULE SRR12949787 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949787_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1925 37.0 37.0 37.0 37.0 37.0 2 35.912 37.0 37.0 37.0 37.0 37.0 3 35.9435 37.0 37.0 37.0 37.0 37.0 4 36.185 37.0 37.0 37.0 37.0 37.0 5 36.1025 37.0 37.0 37.0 37.0 37.0 6 35.9995 37.0 37.0 37.0 37.0 37.0 7 36.1365 37.0 37.0 37.0 37.0 37.0 8 36.1105 37.0 37.0 37.0 37.0 37.0 9 36.0925 37.0 37.0 37.0 37.0 37.0 10-14 36.1523 37.0 37.0 37.0 37.0 37.0 15-19 36.0555 37.0 37.0 37.0 37.0 37.0 20-24 35.9928 37.0 37.0 37.0 37.0 37.0 25-29 35.925 37.0 37.0 37.0 37.0 37.0 30-34 35.874500000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.9033 37.0 37.0 37.0 37.0 37.0 40-44 35.829 37.0 37.0 37.0 37.0 37.0 45-49 35.8246 37.0 37.0 37.0 37.0 37.0 50-54 35.7581 37.0 37.0 37.0 37.0 37.0 55-59 35.727999999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.744 37.0 37.0 37.0 37.0 37.0 65-69 35.6737 37.0 37.0 37.0 37.0 37.0 70-74 35.6269 37.0 37.0 37.0 37.0 37.0 75-79 35.6516 37.0 37.0 37.0 37.0 37.0 80-84 35.617 37.0 37.0 37.0 37.0 37.0 85-89 35.5911 37.0 37.0 37.0 37.0 37.0 90-94 35.525 37.0 37.0 37.0 37.0 37.0 95-99 35.5858 37.0 37.0 37.0 37.0 37.0 100-104 35.5749 37.0 37.0 37.0 37.0 37.0 105-109 35.55459999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.4416 37.0 37.0 37.0 37.0 37.0 115-119 35.4964 37.0 37.0 37.0 37.0 37.0 120-124 35.312200000000004 37.0 37.0 37.0 34.6 37.0 125-129 35.3055 37.0 37.0 37.0 37.0 37.0 130-134 35.183 37.0 37.0 37.0 34.6 37.0 135-139 35.10850000000001 37.0 37.0 37.0 29.8 37.0 140-144 35.0231 37.0 37.0 37.0 27.4 37.0 145-149 34.8584 37.0 37.0 37.0 25.0 37.0 150-151 34.524 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 9.0 14 13.0 15 6.0 16 8.0 17 3.0 18 9.0 19 4.0 20 7.0 21 5.0 22 6.0 23 10.0 24 7.0 25 8.0 26 14.0 27 11.0 28 6.0 29 23.0 30 27.0 31 43.0 32 66.0 33 124.0 34 218.0 35 505.0 36 2504.0 37 362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.1 20.599999999999998 6.2 22.1 2 31.4 22.2 24.75 21.65 3 24.7 23.724999999999998 28.125 23.45 4 28.525 28.799999999999997 18.625 24.05 5 27.925 32.0 18.175 21.9 6 25.3 33.800000000000004 17.45 23.45 7 24.775 20.275000000000002 31.0 23.95 8 23.674999999999997 22.775000000000002 24.6 28.95 9 26.125 21.05 23.7 29.125 10-14 27.24 24.77 21.959999999999997 26.029999999999998 15-19 27.029999999999998 23.285 23.18 26.505000000000003 20-24 27.105 23.62 23.535 25.740000000000002 25-29 26.655 24.27 23.155 25.919999999999998 30-34 26.625 23.905 23.085 26.384999999999998 35-39 26.495 24.275 23.055 26.174999999999997 40-44 27.355 24.755 22.595000000000002 25.295 45-49 27.08 24.245 22.99 25.685000000000002 50-54 27.189999999999998 24.015 22.93 25.865 55-59 27.16 24.154999999999998 22.53 26.155 60-64 27.18 24.33 22.74 25.75 65-69 26.56 24.03 22.97 26.44 70-74 27.265 24.279999999999998 23.01 25.445 75-79 26.21 24.115000000000002 23.494999999999997 26.179999999999996 80-84 27.134999999999998 23.585 23.400000000000002 25.88 85-89 27.165 23.985 22.900000000000002 25.95 90-94 26.865 24.495 22.85 25.790000000000003 95-99 27.1 24.6 23.169999999999998 25.130000000000003 100-104 27.305 23.875 22.93 25.89 105-109 27.865000000000002 24.485 22.23 25.419999999999998 110-114 27.6 24.27 22.62 25.509999999999998 115-119 27.72 24.965 22.400000000000002 24.915000000000003 120-124 27.905 24.385 22.905 24.805 125-129 28.315 24.709999999999997 21.97 25.005 130-134 28.655 24.275 22.689999999999998 24.38 135-139 28.435 25.105 22.725 23.735 140-144 28.28 24.38 22.98 24.36 145-149 29.044999999999998 25.14 22.38 23.435 150-151 30.012499999999996 24.2875 22.25 23.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.0 9 1.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.5 27 3.0 28 4.0 29 3.5 30 4.5 31 7.0 32 10.5 33 12.5 34 16.0 35 28.0 36 36.0 37 46.0 38 58.5 39 68.0 40 91.0 41 110.0 42 131.0 43 141.5 44 154.5 45 163.0 46 155.0 47 144.0 48 135.5 49 143.0 50 135.5 51 128.0 52 121.5 53 112.0 54 100.5 55 93.5 56 95.5 57 95.0 58 94.5 59 103.0 60 121.0 61 110.0 62 95.0 63 97.0 64 86.5 65 85.5 66 87.5 67 81.0 68 81.5 69 74.5 70 56.0 71 50.0 72 52.0 73 44.5 74 28.5 75 18.0 76 13.5 77 8.5 78 6.5 79 4.5 80 1.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 1.0 88 3.0 89 2.0 90 1.0 91 2.0 92 1.5 93 1.5 94 3.0 95 3.0 96 1.5 97 1.5 98 2.0 99 2.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.72677744483792 85.1 2 6.210841732497957 11.4 3 0.8444565513484064 2.325 4 0.1089621356578589 0.4 5 0.08172160174339417 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027240533914464723 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit GGTGGAGTTCTGGGCGCCGTGGTGCGGGCCGTGCAGGATGATCGCCCCCG 5 0.125 No Hit CTCAAGCCCGCCGCGGCGGTGCCGCAAACCGCCGCCGCCTTCTCGGCGAA 5 0.125 No Hit GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.7875000000000001 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.1124999999999998 0.0 0.0 0.0 0.0 92-93 1.2000000000000002 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.8875000000000002 0.0 0.0 0.0 0.0 100-101 2.2375 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 2.9625000000000004 0.0 0.0 0.0 0.0 108-109 3.4 0.0 0.0 0.0 0.0 110-111 3.875 0.0 0.0 0.0 0.0 112-113 4.3125 0.0 0.0 0.0 0.0 114-115 4.6 0.0 0.0 0.0 0.0 116-117 4.9 0.0 0.0 0.0 0.0 118-119 5.2375 0.0 0.0 0.0 0.0 120-121 5.7125 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.7125 0.0 0.0 0.0 0.0 126-127 7.175000000000001 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.337499999999999 0.0 0.0 0.0 0.0 132-133 8.95 0.0 0.0 0.0 0.0 134-135 9.5125 0.0 0.0 0.0 0.0 136-137 10.0125 0.0 0.0 0.0 0.0 138-139 10.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962078 spots for SRR12949787.sra Written 1962078 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra Read 1962066 spots for SRR12949787.sra Written 1962066 spots for SRR12949787.sra SRR ids: ['SRR12949787.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p9m2xhx5 SRR12949787.sra spots: 39241332 blocks: [[1, 1962066], [1962067, 3924132], [3924133, 5886198], [5886199, 7848264], [7848265, 9810330], [9810331, 11772396], [11772397, 13734462], [13734463, 15696528], [15696529, 17658594], [17658595, 19620660], [19620661, 21582726], [21582727, 23544792], [23544793, 25506858], [25506859, 27468924], [27468925, 29430990], [29430991, 31393056], [31393057, 33355122], [33355123, 35317188], [35317189, 37279254], [37279255, 39241332]] SRR12949787 file size 13314221 SRR12949787 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949787 SRR12949787_1.fastq SRR12949787_2.fastq Input file: SRR12949787_1.fastq Paired file: SRR12949787_2.fastq trimmed: SRR12949787-trimmed-pair1.fastq, SRR12949787-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:01:26 2024 >> started Sat Dec 7 10:02:25 2024 >> done (58.606s) 39241332 read pairs processed; of these: 414 ( 0.00%) short read pairs filtered out after trimming by size control 48094 ( 0.12%) empty read pairs filtered out after trimming by size control 39192824 (99.88%) read pairs available; of these: 5923807 (15.11%) trimmed read pairs available after processing 33269017 (84.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 29 0.00% 20 45 0.00% 21 46 0.00% 22 60 0.00% 23 47 0.00% 24 52 0.00% 25 70 0.00% 26 68 0.00% 27 87 0.00% 28 88 0.00% 29 75 0.00% 30 89 0.00% 31 84 0.00% 32 120 0.00% 33 118 0.00% 34 94 0.00% 35 109 0.00% 36 135 0.00% 37 125 0.00% 38 127 0.00% 39 165 0.00% 40 155 0.00% 41 176 0.00% 42 196 0.00% 43 192 0.00% 44 209 0.00% 45 229 0.00% 46 229 0.00% 47 258 0.00% 48 321 0.00% 49 406 0.00% 50 454 0.00% 51 483 0.00% 52 613 0.00% 53 678 0.00% 54 729 0.00% 55 767 0.00% 56 898 0.00% 57 941 0.00% 58 1233 0.00% 59 1370 0.00% 60 1643 0.00% 61 2016 0.01% 62 2302 0.01% 63 2606 0.01% 64 2869 0.01% 65 3065 0.01% 66 3556 0.01% 67 4045 0.01% 68 4535 0.01% 69 5294 0.01% 70 5958 0.02% 71 6619 0.02% 72 7670 0.02% 73 8475 0.02% 74 9430 0.02% 75 10831 0.03% 76 11627 0.03% 77 12648 0.03% 78 13793 0.04% 79 14912 0.04% 80 16156 0.04% 81 17583 0.04% 82 19675 0.05% 83 20930 0.05% 84 23182 0.06% 85 24519 0.06% 86 26076 0.07% 87 27766 0.07% 88 29208 0.07% 89 30541 0.08% 90 32269 0.08% 91 34679 0.09% 92 35328 0.09% 93 38213 0.10% 94 40179 0.10% 95 42091 0.11% 96 44339 0.11% 97 46647 0.12% 98 48150 0.12% 99 50002 0.13% 100 51625 0.13% 101 53652 0.14% 102 55428 0.14% 103 56921 0.15% 104 60363 0.15% 105 61987 0.16% 106 64868 0.17% 107 66315 0.17% 108 68957 0.18% 109 71370 0.18% 110 72899 0.19% 111 74620 0.19% 112 76944 0.20% 113 77848 0.20% 114 82101 0.21% 115 84973 0.22% 116 85880 0.22% 117 90045 0.23% 118 89917 0.23% 119 92493 0.24% 120 95514 0.24% 121 96007 0.24% 122 97040 0.25% 123 99950 0.26% 124 102230 0.26% 125 103066 0.26% 126 105734 0.27% 127 107164 0.27% 128 108472 0.28% 129 112403 0.29% 130 112364 0.29% 131 113743 0.29% 132 117524 0.30% 133 118578 0.30% 134 118155 0.30% 135 121422 0.31% 136 121204 0.31% 137 120688 0.31% 138 121568 0.31% 139 127306 0.32% 140 125660 0.32% 141 127792 0.33% 142 131662 0.34% 143 131314 0.34% 144 134245 0.34% 145 135089 0.34% 146 133969 0.34% 147 137510 0.35% 148 137403 0.35% 149 137494 0.35% 150 138518 0.35% 151 33269017 84.89% 39192824 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=20 prefix-density=0.93 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=12.74 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.9 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGCC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=39 prefix-density=0.35 prefix-fanout=1.9 sequence=GGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=53.66 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=9.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12949787 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:04:10 Started mapping on | Dec 07 10:04:10 Finished on | Dec 07 10:08:02 Mapping speed, Million of reads per hour | 608.16 Number of input reads | 39192824 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 36971621 Uniquely mapped reads % | 94.33% Average mapped length | 292.37 Number of splices: Total | 35384237 Number of splices: Annotated (sjdb) | 33328925 Number of splices: GT/AG | 34909711 Number of splices: GC/AG | 416896 Number of splices: AT/AC | 12876 Number of splices: Non-canonical | 44754 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 469022 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 79737 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1752181 1752181 1752181 N_multimapping 469022 469022 469022 N_noFeature 1341364 35916870 1629804 N_ambiguous 899330 5426 134234 UnstrandedReadsAssigned:34730927 PositiveStrandReadsAssigned:1049325 NegativeStrandReadsAssigned:35207583 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949787 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949787-trimmed-pair1.fastq SRR12949787-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,192,824 reads, 35,850,829 reads pseudoaligned [quant] estimated average fragment length: 270.7 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR12949787.ke.tsv 35125 SRR12949787.se.tsv 88098 total ==> SRR12949787.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.121 0 0 PNS24247 1044 774.3 69.6115 3.59953 PNS24249 1928 1658.3 123.526 2.98241 PNS24246 1044 774.3 69.6115 3.59953 PNS24248 1044 774.3 69.6115 3.59953 PNS24244 1471 1201.3 104.64 3.48754 PNS24243 293 106.087 0 0 KQK14069 1603 1333.3 2966.06 89.0688 KQK14071 474 239.668 73.1673 12.223 ==> SRR12949787.se.tsv <== BRADI_1g14170v3 3591 BRADI_1g53295v3 98 BRADI_1g59795v3 612 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 702 BRADI_1g74790v3 247 BRADI_1g09890v3 0 BRADI_1g77505v3 325 BRADI_1g48960v3 0 SRR12949787 completed mapping pipeline successfully