Starting /dee2/code/volunteer_pipeline.sh SRR12949788 current disk space = 1543936012288 free memory = 1598653944 SRR12949788 SRAfilesize c451d5944e530d3b318fa6853f049aa6 SRR12949788.sra SRR12949788.sra file validated SRR12949788 is paired end SRR12949788 is conventional basespace SRR12949788 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949788_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6605 37.0 37.0 37.0 37.0 37.0 2 36.1175 37.0 37.0 37.0 37.0 37.0 3 36.5855 37.0 37.0 37.0 37.0 37.0 4 36.701 37.0 37.0 37.0 37.0 37.0 5 36.7 37.0 37.0 37.0 37.0 37.0 6 36.7115 37.0 37.0 37.0 37.0 37.0 7 36.582 37.0 37.0 37.0 37.0 37.0 8 36.6135 37.0 37.0 37.0 37.0 37.0 9 36.581 37.0 37.0 37.0 37.0 37.0 10-14 36.625800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.564800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5155 37.0 37.0 37.0 37.0 37.0 25-29 36.4682 37.0 37.0 37.0 37.0 37.0 30-34 36.463499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.45399999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.3637 37.0 37.0 37.0 37.0 37.0 45-49 35.9639 37.0 37.0 37.0 37.0 37.0 50-54 36.0846 37.0 37.0 37.0 37.0 37.0 55-59 35.863800000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.8405 37.0 37.0 37.0 37.0 37.0 65-69 35.750099999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8806 37.0 37.0 37.0 37.0 37.0 75-79 36.2368 37.0 37.0 37.0 37.0 37.0 80-84 36.2361 37.0 37.0 37.0 37.0 37.0 85-89 36.158 37.0 37.0 37.0 37.0 37.0 90-94 36.1494 37.0 37.0 37.0 37.0 37.0 95-99 36.1574 37.0 37.0 37.0 37.0 37.0 100-104 36.1296 37.0 37.0 37.0 37.0 37.0 105-109 36.0851 37.0 37.0 37.0 37.0 37.0 110-114 36.0499 37.0 37.0 37.0 37.0 37.0 115-119 35.9651 37.0 37.0 37.0 37.0 37.0 120-124 35.8815 37.0 37.0 37.0 37.0 37.0 125-129 35.796499999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.632799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5249 37.0 37.0 37.0 37.0 37.0 140-144 35.3255 37.0 37.0 37.0 34.6 37.0 145-149 35.216300000000004 37.0 37.0 37.0 34.6 37.0 150-151 35.15675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 2.0 24 6.0 25 9.0 26 8.0 27 15.0 28 22.0 29 24.0 30 35.0 31 34.0 32 60.0 33 172.0 34 141.0 35 308.0 36 2626.0 37 534.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 63.975 2.85 9.65 23.525 2 25.278622087132725 5.749746707193515 33.76393110435664 35.20770010131712 3 25.15 13.900000000000002 28.325 32.625 4 30.625000000000004 13.975000000000001 25.650000000000002 29.75 5 31.900000000000002 18.05 30.0 20.05 6 31.25 19.525000000000002 27.275 21.95 7 18.15 25.35 44.800000000000004 11.700000000000001 8 19.25 22.400000000000002 35.925000000000004 22.425 9 24.45 18.0 38.125 19.425 10-14 23.86 27.115000000000002 29.880000000000003 19.145 15-19 24.03 25.96 28.275 21.735 20-24 24.349999999999998 26.205000000000002 26.93 22.515 25-29 23.865 25.205 27.815 23.115 30-34 23.74 24.54 27.63 24.09 35-39 23.84 24.025 28.000000000000004 24.135 40-44 23.255 26.745 26.695 23.305 45-49 24.240000000000002 24.75 27.42 23.59 50-54 24.07 24.46 27.134999999999998 24.335 55-59 23.294999999999998 25.365 27.265 24.075 60-64 24.425 24.925 27.205000000000002 23.445 65-69 23.75 26.26 25.729999999999997 24.26 70-74 25.205 24.740000000000002 25.52 24.535 75-79 26.015 25.124999999999996 24.805 24.055 80-84 25.974999999999998 25.22 25.430000000000003 23.375 85-89 26.040000000000003 25.2 24.89 23.87 90-94 25.64 24.825 25.995 23.54 95-99 25.474999999999998 25.395 24.88 24.25 100-104 25.905 25.11 25.185000000000002 23.799999999999997 105-109 25.424999999999997 25.445 24.865000000000002 24.265 110-114 25.419999999999998 24.865000000000002 25.28 24.435000000000002 115-119 25.31 25.935000000000002 24.560000000000002 24.195 120-124 25.674999999999997 25.380000000000003 24.745 24.2 125-129 26.055 25.130000000000003 24.605 24.21 130-134 25.45 26.005 23.919999999999998 24.625 135-139 25.540000000000003 25.495 24.965 24.0 140-144 25.285000000000004 25.365 24.555 24.795 145-149 26.025 25.795 23.86 24.32 150-151 25.7375 25.074999999999996 24.7375 24.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 6.5 26 7.0 27 9.5 28 12.5 29 14.5 30 20.5 31 31.0 32 31.5 33 27.5 34 38.0 35 50.0 36 57.0 37 71.0 38 88.0 39 104.5 40 116.0 41 134.5 42 165.0 43 184.0 44 197.5 45 213.5 46 218.0 47 203.5 48 195.5 49 168.0 50 134.5 51 130.5 52 128.5 53 119.0 54 99.0 55 75.5 56 65.5 57 66.5 58 70.0 59 62.5 60 57.0 61 64.5 62 58.5 63 51.5 64 54.0 65 62.5 66 66.0 67 58.5 68 47.5 69 31.0 70 20.5 71 20.5 72 16.5 73 13.0 74 16.5 75 13.5 76 6.0 77 3.5 78 4.0 79 2.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 92.30127848804892 83.025 2 6.670372429127293 12.0 3 0.7226236798221234 1.95 4 0.08337965536409116 0.3 5 0.08337965536409116 0.375 6 0.055586436909394105 0.3 7 0.0 0.0 8 0.0 0.0 9 0.027793218454697052 0.22499999999999998 >10 0.055586436909394105 1.825 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGTAAATCTCGTAT 45 1.125 TruSeq Adapter, Index 18 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGTAAATCGCGTAT 28 0.7000000000000001 TruSeq Adapter, Index 18 (97% over 38bp) GCCCTCGTAAGTGTCCTGATAATCGATCTATAGCTTCTTTGTTTGCATCC 9 0.22499999999999998 No Hit GTCTGGTTGTAGTCCGTCTTGAACTCCTGCAGCAGCGCGTCGAACTCGTC 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGTAAATCTCGTTT 6 0.15 TruSeq Adapter, Index 18 (97% over 38bp) GGGGGAGGCAATGGAGTACAGAGATACATGAGATGGTGGCATCTGAGGAA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGTAAATCTCGGAT 5 0.125 TruSeq Adapter, Index 18 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGTAAATCGCGTTT 5 0.125 TruSeq Adapter, Index 18 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.07500000000000001 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.2125 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.32499999999999996 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.5875 0.0 0.0 0.0 0.0 74-75 0.7375 0.0 0.0 0.0 0.0 76-77 0.95 0.0 0.0 0.0 0.0 78-79 1.1 0.0 0.0 0.0 0.0 80-81 1.375 0.0 0.0 0.0 0.0 82-83 1.625 0.0 0.0 0.0 0.0 84-85 1.9 0.0 0.0 0.0 0.0 86-87 2.2249999999999996 0.0 0.0 0.0 0.0 88-89 2.5125 0.0 0.0 0.0 0.0 90-91 2.95 0.0 0.0 0.0 0.0 92-93 3.3625 0.0 0.0 0.0 0.0 94-95 3.6125 0.0 0.0 0.0 0.0 96-97 4.0 0.0 0.0 0.0 0.0 98-99 4.45 0.0 0.0 0.0 0.0 100-101 4.9875 0.0 0.0 0.0 0.0 102-103 5.5125 0.0 0.0 0.0 0.0 104-105 6.1 0.0 0.0 0.0 0.0 106-107 6.725 0.0 0.0 0.0 0.0 108-109 7.5375 0.0 0.0 0.0 0.0 110-111 8.2 0.0 0.0 0.0 0.0 112-113 8.925 0.0 0.0 0.0 0.0 114-115 9.45 0.0 0.0 0.0 0.0 116-117 10.3875 0.0 0.0 0.0 0.0 118-119 11.3625 0.0 0.0 0.0 0.0 120-121 12.0875 0.0 0.0 0.0 0.0 122-123 12.7625 0.0 0.0 0.0 0.0 124-125 13.65 0.0 0.0 0.0 0.0 126-127 14.425 0.0 0.0 0.0 0.0 128-129 15.2 0.0 0.0 0.0 0.0 130-131 16.0625 0.0 0.0 0.0 0.0 132-133 17.049999999999997 0.0 0.0 0.0 0.0 134-135 18.1875 0.0 0.0 0.0 0.0 136-137 19.25 0.0 0.0 0.0 0.0 138-139 20.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTCA 10 0.0068343505 144.975 4 TGGATTC 10 0.0068343505 144.975 3 GATCGGA 140 7.7532965E-4 26.216093 1 ATCGGAA 140 7.7532965E-4 26.216093 2 TCGGAAG 140 8.364653E-4 25.888391 3 CGGAAGA 140 8.364653E-4 25.888391 4 >>END_MODULE SRR12949788 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949788_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4215 37.0 37.0 37.0 37.0 37.0 2 36.1075 37.0 37.0 37.0 37.0 37.0 3 36.2195 37.0 37.0 37.0 37.0 37.0 4 36.1735 37.0 37.0 37.0 37.0 37.0 5 36.1465 37.0 37.0 37.0 37.0 37.0 6 36.2425 37.0 37.0 37.0 37.0 37.0 7 36.115 37.0 37.0 37.0 37.0 37.0 8 36.123 37.0 37.0 37.0 37.0 37.0 9 36.0185 37.0 37.0 37.0 37.0 37.0 10-14 35.951 37.0 37.0 37.0 37.0 37.0 15-19 35.888099999999994 37.0 37.0 37.0 37.0 37.0 20-24 35.7653 37.0 37.0 37.0 37.0 37.0 25-29 35.5303 37.0 37.0 37.0 37.0 37.0 30-34 35.377599999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.3787 37.0 37.0 37.0 37.0 37.0 40-44 35.289300000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.281800000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.2096 37.0 37.0 37.0 37.0 37.0 55-59 35.2672 37.0 37.0 37.0 37.0 37.0 60-64 35.36900000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.2967 37.0 37.0 37.0 37.0 37.0 70-74 35.1859 37.0 37.0 37.0 37.0 37.0 75-79 35.1426 37.0 37.0 37.0 37.0 37.0 80-84 35.17100000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.2902 37.0 37.0 37.0 37.0 37.0 90-94 35.3453 37.0 37.0 37.0 37.0 37.0 95-99 35.438900000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.418 37.0 37.0 37.0 37.0 37.0 105-109 35.3429 37.0 37.0 37.0 37.0 37.0 110-114 35.270500000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.1589 37.0 37.0 37.0 34.6 37.0 120-124 35.0394 37.0 37.0 37.0 29.8 37.0 125-129 34.953199999999995 37.0 37.0 37.0 25.0 37.0 130-134 34.82209999999999 37.0 37.0 37.0 25.0 37.0 135-139 34.574 37.0 37.0 37.0 25.0 37.0 140-144 34.403999999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.2353 37.0 37.0 37.0 25.0 37.0 150-151 33.83475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 17.0 14 17.0 15 17.0 16 6.0 17 1.0 18 7.0 19 8.0 20 14.0 21 17.0 22 11.0 23 18.0 24 27.0 25 25.0 26 16.0 27 23.0 28 31.0 29 30.0 30 29.0 31 42.0 32 57.0 33 77.0 34 169.0 35 417.0 36 2516.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 65.17500000000001 4.025 9.975000000000001 20.825 2 35.949999999999996 9.975000000000001 26.224999999999998 27.85 3 26.474999999999998 19.35 35.3 18.875 4 30.599999999999998 28.349999999999998 17.349999999999998 23.7 5 30.9 32.025 17.45 19.625 6 25.4 33.925 18.6 22.075 7 26.724999999999998 20.7 30.4 22.175 8 25.4 23.65 22.775000000000002 28.175 9 26.625 23.075000000000003 24.099999999999998 26.200000000000003 10-14 28.265 26.174999999999997 22.495 23.064999999999998 15-19 27.605 25.215 23.26 23.919999999999998 20-24 27.595 25.465 23.625 23.315 25-29 27.134999999999998 25.535000000000004 23.925 23.405 30-34 26.745 25.924999999999997 23.69 23.64 35-39 27.52 25.825 23.3 23.355 40-44 26.435 26.150000000000002 23.625 23.79 45-49 25.35 26.44 25.35 22.86 50-54 26.229999999999997 26.185000000000002 24.515 23.07 55-59 26.555 26.255 24.295 22.895 60-64 26.729999999999997 26.365 23.76 23.145 65-69 26.41 26.68 23.87 23.04 70-74 26.8 26.845000000000002 23.74 22.615 75-79 25.805 26.945000000000004 24.025 23.225 80-84 25.39 27.07 24.5 23.04 85-89 26.345000000000002 26.995 23.745 22.915 90-94 26.479999999999997 26.784999999999997 24.33 22.405 95-99 26.415 27.400000000000002 23.885 22.3 100-104 27.145000000000003 27.084999999999997 23.555 22.215 105-109 27.169999999999998 27.115000000000002 24.15 21.565 110-114 27.744999999999997 27.27 23.48 21.505 115-119 28.08 27.165 23.72 21.035 120-124 28.849999999999998 27.060000000000002 23.78 20.31 125-129 29.520000000000003 27.045 23.315 20.119999999999997 130-134 30.209999999999997 27.6 22.405 19.785 135-139 30.39 27.425 23.06 19.125 140-144 31.615 27.134999999999998 22.355 18.895 145-149 31.75 26.775 22.605 18.87 150-151 32.775 26.9125 22.45 17.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.5 5 0.5 6 0.5 7 1.0 8 1.0 9 2.0 10 3.0 11 1.5 12 0.5 13 2.0 14 1.5 15 1.5 16 2.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.5 23 3.0 24 2.5 25 3.5 26 3.0 27 4.5 28 9.0 29 9.5 30 10.0 31 10.0 32 15.5 33 21.5 34 22.0 35 30.0 36 42.5 37 72.0 38 99.5 39 106.5 40 124.0 41 149.5 42 181.5 43 186.0 44 173.5 45 190.5 46 195.5 47 174.0 48 161.0 49 148.0 50 141.0 51 142.0 52 136.5 53 110.5 54 84.5 55 89.5 56 86.0 57 82.0 58 73.5 59 69.5 60 72.5 61 66.0 62 66.5 63 58.0 64 47.5 65 50.5 66 50.5 67 44.0 68 37.0 69 35.5 70 32.0 71 23.5 72 22.5 73 25.5 74 20.0 75 15.5 76 13.0 77 7.0 78 4.5 79 3.0 80 2.5 81 1.0 82 2.0 83 3.5 84 5.0 85 4.5 86 3.0 87 3.5 88 3.0 89 2.0 90 2.0 91 3.5 92 5.5 93 5.5 94 4.5 95 6.5 96 8.5 97 8.5 98 9.0 99 10.5 100 13.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.5127860026918 86.85000000000001 2 5.895020188425303 10.95 3 0.48452220726783307 1.35 4 0.08075370121130553 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026917900403768503 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.32499999999999996 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.6000000000000001 0.0 0.0 0.0 0.0 74-75 0.7875 0.0 0.0 0.0 0.0 76-77 1.0 0.0 0.0 0.0 0.0 78-79 1.15 0.0 0.0 0.0 0.0 80-81 1.4 0.0 0.0 0.0 0.0 82-83 1.6 0.0 0.0 0.0 0.0 84-85 1.875 0.0 0.0 0.0 0.0 86-87 2.2125 0.0 0.0 0.0 0.0 88-89 2.4749999999999996 0.0 0.0 0.0 0.0 90-91 2.925 0.0 0.0 0.0 0.0 92-93 3.3375 0.0 0.0 0.0 0.0 94-95 3.5625 0.0 0.0 0.0 0.0 96-97 3.9250000000000003 0.0 0.0 0.0 0.0 98-99 4.375 0.0 0.0 0.0 0.0 100-101 4.9125 0.0 0.0 0.0 0.0 102-103 5.4375 0.0 0.0 0.0 0.0 104-105 6.025 0.0 0.0 0.0 0.0 106-107 6.637499999999999 0.0 0.0 0.0 0.0 108-109 7.4375 0.0 0.0 0.0 0.0 110-111 8.100000000000001 0.0 0.0 0.0 0.0 112-113 8.875 0.0 0.0 0.0 0.0 114-115 9.4125 0.0 0.0 0.0 0.0 116-117 10.3625 0.0 0.0 0.0 0.0 118-119 11.3625 0.0 0.0 0.0 0.0 120-121 12.0875 0.0 0.0 0.0 0.0 122-123 12.787500000000001 0.0 0.0 0.0 0.0 124-125 13.65 0.0 0.0 0.0 0.0 126-127 14.425 0.0 0.0 0.0 0.0 128-129 15.2 0.0 0.0 0.0 0.0 130-131 16.0625 0.0 0.0 0.0 0.0 132-133 17.1 0.0 0.0 0.0 0.0 134-135 18.237499999999997 0.0 0.0 0.0 0.0 136-137 19.2875 0.0 0.0 0.0 0.0 138-139 20.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGAC 10 0.006830828 145.0 5 >>END_MODULE Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306674 spots for SRR12949788.sra Written 1306674 spots for SRR12949788.sra Read 1306686 spots for SRR12949788.sra Written 1306686 spots for SRR12949788.sra SRR ids: ['SRR12949788.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i5bvxd1n SRR12949788.sra spots: 26133492 blocks: [[1, 1306674], [1306675, 2613348], [2613349, 3920022], [3920023, 5226696], [5226697, 6533370], [6533371, 7840044], [7840045, 9146718], [9146719, 10453392], [10453393, 11760066], [11760067, 13066740], [13066741, 14373414], [14373415, 15680088], [15680089, 16986762], [16986763, 18293436], [18293437, 19600110], [19600111, 20906784], [20906785, 22213458], [22213459, 23520132], [23520133, 24826806], [24826807, 26133492]] SRR12949788 file size 8859603 SRR12949788 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949788 SRR12949788_1.fastq SRR12949788_2.fastq Input file: SRR12949788_1.fastq Paired file: SRR12949788_2.fastq trimmed: SRR12949788-trimmed-pair1.fastq, SRR12949788-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:01:05 2024 >> started Sat Dec 7 10:01:32 2024 >> done (27.524s) 26133492 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 722728 ( 2.77%) empty read pairs filtered out after trimming by size control 25410670 (97.23%) read pairs available; of these: 7221420 (28.42%) trimmed read pairs available after processing 18189250 (71.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 14 0.00% 20 20 0.00% 21 23 0.00% 22 30 0.00% 23 48 0.00% 24 109 0.00% 25 21 0.00% 26 53 0.00% 27 71 0.00% 28 72 0.00% 29 97 0.00% 30 127 0.00% 31 174 0.00% 32 143 0.00% 33 147 0.00% 34 109 0.00% 35 167 0.00% 36 160 0.00% 37 256 0.00% 38 319 0.00% 39 429 0.00% 40 492 0.00% 41 492 0.00% 42 427 0.00% 43 462 0.00% 44 486 0.00% 45 610 0.00% 46 807 0.00% 47 994 0.00% 48 1190 0.00% 49 1441 0.01% 50 1694 0.01% 51 1866 0.01% 52 1714 0.01% 53 1772 0.01% 54 1970 0.01% 55 2216 0.01% 56 2606 0.01% 57 3599 0.01% 58 4390 0.02% 59 5221 0.02% 60 6148 0.02% 61 6527 0.03% 62 6813 0.03% 63 6741 0.03% 64 7295 0.03% 65 7537 0.03% 66 8679 0.03% 67 10329 0.04% 68 12163 0.05% 69 14027 0.06% 70 16356 0.06% 71 18139 0.07% 72 19300 0.08% 73 19218 0.08% 74 20414 0.08% 75 20434 0.08% 76 21133 0.08% 77 22604 0.09% 78 25282 0.10% 79 27912 0.11% 80 31163 0.12% 81 34699 0.14% 82 37717 0.15% 83 39963 0.16% 84 40593 0.16% 85 41016 0.16% 86 40608 0.16% 87 42262 0.17% 88 43535 0.17% 89 46027 0.18% 90 50696 0.20% 91 54388 0.21% 92 57864 0.23% 93 62202 0.24% 94 61425 0.24% 95 62668 0.25% 96 61807 0.24% 97 61343 0.24% 98 63135 0.25% 99 66433 0.26% 100 68919 0.27% 101 74778 0.29% 102 78710 0.31% 103 81622 0.32% 104 84435 0.33% 105 86125 0.34% 106 83836 0.33% 107 83346 0.33% 108 84038 0.33% 109 85438 0.34% 110 89498 0.35% 111 95807 0.38% 112 99053 0.39% 113 102960 0.41% 114 108074 0.43% 115 108039 0.43% 116 104389 0.41% 117 104860 0.41% 118 103639 0.41% 119 104616 0.41% 120 107756 0.42% 121 110036 0.43% 122 113445 0.45% 123 121329 0.48% 124 126387 0.50% 125 124704 0.49% 126 126408 0.50% 127 120810 0.48% 128 120826 0.48% 129 119613 0.47% 130 121216 0.48% 131 121818 0.48% 132 131128 0.52% 133 135409 0.53% 134 136921 0.54% 135 138071 0.54% 136 139384 0.55% 137 136177 0.54% 138 133539 0.53% 139 131228 0.52% 140 129290 0.51% 141 131145 0.52% 142 137543 0.54% 143 141651 0.56% 144 145492 0.57% 145 147881 0.58% 146 149484 0.59% 147 144256 0.57% 148 140073 0.55% 149 137943 0.54% 150 134628 0.53% 151 18189250 71.58% 25410670 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=7.61 fanout-score-rank=8 prefix-density=0.04 prefix-fanout=7.6 sequence=TTTTTTTTTTGA criterion=fanout-score sequence-density=0.59 sequence-density-rank=2 fanout-score=32.25 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=31.8 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGGTAAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=13.85 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=7.2 sequence=CAAGGAGATCAAGAACGGCCGCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=73.44 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12949788 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:02:44 Started mapping on | Dec 07 10:02:47 Finished on | Dec 07 10:05:01 Mapping speed, Million of reads per hour | 682.67 Number of input reads | 25410670 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 18062688 Uniquely mapped reads % | 71.08% Average mapped length | 283.32 Number of splices: Total | 18698324 Number of splices: Annotated (sjdb) | 17684475 Number of splices: GT/AG | 18437658 Number of splices: GC/AG | 239566 Number of splices: AT/AC | 9477 Number of splices: Non-canonical | 11623 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128538 % of reads mapped to multiple loci | 0.51% Number of reads mapped to too many loci | 6295 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 28.30% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7219444 7219444 7219444 N_multimapping 128538 128538 128538 N_noFeature 793686 17547570 948529 N_ambiguous 493165 4540 133782 UnstrandedReadsAssigned:16775837 PositiveStrandReadsAssigned:510578 NegativeStrandReadsAssigned:16980377 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=127 echo kmer=123 SRR12949788 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949788-trimmed-pair1.fastq SRR12949788-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,410,670 reads, 23,228,800 reads pseudoaligned [quant] estimated average fragment length: 192.639 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR12949788.ke.tsv 35125 SRR12949788.se.tsv 88098 total ==> SRR12949788.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.582 0 0 PNS24247 1044 852.361 150.44 12.7144 PNS24249 1928 1736.36 141.638 5.87618 PNS24246 1044 852.361 150.44 12.7144 PNS24248 1044 852.361 150.44 12.7144 PNS24244 1471 1279.36 163.042 9.18041 PNS24243 293 127.813 0 0 KQK14069 1603 1411.36 6711.2 342.546 KQK14071 474 288.527 6384.63 1594.06 ==> SRR12949788.se.tsv <== BRADI_1g14170v3 14019 BRADI_1g53295v3 77 BRADI_1g59795v3 606 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 178 BRADI_1g74790v3 45 BRADI_1g09890v3 0 BRADI_1g77505v3 179 BRADI_1g48960v3 0 SRR12949788 completed mapping pipeline successfully