Starting /dee2/code/volunteer_pipeline.sh SRR12949789 current disk space = 1543800819712 free memory = 1479049148 SRR12949789 SRAfilesize e43d1e86c9fbe8cafd16f178ba4910e1 SRR12949789.sra SRR12949789.sra file validated SRR12949789 is paired end SRR12949789 is conventional basespace SRR12949789 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949789_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.632 37.0 37.0 37.0 37.0 37.0 2 36.044 37.0 37.0 37.0 37.0 37.0 3 36.498 37.0 37.0 37.0 37.0 37.0 4 36.6915 37.0 37.0 37.0 37.0 37.0 5 36.6175 37.0 37.0 37.0 37.0 37.0 6 36.588 37.0 37.0 37.0 37.0 37.0 7 36.555 37.0 37.0 37.0 37.0 37.0 8 36.6605 37.0 37.0 37.0 37.0 37.0 9 36.684 37.0 37.0 37.0 37.0 37.0 10-14 36.6317 37.0 37.0 37.0 37.0 37.0 15-19 36.6475 37.0 37.0 37.0 37.0 37.0 20-24 36.6042 37.0 37.0 37.0 37.0 37.0 25-29 36.5801 37.0 37.0 37.0 37.0 37.0 30-34 36.5654 37.0 37.0 37.0 37.0 37.0 35-39 36.537099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5492 37.0 37.0 37.0 37.0 37.0 45-49 36.502599999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4543 37.0 37.0 37.0 37.0 37.0 55-59 36.4587 37.0 37.0 37.0 37.0 37.0 60-64 36.431099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3677 37.0 37.0 37.0 37.0 37.0 70-74 36.3849 37.0 37.0 37.0 37.0 37.0 75-79 36.356899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.357899999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.279 37.0 37.0 37.0 37.0 37.0 90-94 36.3089 37.0 37.0 37.0 37.0 37.0 95-99 36.2915 37.0 37.0 37.0 37.0 37.0 100-104 36.2911 37.0 37.0 37.0 37.0 37.0 105-109 36.1643 37.0 37.0 37.0 37.0 37.0 110-114 36.138 37.0 37.0 37.0 37.0 37.0 115-119 36.130700000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.165499999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0318 37.0 37.0 37.0 37.0 37.0 130-134 35.949 37.0 37.0 37.0 37.0 37.0 135-139 35.9714 37.0 37.0 37.0 37.0 37.0 140-144 35.870000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.925 37.0 37.0 37.0 37.0 37.0 150-151 35.684250000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 3.0 24 1.0 25 2.0 26 1.0 27 7.0 28 10.0 29 22.0 30 26.0 31 28.0 32 35.0 33 65.0 34 105.0 35 288.0 36 2864.0 37 540.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 57.699999999999996 9.875 4.8500000000000005 27.575 2 23.30978809283552 10.267406659939455 31.43289606458123 34.9899091826438 3 22.225 15.225 26.400000000000002 36.15 4 27.575 20.825 22.075 29.525000000000002 5 27.775 27.125 22.525000000000002 22.575 6 25.174999999999997 30.8 20.65 23.375 7 19.925 24.9 37.2 17.974999999999998 8 20.25 24.65 28.799999999999997 26.3 9 20.825 21.9 32.975 24.3 10-14 23.79 26.045 26.325 23.84 15-19 24.169999999999998 24.75 25.785000000000004 25.295 20-24 23.31 25.635 25.5 25.555 25-29 23.71 24.990000000000002 26.145000000000003 25.155 30-34 23.25 25.46 25.419999999999998 25.869999999999997 35-39 23.78 26.19 24.595 25.435000000000002 40-44 23.98 25.385 25.245 25.39 45-49 23.635 25.645 24.834999999999997 25.885 50-54 23.565 25.019999999999996 25.130000000000003 26.284999999999997 55-59 22.96 26.229999999999997 25.515 25.295 60-64 23.05 25.335 25.474999999999998 26.14 65-69 23.794999999999998 25.169999999999998 25.509999999999998 25.525 70-74 23.84 25.365 25.255 25.540000000000003 75-79 24.060000000000002 25.124999999999996 25.44 25.374999999999996 80-84 23.535 24.805 25.6 26.06 85-89 23.52 25.035 25.555 25.89 90-94 23.369999999999997 25.36 25.55 25.72 95-99 23.915 24.67 25.775 25.64 100-104 23.515 25.305 25.674999999999997 25.505 105-109 23.905 25.430000000000003 25.15 25.515 110-114 23.52 25.430000000000003 25.259999999999998 25.790000000000003 115-119 24.03 25.055 25.19 25.724999999999998 120-124 24.46 25.055 25.245 25.240000000000002 125-129 23.7 25.790000000000003 24.82 25.69 130-134 24.05 25.61 24.375 25.965 135-139 24.279999999999998 25.705 24.63 25.385 140-144 23.86 25.14 25.41 25.590000000000003 145-149 23.535 25.91 25.130000000000003 25.424999999999997 150-151 24.025 23.9 25.724999999999998 26.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 0.5 27 2.0 28 5.0 29 6.0 30 8.0 31 13.5 32 17.5 33 21.5 34 26.5 35 35.5 36 44.0 37 55.5 38 72.0 39 80.5 40 92.0 41 121.5 42 157.5 43 178.5 44 201.0 45 216.5 46 218.0 47 203.0 48 186.0 49 194.0 50 174.0 51 146.0 52 140.5 53 134.5 54 122.0 55 103.5 56 92.0 57 85.0 58 77.5 59 76.0 60 77.0 61 68.0 62 57.0 63 59.5 64 58.0 65 51.5 66 51.5 67 53.0 68 50.5 69 34.5 70 29.0 71 27.5 72 23.0 73 16.5 74 8.0 75 7.0 76 6.0 77 4.5 78 1.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.375 #Duplication Level Percentage of deduplicated Percentage of total 1 92.61163734776726 85.55 2 6.7388362652232745 12.45 3 0.46008119079837617 1.275 4 0.16238159675236805 0.6 5 0.027063599458728015 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGGCCAGCAAGAGTCAGCTCCTTTATTTTAAGGTAGTAAACTTCAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.637499999999999 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.55 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.5125 0.0 0.0 0.0 0.0 138-139 7.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12949789 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949789_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3325 37.0 37.0 37.0 37.0 37.0 2 36.2245 37.0 37.0 37.0 37.0 37.0 3 36.1925 37.0 37.0 37.0 37.0 37.0 4 36.226 37.0 37.0 37.0 37.0 37.0 5 36.292 37.0 37.0 37.0 37.0 37.0 6 36.243 37.0 37.0 37.0 37.0 37.0 7 36.2105 37.0 37.0 37.0 37.0 37.0 8 36.177 37.0 37.0 37.0 37.0 37.0 9 36.36 37.0 37.0 37.0 37.0 37.0 10-14 36.335 37.0 37.0 37.0 37.0 37.0 15-19 36.3418 37.0 37.0 37.0 37.0 37.0 20-24 36.280499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.271 37.0 37.0 37.0 37.0 37.0 30-34 36.1657 37.0 37.0 37.0 37.0 37.0 35-39 36.140100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.15559999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1178 37.0 37.0 37.0 37.0 37.0 50-54 36.1031 37.0 37.0 37.0 37.0 37.0 55-59 36.1168 37.0 37.0 37.0 37.0 37.0 60-64 36.049099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0234 37.0 37.0 37.0 37.0 37.0 70-74 35.9899 37.0 37.0 37.0 37.0 37.0 75-79 35.938900000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.966499999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.966300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.940999999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.918 37.0 37.0 37.0 37.0 37.0 100-104 35.896300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.821299999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7946 37.0 37.0 37.0 37.0 37.0 115-119 35.826800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.6632 37.0 37.0 37.0 37.0 37.0 125-129 35.7139 37.0 37.0 37.0 37.0 37.0 130-134 35.644999999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5766 37.0 37.0 37.0 37.0 37.0 140-144 35.524 37.0 37.0 37.0 37.0 37.0 145-149 35.4136 37.0 37.0 37.0 34.6 37.0 150-151 35.073750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 4.0 15 1.0 16 4.0 17 1.0 18 5.0 19 0.0 20 4.0 21 5.0 22 7.0 23 7.0 24 4.0 25 4.0 26 6.0 27 11.0 28 18.0 29 14.0 30 30.0 31 20.0 32 52.0 33 89.0 34 174.0 35 439.0 36 2693.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.0 20.825 7.6 20.575 2 30.4 22.125 24.875 22.6 3 23.974999999999998 23.375 31.225 21.425 4 28.775000000000002 30.75 20.1 20.375 5 27.275 33.5 19.8 19.425 6 24.15 33.75 19.1 23.0 7 24.675 20.599999999999998 32.45 22.275 8 22.75 22.3 25.825 29.125 9 25.5 21.75 25.3 27.450000000000003 10-14 26.14 25.82 23.335 24.705 15-19 26.32 24.745 23.775 25.16 20-24 25.7 25.36 24.325 24.615000000000002 25-29 25.94 25.805 23.7 24.555 30-34 25.635 25.130000000000003 24.525 24.709999999999997 35-39 25.845000000000002 25.569999999999997 24.035 24.55 40-44 25.575 25.074999999999996 24.104999999999997 25.245 45-49 25.919999999999998 25.495 24.15 24.435000000000002 50-54 26.229999999999997 25.06 24.485 24.224999999999998 55-59 26.455000000000002 25.355 24.0 24.19 60-64 25.95 25.56 24.13 24.36 65-69 25.905 25.119999999999997 24.73 24.245 70-74 26.314999999999998 25.580000000000002 24.33 23.775 75-79 25.69 25.205 25.16 23.945 80-84 26.08 25.46 24.67 23.79 85-89 25.929999999999996 25.580000000000002 24.4 24.09 90-94 25.919999999999998 25.45 24.490000000000002 24.14 95-99 26.029999999999998 25.795 24.11 24.065 100-104 25.900000000000002 25.06 24.595 24.445 105-109 26.31 25.31 24.95 23.43 110-114 26.700000000000003 25.759999999999998 23.94 23.599999999999998 115-119 26.575 25.535000000000004 24.125 23.765 120-124 27.075 25.745 23.669999999999998 23.51 125-129 26.32 25.814999999999998 24.2 23.665 130-134 26.935 26.075 24.235 22.755 135-139 27.175 25.724999999999998 24.060000000000002 23.04 140-144 26.93 26.025 23.84 23.205000000000002 145-149 28.000000000000004 26.39 23.24 22.37 150-151 27.437499999999996 25.937500000000004 24.4875 22.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 3.5 27 6.5 28 6.5 29 7.0 30 11.5 31 12.0 32 13.5 33 15.0 34 22.0 35 32.5 36 39.0 37 49.5 38 65.0 39 79.5 40 106.5 41 131.5 42 138.0 43 161.5 44 188.0 45 196.5 46 197.5 47 182.5 48 171.0 49 175.0 50 162.5 51 144.5 52 130.0 53 127.0 54 126.0 55 100.5 56 94.5 57 94.0 58 80.5 59 72.0 60 69.5 61 83.0 62 81.5 63 69.0 64 73.0 65 77.5 66 75.5 67 66.0 68 52.0 69 43.0 70 34.5 71 25.0 72 19.0 73 19.0 74 15.0 75 8.0 76 7.5 77 6.5 78 2.5 79 1.5 80 1.5 81 1.0 82 1.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 1.0 90 1.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.44359880402283 85.02499999999999 2 6.768143517260125 12.45 3 0.5164446860559935 1.425 4 0.19026909486273444 0.7000000000000001 5 0.05436259853220984 0.25 6 0.02718129926610492 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit ATCTTATTGAATGGCGCTATTAGAAAGGGGGAGCGCCTGATCCCCCCTAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 1.0125000000000002 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.15 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.137499999999999 0.0 0.0 0.0 0.0 136-137 6.637499999999999 0.0 0.0 0.0 0.0 138-139 7.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATGG 10 0.006830828 145.0 145 GGCAAAT 10 0.006830828 145.0 1 GCAAATC 10 0.006830828 145.0 2 >>END_MODULE Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra Read 1777315 spots for SRR12949789.sra Written 1777315 spots for SRR12949789.sra Read 1777310 spots for SRR12949789.sra Written 1777310 spots for SRR12949789.sra SRR ids: ['SRR12949789.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tsducww_ SRR12949789.sra spots: 35546205 blocks: [[1, 1777310], [1777311, 3554620], [3554621, 5331930], [5331931, 7109240], [7109241, 8886550], [8886551, 10663860], [10663861, 12441170], [12441171, 14218480], [14218481, 15995790], [15995791, 17773100], [17773101, 19550410], [19550411, 21327720], [21327721, 23105030], [23105031, 24882340], [24882341, 26659650], [26659651, 28436960], [28436961, 30214270], [30214271, 31991580], [31991581, 33768890], [33768891, 35546205]] SRR12949789 file size 12058455 SRR12949789 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949789 SRR12949789_1.fastq SRR12949789_2.fastq Input file: SRR12949789_1.fastq Paired file: SRR12949789_2.fastq trimmed: SRR12949789-trimmed-pair1.fastq, SRR12949789-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:15:44 2024 >> started Sat Dec 7 10:20:29 2024 >> done (285.869s) 35546205 read pairs processed; of these: 246 ( 0.00%) short read pairs filtered out after trimming by size control 22881 ( 0.06%) empty read pairs filtered out after trimming by size control 35523078 (99.93%) read pairs available; of these: 4013291 (11.30%) trimmed read pairs available after processing 31509787 (88.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 16 0.00% 20 25 0.00% 21 23 0.00% 22 28 0.00% 23 31 0.00% 24 40 0.00% 25 49 0.00% 26 34 0.00% 27 44 0.00% 28 54 0.00% 29 52 0.00% 30 59 0.00% 31 47 0.00% 32 57 0.00% 33 64 0.00% 34 70 0.00% 35 69 0.00% 36 81 0.00% 37 87 0.00% 38 98 0.00% 39 55 0.00% 40 86 0.00% 41 110 0.00% 42 114 0.00% 43 124 0.00% 44 107 0.00% 45 126 0.00% 46 149 0.00% 47 144 0.00% 48 174 0.00% 49 199 0.00% 50 220 0.00% 51 243 0.00% 52 276 0.00% 53 301 0.00% 54 281 0.00% 55 347 0.00% 56 422 0.00% 57 454 0.00% 58 548 0.00% 59 556 0.00% 60 671 0.00% 61 759 0.00% 62 910 0.00% 63 1075 0.00% 64 1083 0.00% 65 1270 0.00% 66 1415 0.00% 67 1591 0.00% 68 1757 0.00% 69 1987 0.01% 70 2283 0.01% 71 2692 0.01% 72 3018 0.01% 73 3413 0.01% 74 3964 0.01% 75 4433 0.01% 76 4751 0.01% 77 5296 0.01% 78 5931 0.02% 79 6665 0.02% 80 6903 0.02% 81 7979 0.02% 82 8684 0.02% 83 9431 0.03% 84 10807 0.03% 85 11911 0.03% 86 12717 0.04% 87 13619 0.04% 88 14637 0.04% 89 14912 0.04% 90 16601 0.05% 91 17283 0.05% 92 18823 0.05% 93 20433 0.06% 94 21613 0.06% 95 22876 0.06% 96 24371 0.07% 97 25920 0.07% 98 26498 0.07% 99 28364 0.08% 100 29491 0.08% 101 30025 0.08% 102 31948 0.09% 103 33808 0.10% 104 34959 0.10% 105 36821 0.10% 106 39134 0.11% 107 40246 0.11% 108 41880 0.12% 109 43848 0.12% 110 44237 0.12% 111 46164 0.13% 112 48004 0.14% 113 48695 0.14% 114 51649 0.15% 115 52882 0.15% 116 55165 0.16% 117 57188 0.16% 118 59150 0.17% 119 60599 0.17% 120 62689 0.18% 121 64552 0.18% 122 64666 0.18% 123 67351 0.19% 124 68933 0.19% 125 70367 0.20% 126 73008 0.21% 127 74752 0.21% 128 76918 0.22% 129 79773 0.22% 130 80560 0.23% 131 81301 0.23% 132 83499 0.24% 133 85285 0.24% 134 86078 0.24% 135 87764 0.25% 136 90585 0.26% 137 90860 0.26% 138 93287 0.26% 139 96069 0.27% 140 96929 0.27% 141 99157 0.28% 142 101753 0.29% 143 101489 0.29% 144 103405 0.29% 145 105107 0.30% 146 106152 0.30% 147 107636 0.30% 148 109214 0.31% 149 109678 0.31% 150 113154 0.32% 151 31509787 88.70% 35523078 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.29 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=3.6 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=1174.56 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=28.2 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=34 prefix-density=0.50 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=272.98 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=20.6 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR12949789 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:25:36 Started mapping on | Dec 07 10:25:37 Finished on | Dec 07 10:50:02 Mapping speed, Million of reads per hour | 87.29 Number of input reads | 35523078 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 33851712 Uniquely mapped reads % | 95.29% Average mapped length | 295.38 Number of splices: Total | 35004323 Number of splices: Annotated (sjdb) | 32801008 Number of splices: GT/AG | 34536226 Number of splices: GC/AG | 405976 Number of splices: AT/AC | 23858 Number of splices: Non-canonical | 38263 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393677 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 52772 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1277689 1277689 1277689 N_multimapping 393677 393677 393677 N_noFeature 1212714 33015710 1494130 N_ambiguous 644942 4588 91304 UnstrandedReadsAssigned:31994056 PositiveStrandReadsAssigned:831414 NegativeStrandReadsAssigned:32266278 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949789 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949789-trimmed-pair1.fastq SRR12949789-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,523,078 reads, 32,811,704 reads pseudoaligned [quant] estimated average fragment length: 280.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR12949789.ke.tsv 35125 SRR12949789.se.tsv 88098 total ==> SRR12949789.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.904 0 0 PNS24247 1044 764.017 154.062 9.43905 PNS24249 1928 1648.02 157.688 4.47892 PNS24246 1044 764.017 154.062 9.43905 PNS24248 1044 764.017 154.062 9.43905 PNS24244 1471 1191.02 266.124 10.4593 PNS24243 293 98.1947 4 1.90681 KQK14069 1603 1323.02 12907.1 456.665 KQK14071 474 228.748 202.76 41.4914 ==> SRR12949789.se.tsv <== BRADI_1g14170v3 14231 BRADI_1g53295v3 190 BRADI_1g59795v3 856 BRADI_1g07683v3 0 BRADI_1g00485v3 68 BRADI_1g20270v3 1648 BRADI_1g74790v3 102 BRADI_1g09890v3 3 BRADI_1g77505v3 247 BRADI_1g48960v3 1 SRR12949789 completed mapping pipeline successfully