Starting /dee2/code/volunteer_pipeline.sh SRR12949790 current disk space = 1543806529536 free memory = 1598489196 SRR12949790 SRAfilesize 9d3c6769c1a9bcdb454f76d710ab2834 SRR12949790.sra SRR12949790.sra file validated SRR12949790 is paired end SRR12949790 is conventional basespace SRR12949790 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949790_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.548 37.0 37.0 37.0 37.0 37.0 2 36.09225 37.0 37.0 37.0 37.0 37.0 3 36.5505 37.0 37.0 37.0 37.0 37.0 4 36.5525 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.652 37.0 37.0 37.0 37.0 37.0 7 36.6 37.0 37.0 37.0 37.0 37.0 8 36.648 37.0 37.0 37.0 37.0 37.0 9 36.6695 37.0 37.0 37.0 37.0 37.0 10-14 36.6254 37.0 37.0 37.0 37.0 37.0 15-19 36.6198 37.0 37.0 37.0 37.0 37.0 20-24 36.5846 37.0 37.0 37.0 37.0 37.0 25-29 36.545899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.516799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4867 37.0 37.0 37.0 37.0 37.0 40-44 36.509100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.47180000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.4344 37.0 37.0 37.0 37.0 37.0 55-59 36.479 37.0 37.0 37.0 37.0 37.0 60-64 36.363800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3726 37.0 37.0 37.0 37.0 37.0 70-74 36.3932 37.0 37.0 37.0 37.0 37.0 75-79 36.3482 37.0 37.0 37.0 37.0 37.0 80-84 36.338800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3226 37.0 37.0 37.0 37.0 37.0 90-94 36.3541 37.0 37.0 37.0 37.0 37.0 95-99 36.2848 37.0 37.0 37.0 37.0 37.0 100-104 36.264599999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.259499999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.2427 37.0 37.0 37.0 37.0 37.0 115-119 36.1762 37.0 37.0 37.0 37.0 37.0 120-124 36.1288 37.0 37.0 37.0 37.0 37.0 125-129 36.0618 37.0 37.0 37.0 37.0 37.0 130-134 36.06529999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.0579 37.0 37.0 37.0 37.0 37.0 140-144 35.829499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.913799999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.715 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 1.0 26 3.0 27 11.0 28 14.0 29 14.0 30 13.0 31 24.0 32 55.0 33 72.0 34 122.0 35 255.0 36 2834.0 37 579.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.475 9.625 6.15 36.75 2 21.61753590325019 9.926933736457547 34.64348702443941 33.81204333585286 3 21.725 14.85 24.675 38.75 4 27.325 21.525 20.825 30.325000000000003 5 26.974999999999998 26.325 23.225 23.474999999999998 6 22.900000000000002 30.425 23.150000000000002 23.525 7 20.05 24.7 37.15 18.099999999999998 8 20.3 24.175 30.85 24.675 9 19.675 20.925 33.275 26.125 10-14 22.89 26.47 26.19 24.45 15-19 23.41 24.959999999999997 25.955000000000002 25.674999999999997 20-24 22.759999999999998 25.245 26.224999999999998 25.77 25-29 23.035 25.555 25.535000000000004 25.874999999999996 30-34 23.45 25.525 25.335 25.69 35-39 23.815 24.959999999999997 26.185000000000002 25.040000000000003 40-44 23.285 25.025 25.985000000000003 25.705 45-49 22.45 25.14 26.229999999999997 26.179999999999996 50-54 22.535 25.365 25.915 26.185000000000002 55-59 23.585 25.115 25.36 25.94 60-64 23.375 25.145 24.735 26.745 65-69 23.03 25.355 25.255 26.36 70-74 23.175 25.035 25.91 25.88 75-79 23.23 25.71 25.009999999999998 26.05 80-84 23.185 24.63 26.490000000000002 25.695 85-89 23.625 25.074999999999996 25.064999999999998 26.235000000000003 90-94 23.78 25.485000000000003 24.565 26.169999999999998 95-99 24.279999999999998 24.73 25.5 25.490000000000002 100-104 23.849999999999998 25.685000000000002 24.85 25.615 105-109 24.03 25.415 24.654999999999998 25.900000000000002 110-114 23.57 25.455 25.21 25.765 115-119 23.695 25.064999999999998 25.525 25.715 120-124 23.9 25.045 25.419999999999998 25.635 125-129 23.724999999999998 25.52 25.345000000000002 25.41 130-134 23.745 25.575 24.675 26.005 135-139 24.085 25.52 24.355 26.040000000000003 140-144 23.98 25.480000000000004 24.46 26.08 145-149 24.275 25.275 24.104999999999997 26.345000000000002 150-151 23.3 25.587500000000002 24.275 26.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 2.5 28 3.0 29 3.5 30 9.5 31 12.0 32 11.5 33 16.5 34 24.0 35 32.0 36 50.0 37 69.0 38 76.0 39 87.5 40 114.5 41 150.5 42 153.0 43 171.5 44 193.0 45 193.5 46 198.5 47 189.0 48 187.0 49 178.0 50 174.0 51 159.5 52 155.0 53 155.5 54 127.0 55 109.0 56 99.0 57 84.0 58 81.0 59 80.0 60 72.5 61 65.0 62 54.5 63 53.5 64 55.5 65 57.5 66 52.5 67 44.0 68 44.5 69 35.5 70 26.0 71 20.5 72 18.5 73 16.5 74 9.5 75 7.5 76 6.0 77 3.0 78 2.0 79 2.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.775 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.75837128315028 87.5 2 5.491561746584517 10.25 3 0.6161264398607018 1.725 4 0.10715242432360034 0.4 5 0.026788106080900084 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGCCAACTTCGTGGGTGTTGTTTGGTAGAAGTTATAACAGGTCCGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.1125 0.0 0.0 0.0 0.0 130-131 4.675000000000001 0.0 0.0 0.0 0.0 132-133 4.95 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.6375 0.0 0.0 0.0 0.0 138-139 6.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAGGA 10 0.006830828 145.0 1 TCACATA 10 0.006830828 145.0 2 >>END_MODULE SRR12949790 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949790_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.264 37.0 37.0 37.0 37.0 37.0 2 36.117 37.0 37.0 37.0 37.0 37.0 3 36.2425 37.0 37.0 37.0 37.0 37.0 4 36.2995 37.0 37.0 37.0 37.0 37.0 5 36.3305 37.0 37.0 37.0 37.0 37.0 6 36.091 37.0 37.0 37.0 37.0 37.0 7 36.2515 37.0 37.0 37.0 37.0 37.0 8 36.398 37.0 37.0 37.0 37.0 37.0 9 36.324 37.0 37.0 37.0 37.0 37.0 10-14 36.2743 37.0 37.0 37.0 37.0 37.0 15-19 36.2445 37.0 37.0 37.0 37.0 37.0 20-24 36.2679 37.0 37.0 37.0 37.0 37.0 25-29 36.1554 37.0 37.0 37.0 37.0 37.0 30-34 36.095800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0981 37.0 37.0 37.0 37.0 37.0 40-44 36.069500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0868 37.0 37.0 37.0 37.0 37.0 50-54 36.054199999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.004 37.0 37.0 37.0 37.0 37.0 60-64 36.002399999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.9821 37.0 37.0 37.0 37.0 37.0 70-74 35.97 37.0 37.0 37.0 37.0 37.0 75-79 35.954899999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.900400000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8698 37.0 37.0 37.0 37.0 37.0 90-94 35.897499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8416 37.0 37.0 37.0 37.0 37.0 100-104 35.8013 37.0 37.0 37.0 37.0 37.0 105-109 35.8037 37.0 37.0 37.0 37.0 37.0 110-114 35.820499999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.706 37.0 37.0 37.0 37.0 37.0 120-124 35.6582 37.0 37.0 37.0 37.0 37.0 125-129 35.6646 37.0 37.0 37.0 37.0 37.0 130-134 35.655 37.0 37.0 37.0 37.0 37.0 135-139 35.6205 37.0 37.0 37.0 37.0 37.0 140-144 35.6539 37.0 37.0 37.0 37.0 37.0 145-149 35.43249999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.126999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 9.0 15 7.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 2.0 23 8.0 24 7.0 25 5.0 26 7.0 27 13.0 28 9.0 29 16.0 30 23.0 31 42.0 32 53.0 33 99.0 34 187.0 35 491.0 36 2594.0 37 418.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.325 18.224999999999998 10.075000000000001 28.375 2 31.65 21.7 25.85 20.8 3 23.974999999999998 24.25 29.7 22.075 4 26.724999999999998 28.425 20.375 24.474999999999998 5 29.2 31.900000000000002 19.0 19.900000000000002 6 23.65 36.625 18.9 20.825 7 23.95 18.75 34.4 22.900000000000002 8 23.549999999999997 23.825 24.099999999999998 28.525 9 24.675 22.75 26.974999999999998 25.6 10-14 26.125 25.374999999999996 23.415 25.085 15-19 26.205000000000002 24.88 24.235 24.68 20-24 26.029999999999998 24.805 23.76 25.405 25-29 26.05 25.259999999999998 24.169999999999998 24.52 30-34 26.314999999999998 24.58 24.94 24.165 35-39 26.015 24.875 24.43 24.68 40-44 25.94 25.314999999999998 23.74 25.005 45-49 25.990000000000002 25.255 24.595 24.16 50-54 25.874999999999996 25.419999999999998 24.154999999999998 24.55 55-59 25.825 25.480000000000004 24.44 24.255 60-64 26.195 25.35 24.095 24.36 65-69 27.015 25.09 23.45 24.445 70-74 26.729999999999997 24.98 24.525 23.765 75-79 26.565 25.4 24.115000000000002 23.919999999999998 80-84 26.810000000000002 25.369999999999997 24.09 23.73 85-89 25.795 25.424999999999997 24.224999999999998 24.555 90-94 26.99 24.685000000000002 24.15 24.175 95-99 26.76 25.485000000000003 24.195 23.56 100-104 26.545 25.080000000000002 24.075 24.3 105-109 27.0 24.58 24.695 23.724999999999998 110-114 27.0 25.44 24.15 23.41 115-119 26.119999999999997 25.624999999999996 24.69 23.565 120-124 27.025 25.645 23.925 23.405 125-129 27.295 25.665 24.19 22.85 130-134 27.134999999999998 25.545 24.224999999999998 23.095 135-139 27.810000000000002 25.6 24.095 22.495 140-144 27.450000000000003 26.275 23.515 22.759999999999998 145-149 27.73 26.075 23.78 22.415 150-151 27.1375 26.125 24.825 21.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 1.5 27 1.5 28 2.0 29 4.0 30 3.5 31 4.5 32 8.0 33 11.0 34 15.5 35 27.0 36 41.5 37 53.5 38 72.0 39 87.5 40 102.5 41 126.5 42 147.0 43 159.0 44 189.0 45 199.5 46 185.0 47 177.0 48 170.5 49 173.0 50 166.5 51 149.5 52 137.0 53 127.5 54 113.5 55 104.5 56 99.0 57 96.5 58 93.0 59 93.0 60 97.5 61 89.5 62 73.5 63 66.0 64 62.0 65 61.0 66 63.5 67 60.5 68 52.5 69 38.5 70 37.0 71 31.0 72 21.0 73 20.0 74 16.0 75 15.5 76 10.5 77 3.0 78 2.0 79 3.5 80 2.0 81 0.5 82 0.0 83 1.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 1.0 96 1.5 97 0.5 98 1.0 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.97912764249398 87.8 2 5.244848809205245 9.8 3 0.6422263848006422 1.7999999999999998 4 0.08027829810008028 0.3 5 0.02675943270002676 0.125 6 0.0 0.0 7 0.02675943270002676 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GCCTCATACTCAACAATTACATTCGGTGCTATGGGAGATAGCTTTTACGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.737500000000001 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.7125 0.0 0.0 0.0 0.0 138-139 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCATG 10 0.006830828 145.0 7 GATCAAA 10 0.006830828 145.0 5 GGGGGGG 35 0.0035366106 20.714287 130-134 >>END_MODULE Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338674 spots for SRR12949790.sra Written 1338674 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra Read 1338671 spots for SRR12949790.sra Written 1338671 spots for SRR12949790.sra SRR ids: ['SRR12949790.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0u5szcpb SRR12949790.sra spots: 26773423 blocks: [[1, 1338671], [1338672, 2677342], [2677343, 4016013], [4016014, 5354684], [5354685, 6693355], [6693356, 8032026], [8032027, 9370697], [9370698, 10709368], [10709369, 12048039], [12048040, 13386710], [13386711, 14725381], [14725382, 16064052], [16064053, 17402723], [17402724, 18741394], [18741395, 20080065], [20080066, 21418736], [21418737, 22757407], [22757408, 24096078], [24096079, 25434749], [25434750, 26773423]] SRR12949790 file size 9077080 SRR12949790 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949790 SRR12949790_1.fastq SRR12949790_2.fastq Input file: SRR12949790_1.fastq Paired file: SRR12949790_2.fastq trimmed: SRR12949790-trimmed-pair1.fastq, SRR12949790-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:10:54 2024 >> started Sat Dec 7 10:11:37 2024 >> done (42.533s) 26773423 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 5394 ( 0.02%) empty read pairs filtered out after trimming by size control 26767902 (99.98%) read pairs available; of these: 2541649 ( 9.50%) trimmed read pairs available after processing 24226253 (90.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 16 0.00% 21 18 0.00% 22 10 0.00% 23 19 0.00% 24 22 0.00% 25 23 0.00% 26 30 0.00% 27 25 0.00% 28 29 0.00% 29 36 0.00% 30 22 0.00% 31 25 0.00% 32 31 0.00% 33 43 0.00% 34 41 0.00% 35 39 0.00% 36 58 0.00% 37 54 0.00% 38 60 0.00% 39 48 0.00% 40 56 0.00% 41 48 0.00% 42 65 0.00% 43 54 0.00% 44 50 0.00% 45 87 0.00% 46 80 0.00% 47 76 0.00% 48 102 0.00% 49 86 0.00% 50 139 0.00% 51 143 0.00% 52 168 0.00% 53 165 0.00% 54 156 0.00% 55 169 0.00% 56 220 0.00% 57 254 0.00% 58 295 0.00% 59 305 0.00% 60 351 0.00% 61 380 0.00% 62 438 0.00% 63 519 0.00% 64 589 0.00% 65 655 0.00% 66 741 0.00% 67 847 0.00% 68 915 0.00% 69 1074 0.00% 70 1171 0.00% 71 1362 0.01% 72 1615 0.01% 73 1851 0.01% 74 2070 0.01% 75 2261 0.01% 76 2544 0.01% 77 2843 0.01% 78 3179 0.01% 79 3588 0.01% 80 3812 0.01% 81 4263 0.02% 82 4740 0.02% 83 5214 0.02% 84 5694 0.02% 85 6427 0.02% 86 6939 0.03% 87 7426 0.03% 88 7869 0.03% 89 8474 0.03% 90 9153 0.03% 91 9652 0.04% 92 10424 0.04% 93 11147 0.04% 94 12062 0.05% 95 13035 0.05% 96 13894 0.05% 97 14891 0.06% 98 15626 0.06% 99 16288 0.06% 100 17101 0.06% 101 17815 0.07% 102 18592 0.07% 103 19900 0.07% 104 20490 0.08% 105 21473 0.08% 106 22528 0.08% 107 23644 0.09% 108 24672 0.09% 109 25790 0.10% 110 26546 0.10% 111 27891 0.10% 112 28884 0.11% 113 29554 0.11% 114 30682 0.11% 115 32060 0.12% 116 33621 0.13% 117 34953 0.13% 118 36154 0.14% 119 37270 0.14% 120 38409 0.14% 121 40160 0.15% 122 40664 0.15% 123 41772 0.16% 124 43603 0.16% 125 44367 0.17% 126 45751 0.17% 127 47642 0.18% 128 48511 0.18% 129 50065 0.19% 130 51833 0.19% 131 52407 0.20% 132 53946 0.20% 133 55421 0.21% 134 56342 0.21% 135 57482 0.21% 136 59438 0.22% 137 60406 0.23% 138 61799 0.23% 139 64154 0.24% 140 64295 0.24% 141 66329 0.25% 142 67990 0.25% 143 67971 0.25% 144 69829 0.26% 145 71042 0.27% 146 71166 0.27% 147 72682 0.27% 148 74397 0.28% 149 75771 0.28% 150 76974 0.29% 151 24226253 90.50% 26767902 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=3.4 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=1446.67 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=28.7 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=31 prefix-density=0.44 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=275.05 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=21.2 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR12949790 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:12:18 Started mapping on | Dec 07 10:12:18 Finished on | Dec 07 10:14:42 Mapping speed, Million of reads per hour | 669.20 Number of input reads | 26767902 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 25675681 Uniquely mapped reads % | 95.92% Average mapped length | 296.63 Number of splices: Total | 26983919 Number of splices: Annotated (sjdb) | 25211807 Number of splices: GT/AG | 26618870 Number of splices: GC/AG | 318054 Number of splices: AT/AC | 18878 Number of splices: Non-canonical | 28117 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284308 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 54817 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 807913 807913 807913 N_multimapping 284308 284308 284308 N_noFeature 908023 25053799 1108590 N_ambiguous 491232 3688 71003 UnstrandedReadsAssigned:24276426 PositiveStrandReadsAssigned:618194 NegativeStrandReadsAssigned:24496088 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949790 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949790-trimmed-pair1.fastq SRR12949790-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,767,902 reads, 24,849,568 reads pseudoaligned [quant] estimated average fragment length: 290.826 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,299 rounds 52973 SRR12949790.ke.tsv 35125 SRR12949790.se.tsv 88098 total ==> SRR12949790.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 647.052 0 0 PNS24247 1044 754.174 95.8675 7.86535 PNS24249 1928 1638.17 158.14 5.97311 PNS24246 1044 754.174 95.8675 7.86535 PNS24248 1044 754.174 95.8675 7.86535 PNS24244 1471 1181.17 169.257 8.8665 PNS24243 293 94.8244 0 0 KQK14069 1603 1313.17 13266.6 625.108 KQK14071 474 223.882 170.886 47.2288 ==> SRR12949790.se.tsv <== BRADI_1g14170v3 14640 BRADI_1g53295v3 134 BRADI_1g59795v3 601 BRADI_1g07683v3 0 BRADI_1g00485v3 71 BRADI_1g20270v3 1053 BRADI_1g74790v3 59 BRADI_1g09890v3 0 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR12949790 completed mapping pipeline successfully