Starting /dee2/code/volunteer_pipeline.sh SRR12949792 current disk space = 1543828111360 free memory = 1605772316 SRR12949792 SRAfilesize 031a733a10634fc94b9e6ec8fce83a6e SRR12949792.sra SRR12949792.sra file validated SRR12949792 is paired end SRR12949792 is conventional basespace SRR12949792 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949792_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.585 37.0 37.0 37.0 37.0 37.0 2 36.03775 37.0 37.0 37.0 37.0 37.0 3 36.5915 37.0 37.0 37.0 37.0 37.0 4 36.638 37.0 37.0 37.0 37.0 37.0 5 36.6685 37.0 37.0 37.0 37.0 37.0 6 36.611 37.0 37.0 37.0 37.0 37.0 7 36.5265 37.0 37.0 37.0 37.0 37.0 8 36.692 37.0 37.0 37.0 37.0 37.0 9 36.6605 37.0 37.0 37.0 37.0 37.0 10-14 36.649 37.0 37.0 37.0 37.0 37.0 15-19 36.669 37.0 37.0 37.0 37.0 37.0 20-24 36.6185 37.0 37.0 37.0 37.0 37.0 25-29 36.5778 37.0 37.0 37.0 37.0 37.0 30-34 36.570299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5484 37.0 37.0 37.0 37.0 37.0 40-44 36.5158 37.0 37.0 37.0 37.0 37.0 45-49 36.4908 37.0 37.0 37.0 37.0 37.0 50-54 36.404399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.4683 37.0 37.0 37.0 37.0 37.0 60-64 36.382000000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3282 37.0 37.0 37.0 37.0 37.0 70-74 36.3502 37.0 37.0 37.0 37.0 37.0 75-79 36.346199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.296099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2825 37.0 37.0 37.0 37.0 37.0 90-94 36.261199999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.287400000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2454 37.0 37.0 37.0 37.0 37.0 105-109 36.180899999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.1605 37.0 37.0 37.0 37.0 37.0 115-119 36.1311 37.0 37.0 37.0 37.0 37.0 120-124 36.1591 37.0 37.0 37.0 37.0 37.0 125-129 36.0731 37.0 37.0 37.0 37.0 37.0 130-134 36.062400000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.0075 37.0 37.0 37.0 37.0 37.0 140-144 35.8343 37.0 37.0 37.0 37.0 37.0 145-149 35.8621 37.0 37.0 37.0 37.0 37.0 150-151 35.64975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 4.0 25 4.0 26 3.0 27 8.0 28 5.0 29 20.0 30 20.0 31 37.0 32 44.0 33 74.0 34 112.0 35 271.0 36 2829.0 37 567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 58.95 9.975000000000001 3.775 27.3 2 23.57846853677028 8.112206216830932 33.38387667424817 34.92544857215062 3 20.7 15.575 26.6 37.125 4 28.1 20.275000000000002 22.175 29.45 5 27.750000000000004 25.95 23.0 23.3 6 24.625 30.099999999999998 22.375 22.900000000000002 7 19.925 24.6 37.6 17.875 8 20.225 23.125 30.275000000000002 26.375 9 21.525 20.724999999999998 32.95 24.8 10-14 23.135 26.155 25.919999999999998 24.79 15-19 23.125 24.89 26.1 25.885 20-24 23.41 25.064999999999998 25.474999999999998 26.05 25-29 23.51 25.115 25.64 25.735000000000003 30-34 23.5 24.990000000000002 25.69 25.82 35-39 23.72 24.97 25.705 25.605 40-44 23.505000000000003 24.965 25.345000000000002 26.185000000000002 45-49 23.445 24.94 25.745 25.869999999999997 50-54 23.615 25.6 24.985 25.8 55-59 23.195 24.86 25.314999999999998 26.63 60-64 23.669999999999998 24.92 25.15 26.26 65-69 23.375 25.61 25.259999999999998 25.755 70-74 23.97 24.86 25.035 26.135 75-79 24.025 25.124999999999996 25.205 25.645 80-84 24.26 24.88 25.290000000000003 25.569999999999997 85-89 23.810000000000002 24.725 25.145 26.32 90-94 23.995 24.735 25.485000000000003 25.785000000000004 95-99 24.044999999999998 24.785 25.71 25.46 100-104 24.21 24.385 25.525 25.88 105-109 23.830000000000002 24.73 25.525 25.915 110-114 24.495 25.205 24.84 25.46 115-119 23.885 24.709999999999997 25.205 26.200000000000003 120-124 24.08 25.180000000000003 24.755 25.985000000000003 125-129 24.585 24.695 24.895 25.825 130-134 24.395 24.675 24.52 26.41 135-139 24.69 25.135 24.75 25.424999999999997 140-144 25.195 24.77 24.325 25.71 145-149 24.7 25.264999999999997 24.23 25.805 150-151 25.1 24.5625 24.175 26.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.0 28 3.5 29 7.0 30 7.0 31 6.5 32 15.0 33 20.5 34 22.0 35 32.5 36 40.5 37 49.5 38 65.5 39 78.0 40 103.0 41 150.0 42 177.0 43 178.0 44 169.5 45 186.5 46 203.0 47 195.5 48 190.0 49 170.0 50 171.0 51 162.0 52 140.0 53 124.0 54 101.0 55 101.0 56 116.0 57 101.0 58 81.0 59 86.5 60 79.5 61 72.0 62 71.0 63 69.5 64 70.0 65 65.5 66 63.0 67 55.0 68 44.0 69 39.0 70 30.5 71 21.0 72 14.5 73 11.0 74 10.5 75 7.0 76 3.5 77 4.0 78 2.5 79 0.5 80 0.0 81 0.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.0 #Duplication Level Percentage of deduplicated Percentage of total 1 92.36413043478261 84.975 2 6.711956521739131 12.35 3 0.7880434782608695 2.175 4 0.1358695652173913 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.7750000000000004 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 5.199999999999999 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAAG 10 0.006830828 145.0 9 >>END_MODULE SRR12949792 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949792_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32 37.0 37.0 37.0 37.0 37.0 2 36.013 37.0 37.0 37.0 37.0 37.0 3 36.0185 37.0 37.0 37.0 37.0 37.0 4 36.1135 37.0 37.0 37.0 37.0 37.0 5 36.2635 37.0 37.0 37.0 37.0 37.0 6 36.096 37.0 37.0 37.0 37.0 37.0 7 36.1845 37.0 37.0 37.0 37.0 37.0 8 36.054 37.0 37.0 37.0 37.0 37.0 9 36.038 37.0 37.0 37.0 37.0 37.0 10-14 36.0484 37.0 37.0 37.0 37.0 37.0 15-19 35.91949999999999 37.0 37.0 37.0 37.0 37.0 20-24 35.963 37.0 37.0 37.0 37.0 37.0 25-29 35.8522 37.0 37.0 37.0 37.0 37.0 30-34 35.7661 37.0 37.0 37.0 37.0 37.0 35-39 35.7763 37.0 37.0 37.0 37.0 37.0 40-44 35.7556 37.0 37.0 37.0 37.0 37.0 45-49 35.747 37.0 37.0 37.0 37.0 37.0 50-54 35.7006 37.0 37.0 37.0 37.0 37.0 55-59 35.723 37.0 37.0 37.0 37.0 37.0 60-64 35.7357 37.0 37.0 37.0 37.0 37.0 65-69 35.6802 37.0 37.0 37.0 37.0 37.0 70-74 35.6268 37.0 37.0 37.0 37.0 37.0 75-79 35.5865 37.0 37.0 37.0 37.0 37.0 80-84 35.606 37.0 37.0 37.0 37.0 37.0 85-89 35.549099999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.523300000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.5176 37.0 37.0 37.0 37.0 37.0 100-104 35.5101 37.0 37.0 37.0 37.0 37.0 105-109 35.4997 37.0 37.0 37.0 37.0 37.0 110-114 35.4802 37.0 37.0 37.0 37.0 37.0 115-119 35.396100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.3677 37.0 37.0 37.0 37.0 37.0 125-129 35.318400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.287099999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.2691 37.0 37.0 37.0 37.0 37.0 140-144 35.207 37.0 37.0 37.0 32.2 37.0 145-149 35.1019 37.0 37.0 37.0 29.8 37.0 150-151 34.93325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 15.0 14 12.0 15 12.0 16 11.0 17 6.0 18 4.0 19 2.0 20 7.0 21 13.0 22 10.0 23 12.0 24 11.0 25 12.0 26 10.0 27 12.0 28 9.0 29 11.0 30 23.0 31 29.0 32 43.0 33 84.0 34 179.0 35 432.0 36 2614.0 37 422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.349999999999994 20.974999999999998 6.75 21.925 2 31.275 21.925 25.324999999999996 21.475 3 26.8 21.9 30.099999999999998 21.2 4 29.15 28.65 19.400000000000002 22.8 5 28.325 34.0 17.95 19.725 6 23.95 34.8 18.975 22.275 7 25.874999999999996 19.2 31.85 23.075000000000003 8 25.025 22.975 22.7 29.299999999999997 9 26.0 22.425 25.324999999999996 26.25 10-14 27.205000000000002 25.795 22.585 24.415 15-19 27.155 25.074999999999996 23.485 24.285 20-24 26.985 25.174999999999997 23.465 24.375 25-29 26.5 25.669999999999998 23.22 24.610000000000003 30-34 25.485000000000003 25.195 23.845 25.474999999999998 35-39 26.025 25.324999999999996 24.255 24.395 40-44 26.995 25.155 23.535 24.315 45-49 26.35 25.495 23.625 24.529999999999998 50-54 26.435 25.705 23.56 24.3 55-59 26.85 25.71 23.305 24.135 60-64 26.235000000000003 25.215 23.794999999999998 24.755 65-69 25.855 25.655 23.735 24.755 70-74 26.179999999999996 24.805 24.490000000000002 24.525 75-79 25.945 25.025 23.919999999999998 25.11 80-84 26.640000000000004 24.91 24.41 24.04 85-89 26.119999999999997 26.0 23.465 24.415 90-94 26.205000000000002 25.445 23.474999999999998 24.875 95-99 26.155 25.929999999999996 23.75 24.165 100-104 26.955000000000002 25.88 24.355 22.81 105-109 26.685 25.330000000000002 24.2 23.785 110-114 26.479999999999997 26.14 23.799999999999997 23.580000000000002 115-119 26.634999999999998 25.415 23.565 24.385 120-124 26.540000000000003 25.855 23.515 24.09 125-129 26.825 26.575 23.155 23.445 130-134 26.935 26.47 23.26 23.335 135-139 26.52 25.729999999999997 24.115000000000002 23.635 140-144 27.765 26.185000000000002 23.385 22.665 145-149 27.88 26.495 23.46 22.165000000000003 150-151 27.6875 27.3 23.075000000000003 21.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 1.5 10 1.5 11 1.0 12 1.5 13 1.5 14 2.5 15 2.0 16 2.0 17 3.5 18 2.0 19 0.5 20 1.5 21 1.5 22 1.0 23 3.5 24 3.0 25 1.0 26 1.5 27 3.5 28 4.0 29 2.0 30 4.5 31 8.0 32 11.0 33 16.0 34 17.5 35 27.5 36 37.5 37 36.5 38 57.5 39 83.5 40 103.5 41 120.5 42 140.5 43 163.0 44 175.0 45 174.5 46 172.0 47 165.5 48 160.5 49 162.0 50 152.5 51 145.5 52 136.0 53 131.5 54 125.5 55 106.0 56 99.5 57 93.5 58 86.5 59 103.0 60 108.0 61 97.5 62 99.0 63 93.5 64 88.5 65 77.0 66 61.0 67 58.0 68 51.0 69 42.5 70 35.0 71 26.5 72 20.0 73 18.0 74 12.0 75 5.0 76 3.5 77 4.0 78 3.5 79 3.0 80 1.5 81 0.5 82 1.5 83 2.0 84 1.5 85 1.5 86 1.0 87 0.0 88 0.0 89 2.0 90 3.0 91 1.0 92 0.5 93 0.5 94 0.5 95 1.5 96 1.5 97 1.5 98 2.0 99 2.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.58046917621385 84.85000000000001 2 6.46481178396072 11.85 3 0.7910529187124932 2.175 4 0.05455537370430987 0.2 5 0.027277686852154936 0.125 6 0.027277686852154936 0.15 7 0.0 0.0 8 0.027277686852154936 0.2 9 0.0 0.0 >10 0.027277686852154936 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 8 0.2 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit CGGAAGCAGAGGAACAGCGTGTGGTTCAACAAGCCCGTGGACGTCGAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.0250000000000004 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.7125000000000004 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 5.15 0.0 0.0 0.0 0.0 132-133 5.6625 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.7625 0.0 0.0 0.0 0.0 138-139 7.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATATCC 10 0.006830828 145.0 5 >>END_MODULE Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888033 spots for SRR12949792.sra Written 1888033 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra Read 1888025 spots for SRR12949792.sra Written 1888025 spots for SRR12949792.sra SRR ids: ['SRR12949792.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0yt4906u SRR12949792.sra spots: 37760508 blocks: [[1, 1888025], [1888026, 3776050], [3776051, 5664075], [5664076, 7552100], [7552101, 9440125], [9440126, 11328150], [11328151, 13216175], [13216176, 15104200], [15104201, 16992225], [16992226, 18880250], [18880251, 20768275], [20768276, 22656300], [22656301, 24544325], [24544326, 26432350], [26432351, 28320375], [28320376, 30208400], [30208401, 32096425], [32096426, 33984450], [33984451, 35872475], [35872476, 37760508]] SRR12949792 file size 12810972 SRR12949792 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949792 SRR12949792_1.fastq SRR12949792_2.fastq Input file: SRR12949792_1.fastq Paired file: SRR12949792_2.fastq trimmed: SRR12949792-trimmed-pair1.fastq, SRR12949792-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:17:57 2024 >> started Sat Dec 7 10:18:43 2024 >> done (45.991s) 37760508 read pairs processed; of these: 236 ( 0.00%) short read pairs filtered out after trimming by size control 25867 ( 0.07%) empty read pairs filtered out after trimming by size control 37734405 (99.93%) read pairs available; of these: 4073299 (10.79%) trimmed read pairs available after processing 33661106 (89.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 26 0.00% 20 20 0.00% 21 21 0.00% 22 30 0.00% 23 35 0.00% 24 25 0.00% 25 40 0.00% 26 53 0.00% 27 47 0.00% 28 49 0.00% 29 51 0.00% 30 53 0.00% 31 55 0.00% 32 58 0.00% 33 70 0.00% 34 60 0.00% 35 66 0.00% 36 70 0.00% 37 82 0.00% 38 79 0.00% 39 74 0.00% 40 80 0.00% 41 112 0.00% 42 119 0.00% 43 115 0.00% 44 119 0.00% 45 127 0.00% 46 150 0.00% 47 176 0.00% 48 196 0.00% 49 236 0.00% 50 264 0.00% 51 314 0.00% 52 335 0.00% 53 361 0.00% 54 369 0.00% 55 457 0.00% 56 507 0.00% 57 583 0.00% 58 730 0.00% 59 759 0.00% 60 967 0.00% 61 1075 0.00% 62 1338 0.00% 63 1414 0.00% 64 1624 0.00% 65 1791 0.00% 66 2112 0.01% 67 2201 0.01% 68 2554 0.01% 69 2941 0.01% 70 3251 0.01% 71 3692 0.01% 72 4291 0.01% 73 4837 0.01% 74 5439 0.01% 75 6105 0.02% 76 6546 0.02% 77 6923 0.02% 78 7719 0.02% 79 8368 0.02% 80 9030 0.02% 81 9799 0.03% 82 10693 0.03% 83 11723 0.03% 84 12600 0.03% 85 13601 0.04% 86 14435 0.04% 87 15350 0.04% 88 16188 0.04% 89 16666 0.04% 90 17867 0.05% 91 18996 0.05% 92 20085 0.05% 93 21032 0.06% 94 22439 0.06% 95 23798 0.06% 96 25071 0.07% 97 26532 0.07% 98 27314 0.07% 99 28900 0.08% 100 29332 0.08% 101 30782 0.08% 102 32415 0.09% 103 33399 0.09% 104 34961 0.09% 105 36398 0.10% 106 37979 0.10% 107 39433 0.10% 108 41055 0.11% 109 43052 0.11% 110 43826 0.12% 111 45724 0.12% 112 47623 0.13% 113 48364 0.13% 114 51267 0.14% 115 52913 0.14% 116 54512 0.14% 117 57031 0.15% 118 58203 0.15% 119 59799 0.16% 120 62933 0.17% 121 62882 0.17% 122 63704 0.17% 123 66350 0.18% 124 68522 0.18% 125 70483 0.19% 126 72591 0.19% 127 74273 0.20% 128 76508 0.20% 129 79440 0.21% 130 79750 0.21% 131 80422 0.21% 132 83569 0.22% 133 85736 0.23% 134 85571 0.23% 135 89533 0.24% 136 90160 0.24% 137 90954 0.24% 138 92212 0.24% 139 96670 0.26% 140 97527 0.26% 141 99135 0.26% 142 101608 0.27% 143 103476 0.27% 144 105895 0.28% 145 106598 0.28% 146 108826 0.29% 147 114212 0.30% 148 112443 0.30% 149 114143 0.30% 150 114612 0.30% 151 33661106 89.21% 37734405 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=17 prefix-density=0.96 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=12.80 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.1 sequence=CCGAGCGGGTCGAATGGGCCACCGGGGTGGAGCTTGTCCTCAAGATCAAGGCCGTTGATGATCCTGTAGTACTCGGCGCCTCCGACGAGGACAACCTCGGCGACGACGGCGAGGATGAGGTTGATGGGGATGCTGTTGCCGAAGTAGTTGAGGGTGTTGCCGTCCAGGAGAAGAGCGCCGGTCTTGAACCAGACGGCCTCGGGACCGCAGTTGGCGCCGAACTTGTTGCACGCCTCGGGGATGATGAAGCCGGCAGCGCCGAGCATGGCCCATCTGGCATGGATCAGCTCATAGGCCTGGTACTTGGTGAAGTCATCTGGCTTCTTGCTCAGACCGAAAGGATCATAGCCATAGTCTCCAGGAACCTCTCCGTTGAGGTACTC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=18 prefix-density=0.68 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=71.15 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.3 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR12949792 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:19:22 Started mapping on | Dec 07 10:19:23 Finished on | Dec 07 10:22:40 Mapping speed, Million of reads per hour | 689.56 Number of input reads | 37734405 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 35340887 Uniquely mapped reads % | 93.66% Average mapped length | 295.49 Number of splices: Total | 36220109 Number of splices: Annotated (sjdb) | 34106775 Number of splices: GT/AG | 35735899 Number of splices: GC/AG | 432461 Number of splices: AT/AC | 12395 Number of splices: Non-canonical | 39354 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 506612 % of reads mapped to multiple loci | 1.34% Number of reads mapped to too many loci | 79703 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 1.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1886906 1886906 1886906 N_multimapping 506612 506612 506612 N_noFeature 1510756 34314207 1787801 N_ambiguous 886786 5167 139254 UnstrandedReadsAssigned:32943345 PositiveStrandReadsAssigned:1021513 NegativeStrandReadsAssigned:33413832 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949792 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949792-trimmed-pair1.fastq SRR12949792-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,734,405 reads, 34,119,826 reads pseudoaligned [quant] estimated average fragment length: 282.01 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR12949792.ke.tsv 35125 SRR12949792.se.tsv 88098 total ==> SRR12949792.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 655.88 0 0 PNS24247 1044 762.99 78.2224 4.34237 PNS24249 1928 1646.99 55.6084 1.43009 PNS24246 1044 762.99 78.2224 4.34237 PNS24248 1044 762.99 78.2224 4.34237 PNS24244 1471 1189.99 229.724 8.1767 PNS24243 293 98.4833 0 0 KQK14069 1603 1321.99 2706.07 86.7013 KQK14071 474 229.391 79.6139 14.7003 ==> SRR12949792.se.tsv <== BRADI_1g14170v3 3565 BRADI_1g53295v3 138 BRADI_1g59795v3 918 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 663 BRADI_1g74790v3 187 BRADI_1g09890v3 0 BRADI_1g77505v3 268 BRADI_1g48960v3 0 SRR12949792 completed mapping pipeline successfully