Starting /dee2/code/volunteer_pipeline.sh SRR12949793 current disk space = 1543829839872 free memory = 1598948060 SRR12949793 SRAfilesize 4e4f2f2db62b061d65d2ad4f25dec7f7 SRR12949793.sra SRR12949793.sra file validated SRR12949793 is paired end SRR12949793 is conventional basespace SRR12949793 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949793_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.577 37.0 37.0 37.0 37.0 37.0 2 35.96625 37.0 37.0 37.0 37.0 37.0 3 36.4325 37.0 37.0 37.0 37.0 37.0 4 36.623 37.0 37.0 37.0 37.0 37.0 5 36.544 37.0 37.0 37.0 37.0 37.0 6 36.6 37.0 37.0 37.0 37.0 37.0 7 36.496 37.0 37.0 37.0 37.0 37.0 8 36.5915 37.0 37.0 37.0 37.0 37.0 9 36.5935 37.0 37.0 37.0 37.0 37.0 10-14 36.64620000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6056 37.0 37.0 37.0 37.0 37.0 20-24 36.563599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.563199999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5364 37.0 37.0 37.0 37.0 37.0 35-39 36.5775 37.0 37.0 37.0 37.0 37.0 40-44 36.50170000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4827 37.0 37.0 37.0 37.0 37.0 50-54 36.4144 37.0 37.0 37.0 37.0 37.0 55-59 36.477199999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3947 37.0 37.0 37.0 37.0 37.0 65-69 36.3679 37.0 37.0 37.0 37.0 37.0 70-74 36.3654 37.0 37.0 37.0 37.0 37.0 75-79 36.338100000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3291 37.0 37.0 37.0 37.0 37.0 85-89 36.294 37.0 37.0 37.0 37.0 37.0 90-94 36.297900000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.2701 37.0 37.0 37.0 37.0 37.0 100-104 36.2378 37.0 37.0 37.0 37.0 37.0 105-109 36.1674 37.0 37.0 37.0 37.0 37.0 110-114 36.131299999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0925 37.0 37.0 37.0 37.0 37.0 120-124 36.03189999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.0184 37.0 37.0 37.0 37.0 37.0 130-134 35.9735 37.0 37.0 37.0 37.0 37.0 135-139 36.0019 37.0 37.0 37.0 37.0 37.0 140-144 35.8609 37.0 37.0 37.0 37.0 37.0 145-149 35.8115 37.0 37.0 37.0 37.0 37.0 150-151 35.699250000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 0.0 25 2.0 26 6.0 27 9.0 28 7.0 29 16.0 30 23.0 31 25.0 32 46.0 33 85.0 34 128.0 35 290.0 36 2778.0 37 582.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.525000000000006 10.375 3.875 29.225 2 24.224072672218018 9.28589452435024 33.45950037850113 33.030532424930605 3 21.95 14.75 25.174999999999997 38.125 4 29.625 19.400000000000002 20.3 30.675 5 28.050000000000004 25.4 23.05 23.5 6 24.65 29.45 21.625 24.275 7 20.0 24.7 36.35 18.95 8 20.674999999999997 23.1 30.099999999999998 26.125 9 21.15 19.85 33.625 25.374999999999996 10-14 24.29 24.990000000000002 25.27 25.45 15-19 24.205 24.275 24.905 26.615 20-24 24.985 24.195 25.245 25.575 25-29 24.69 24.265 24.68 26.365 30-34 24.955 24.055 24.68 26.31 35-39 24.535 24.165 24.925 26.375 40-44 25.16 24.884999999999998 23.830000000000002 26.125 45-49 24.95 23.71 24.185000000000002 27.155 50-54 25.105 24.0 24.29 26.605 55-59 24.865000000000002 24.425 24.275 26.435 60-64 24.834999999999997 23.794999999999998 24.05 27.32 65-69 24.91 24.57 24.75 25.77 70-74 24.82 24.67 24.035 26.474999999999998 75-79 25.14 24.055 24.115000000000002 26.69 80-84 24.66 24.215 24.47 26.655 85-89 25.485000000000003 24.21 23.945 26.36 90-94 25.424999999999997 24.25 24.13 26.195 95-99 24.805 24.005000000000003 24.345 26.845000000000002 100-104 24.985 24.39 23.56 27.065 105-109 25.885 24.195 23.905 26.015 110-114 24.34 24.04 23.985 27.634999999999998 115-119 25.240000000000002 23.849999999999998 24.135 26.775 120-124 24.8 23.995 24.51 26.695 125-129 24.21 24.005000000000003 24.345 27.439999999999998 130-134 25.21 23.93 23.799999999999997 27.060000000000002 135-139 25.145 24.095 23.91 26.85 140-144 25.465 23.630000000000003 24.154999999999998 26.75 145-149 25.235000000000003 23.855 24.345 26.565 150-151 24.224999999999998 24.325 24.087500000000002 27.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 2.0 28 5.0 29 7.5 30 8.5 31 11.0 32 16.0 33 20.5 34 21.0 35 30.0 36 35.0 37 48.0 38 64.5 39 75.0 40 93.0 41 114.5 42 140.5 43 157.5 44 164.0 45 167.5 46 165.0 47 161.0 48 166.0 49 158.5 50 140.5 51 131.5 52 122.0 53 114.5 54 105.5 55 104.0 56 108.0 57 102.0 58 92.0 59 89.5 60 93.0 61 97.0 62 99.0 63 92.0 64 93.0 65 94.0 66 91.5 67 75.5 68 56.5 69 56.5 70 50.0 71 37.5 72 28.0 73 25.0 74 23.0 75 19.0 76 12.0 77 3.5 78 2.0 79 2.0 80 2.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.9249999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.29599121361889 83.125 2 7.797913234486546 14.2 3 0.7962657880285557 2.175 4 0.0 0.0 5 0.10982976386600769 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAA 5 0.125 No Hit GGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGAC 5 0.125 No Hit GCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAG 5 0.125 No Hit GTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.15 0.0 0.0 0.0 0.0 110-111 2.4000000000000004 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.5250000000000004 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.612500000000001 0.0 0.0 0.0 0.0 130-131 4.925000000000001 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 5.987500000000001 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12949793 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949793_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1345 37.0 37.0 37.0 37.0 37.0 2 36.1965 37.0 37.0 37.0 37.0 37.0 3 36.3065 37.0 37.0 37.0 37.0 37.0 4 36.148 37.0 37.0 37.0 37.0 37.0 5 36.332 37.0 37.0 37.0 37.0 37.0 6 36.202 37.0 37.0 37.0 37.0 37.0 7 36.18 37.0 37.0 37.0 37.0 37.0 8 36.2945 37.0 37.0 37.0 37.0 37.0 9 36.1375 37.0 37.0 37.0 37.0 37.0 10-14 36.281699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.1981 37.0 37.0 37.0 37.0 37.0 20-24 36.1752 37.0 37.0 37.0 37.0 37.0 25-29 36.1292 37.0 37.0 37.0 37.0 37.0 30-34 36.062 37.0 37.0 37.0 37.0 37.0 35-39 36.103699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.012499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.062 37.0 37.0 37.0 37.0 37.0 50-54 35.988099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0155 37.0 37.0 37.0 37.0 37.0 60-64 35.995400000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9669 37.0 37.0 37.0 37.0 37.0 70-74 35.9767 37.0 37.0 37.0 37.0 37.0 75-79 35.916 37.0 37.0 37.0 37.0 37.0 80-84 35.851600000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8942 37.0 37.0 37.0 37.0 37.0 90-94 35.8262 37.0 37.0 37.0 37.0 37.0 95-99 35.8655 37.0 37.0 37.0 37.0 37.0 100-104 35.735400000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.757000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.712900000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.691700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5735 37.0 37.0 37.0 37.0 37.0 125-129 35.6293 37.0 37.0 37.0 37.0 37.0 130-134 35.5388 37.0 37.0 37.0 37.0 37.0 135-139 35.5019 37.0 37.0 37.0 37.0 37.0 140-144 35.4114 37.0 37.0 37.0 34.6 37.0 145-149 35.327299999999994 37.0 37.0 37.0 34.6 37.0 150-151 35.091499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 8.0 14 4.0 15 7.0 16 2.0 17 1.0 18 3.0 19 2.0 20 9.0 21 2.0 22 4.0 23 7.0 24 9.0 25 5.0 26 5.0 27 12.0 28 10.0 29 18.0 30 24.0 31 38.0 32 57.0 33 74.0 34 169.0 35 471.0 36 2620.0 37 435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.9 19.375 6.525 26.200000000000003 2 31.125000000000004 20.925 26.55 21.4 3 23.9 22.75 30.15 23.200000000000003 4 27.725 29.975 18.95 23.35 5 30.599999999999998 31.374999999999996 17.45 20.575 6 22.6 36.775000000000006 17.025000000000002 23.599999999999998 7 24.65 19.475 32.675 23.200000000000003 8 25.650000000000002 21.925 23.625 28.799999999999997 9 25.35 21.45 26.6 26.6 10-14 26.805 24.085 22.335 26.775 15-19 26.540000000000003 23.855 23.25 26.355 20-24 27.034999999999997 24.235 22.585 26.145000000000003 25-29 26.284999999999997 23.835 22.634999999999998 27.245 30-34 26.619999999999997 24.375 23.45 25.555 35-39 26.169999999999998 24.310000000000002 22.98 26.540000000000003 40-44 26.825 23.695 23.169999999999998 26.31 45-49 26.87 24.529999999999998 22.689999999999998 25.91 50-54 27.395000000000003 23.865 22.605 26.135 55-59 27.54 23.830000000000002 22.74 25.89 60-64 27.115000000000002 23.325000000000003 23.13 26.43 65-69 27.37 24.015 22.715 25.900000000000002 70-74 27.3 23.24 22.91 26.55 75-79 27.375 23.810000000000002 23.064999999999998 25.75 80-84 27.605 23.674999999999997 23.375 25.345000000000002 85-89 27.63 24.099999999999998 21.935 26.334999999999997 90-94 27.24 23.880000000000003 22.945 25.935000000000002 95-99 26.915 23.615 23.135 26.334999999999997 100-104 26.96 24.42 22.905 25.715 105-109 27.055 24.425 22.759999999999998 25.759999999999998 110-114 27.38 24.93 22.21 25.480000000000004 115-119 27.644999999999996 24.535 22.485 25.335 120-124 27.61 24.169999999999998 23.05 25.169999999999998 125-129 28.255000000000003 23.805 22.715 25.224999999999998 130-134 27.72 24.98 22.3 25.0 135-139 27.38 24.21 23.265 25.145 140-144 28.68 24.015 23.11 24.195 145-149 28.549999999999997 24.575 22.5 24.375 150-151 28.275 25.8 22.162499999999998 23.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 1.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 2.5 29 4.5 30 6.5 31 10.5 32 10.5 33 13.5 34 17.0 35 23.0 36 34.0 37 43.0 38 59.5 39 70.0 40 87.0 41 104.5 42 122.0 43 133.5 44 140.0 45 151.0 46 159.5 47 151.5 48 130.5 49 135.0 50 139.5 51 126.0 52 106.0 53 96.5 54 107.0 55 108.5 56 94.5 57 92.0 58 101.5 59 97.5 60 100.5 61 115.0 62 112.5 63 116.0 64 112.5 65 106.0 66 94.0 67 81.5 68 78.0 69 82.5 70 74.5 71 55.5 72 50.0 73 43.5 74 32.5 75 20.5 76 10.0 77 3.0 78 2.0 79 2.0 80 4.0 81 2.5 82 2.0 83 1.5 84 0.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.5 96 1.0 97 1.5 98 1.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.34881149806523 82.625 2 7.32448866777225 13.25 3 1.077943615257048 2.9250000000000003 4 0.08291873963515754 0.3 5 0.055279159756771695 0.25 6 0.08291873963515754 0.44999999999999996 7 0.0 0.0 8 0.027639579878385848 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit CACCTTTCCTGCTGAGCTGAGCACACCTCTCTGTGAACTTTGGGCCTGAG 6 0.15 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit GTTCAGAGTTCTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGA 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.5250000000000004 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.45 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.0 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra Read 2075350 spots for SRR12949793.sra Written 2075350 spots for SRR12949793.sra Read 2075337 spots for SRR12949793.sra Written 2075337 spots for SRR12949793.sra SRR ids: ['SRR12949793.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b1smm_8y SRR12949793.sra spots: 41506753 blocks: [[1, 2075337], [2075338, 4150674], [4150675, 6226011], [6226012, 8301348], [8301349, 10376685], [10376686, 12452022], [12452023, 14527359], [14527360, 16602696], [16602697, 18678033], [18678034, 20753370], [20753371, 22828707], [22828708, 24904044], [24904045, 26979381], [26979382, 29054718], [29054719, 31130055], [31130056, 33205392], [33205393, 35280729], [35280730, 37356066], [37356067, 39431403], [39431404, 41506753]] SRR12949793 file size 14084110 SRR12949793 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949793 SRR12949793_1.fastq SRR12949793_2.fastq Input file: SRR12949793_1.fastq Paired file: SRR12949793_2.fastq trimmed: SRR12949793-trimmed-pair1.fastq, SRR12949793-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:19:03 2024 >> started Sat Dec 7 10:19:50 2024 >> done (47.691s) 41506753 read pairs processed; of these: 277 ( 0.00%) short read pairs filtered out after trimming by size control 36021 ( 0.09%) empty read pairs filtered out after trimming by size control 41470455 (99.91%) read pairs available; of these: 4274214 (10.31%) trimmed read pairs available after processing 37196241 (89.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 31 0.00% 20 21 0.00% 21 33 0.00% 22 38 0.00% 23 42 0.00% 24 36 0.00% 25 54 0.00% 26 61 0.00% 27 42 0.00% 28 66 0.00% 29 60 0.00% 30 73 0.00% 31 71 0.00% 32 98 0.00% 33 78 0.00% 34 82 0.00% 35 113 0.00% 36 115 0.00% 37 115 0.00% 38 113 0.00% 39 127 0.00% 40 107 0.00% 41 125 0.00% 42 151 0.00% 43 160 0.00% 44 167 0.00% 45 188 0.00% 46 189 0.00% 47 195 0.00% 48 232 0.00% 49 291 0.00% 50 320 0.00% 51 396 0.00% 52 394 0.00% 53 392 0.00% 54 493 0.00% 55 505 0.00% 56 570 0.00% 57 767 0.00% 58 770 0.00% 59 874 0.00% 60 1006 0.00% 61 1264 0.00% 62 1329 0.00% 63 1557 0.00% 64 1819 0.00% 65 1960 0.00% 66 2171 0.01% 67 2390 0.01% 68 2770 0.01% 69 3095 0.01% 70 3504 0.01% 71 3751 0.01% 72 4397 0.01% 73 4969 0.01% 74 5622 0.01% 75 6149 0.01% 76 6586 0.02% 77 7186 0.02% 78 7769 0.02% 79 8771 0.02% 80 9274 0.02% 81 10082 0.02% 82 11401 0.03% 83 12372 0.03% 84 13293 0.03% 85 14157 0.03% 86 14967 0.04% 87 15867 0.04% 88 16726 0.04% 89 17527 0.04% 90 18497 0.04% 91 19756 0.05% 92 20682 0.05% 93 21890 0.05% 94 23358 0.06% 95 24689 0.06% 96 25935 0.06% 97 27206 0.07% 98 28467 0.07% 99 29708 0.07% 100 30698 0.07% 101 31781 0.08% 102 33019 0.08% 103 34134 0.08% 104 35705 0.09% 105 36983 0.09% 106 39822 0.10% 107 41506 0.10% 108 42736 0.10% 109 44689 0.11% 110 45650 0.11% 111 47210 0.11% 112 48677 0.12% 113 50168 0.12% 114 52791 0.13% 115 55844 0.13% 116 56943 0.14% 117 59594 0.14% 118 60287 0.15% 119 62227 0.15% 120 64504 0.16% 121 66071 0.16% 122 66195 0.16% 123 69204 0.17% 124 71000 0.17% 125 72888 0.18% 126 75254 0.18% 127 76308 0.18% 128 79445 0.19% 129 82892 0.20% 130 83405 0.20% 131 85402 0.21% 132 87660 0.21% 133 89945 0.22% 134 90539 0.22% 135 93472 0.23% 136 94635 0.23% 137 96400 0.23% 138 98324 0.24% 139 103240 0.25% 140 102481 0.25% 141 105956 0.26% 142 108379 0.26% 143 109886 0.26% 144 113567 0.27% 145 114462 0.28% 146 115376 0.28% 147 119316 0.29% 148 119914 0.29% 149 121478 0.29% 150 123460 0.30% 151 37196241 89.69% 41470455 reads passed initial QC criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=19 prefix-density=1.15 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=17.35 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.7 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=13 prefix-density=0.83 prefix-fanout=3.9 sequence=GAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=71.26 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=8.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12949793 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:20:33 Started mapping on | Dec 07 10:20:33 Finished on | Dec 07 10:23:41 Mapping speed, Million of reads per hour | 794.12 Number of input reads | 41470455 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 39660363 Uniquely mapped reads % | 95.64% Average mapped length | 295.88 Number of splices: Total | 39476225 Number of splices: Annotated (sjdb) | 37270858 Number of splices: GT/AG | 38946253 Number of splices: GC/AG | 472336 Number of splices: AT/AC | 14290 Number of splices: Non-canonical | 43346 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454623 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 59211 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1355469 1355469 1355469 N_multimapping 454623 454623 454623 N_noFeature 1387866 38545828 1670895 N_ambiguous 983789 5742 153226 UnstrandedReadsAssigned:37288708 PositiveStrandReadsAssigned:1108793 NegativeStrandReadsAssigned:37836242 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949793 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949793-trimmed-pair1.fastq SRR12949793-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,470,455 reads, 38,257,838 reads pseudoaligned [quant] estimated average fragment length: 279.117 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52973 SRR12949793.ke.tsv 35125 SRR12949793.se.tsv 88098 total ==> SRR12949793.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.57 6.31445e-08 3.37323e-09 PNS24247 1044 765.883 87.3997 4.01477 PNS24249 1928 1649.88 126.758 2.70294 PNS24246 1044 765.883 87.3997 4.01477 PNS24248 1044 765.883 87.3997 4.01477 PNS24244 1471 1192.88 131.043 3.8648 PNS24243 293 96.2067 0 0 KQK14069 1603 1324.88 7185.61 190.809 KQK14071 474 229.397 75.5333 11.5842 ==> SRR12949793.se.tsv <== BRADI_1g14170v3 7929 BRADI_1g53295v3 236 BRADI_1g59795v3 1397 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 729 BRADI_1g74790v3 163 BRADI_1g09890v3 0 BRADI_1g77505v3 418 BRADI_1g48960v3 0 SRR12949793 completed mapping pipeline successfully