Starting /dee2/code/volunteer_pipeline.sh SRR12949794 current disk space = 1516112543744 free memory = 1607765540 SRR12949794 SRAfilesize b9fc37fc8942f3a886aa8ccc79cb3372 SRR12949794.sra SRR12949794.sra file validated SRR12949794 is paired end SRR12949794 is conventional basespace SRR12949794 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949794_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.606 37.0 37.0 37.0 37.0 37.0 2 36.08 37.0 37.0 37.0 37.0 37.0 3 36.587 37.0 37.0 37.0 37.0 37.0 4 36.6705 37.0 37.0 37.0 37.0 37.0 5 36.676 37.0 37.0 37.0 37.0 37.0 6 36.651 37.0 37.0 37.0 37.0 37.0 7 36.594 37.0 37.0 37.0 37.0 37.0 8 36.697 37.0 37.0 37.0 37.0 37.0 9 36.586 37.0 37.0 37.0 37.0 37.0 10-14 36.646300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6491 37.0 37.0 37.0 37.0 37.0 20-24 36.650400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.644400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5813 37.0 37.0 37.0 37.0 37.0 35-39 36.54430000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.5538 37.0 37.0 37.0 37.0 37.0 45-49 36.5366 37.0 37.0 37.0 37.0 37.0 50-54 36.4878 37.0 37.0 37.0 37.0 37.0 55-59 36.5133 37.0 37.0 37.0 37.0 37.0 60-64 36.454699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.4786 37.0 37.0 37.0 37.0 37.0 70-74 36.4061 37.0 37.0 37.0 37.0 37.0 75-79 36.4372 37.0 37.0 37.0 37.0 37.0 80-84 36.4349 37.0 37.0 37.0 37.0 37.0 85-89 36.3648 37.0 37.0 37.0 37.0 37.0 90-94 36.3384 37.0 37.0 37.0 37.0 37.0 95-99 36.400999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2993 37.0 37.0 37.0 37.0 37.0 105-109 36.285000000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.2879 37.0 37.0 37.0 37.0 37.0 115-119 36.1955 37.0 37.0 37.0 37.0 37.0 120-124 36.1613 37.0 37.0 37.0 37.0 37.0 125-129 36.1572 37.0 37.0 37.0 37.0 37.0 130-134 36.060100000000006 37.0 37.0 37.0 37.0 37.0 135-139 36.063900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.898900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8579 37.0 37.0 37.0 37.0 37.0 150-151 35.747 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 2.0 25 1.0 26 2.0 27 4.0 28 11.0 29 10.0 30 19.0 31 28.0 32 47.0 33 63.0 34 93.0 35 289.0 36 2811.0 37 616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.5 10.725 4.8 30.975 2 22.53912165572943 11.206461383139828 32.93791014639071 33.31650681474003 3 21.6 15.475 25.15 37.775 4 26.05 21.625 21.775 30.55 5 27.500000000000004 28.025 23.225 21.25 6 22.05 30.65 22.875 24.425 7 18.2 23.95 39.225 18.625 8 18.9 25.025 30.75 25.324999999999996 9 20.599999999999998 23.0 32.550000000000004 23.849999999999998 10-14 23.06 26.745 25.645 24.55 15-19 22.869999999999997 26.334999999999997 25.915 24.88 20-24 23.14 25.485000000000003 25.95 25.424999999999997 25-29 22.615 26.11 25.47 25.805 30-34 23.36 25.3 25.790000000000003 25.55 35-39 22.855 25.695 25.465 25.985000000000003 40-44 23.355 25.64 25.645 25.36 45-49 23.21 25.645 25.47 25.674999999999997 50-54 23.055 25.915 25.16 25.869999999999997 55-59 23.34 25.380000000000003 25.71 25.569999999999997 60-64 23.375 25.965 25.124999999999996 25.535000000000004 65-69 23.095 25.95 24.959999999999997 25.995 70-74 23.605 25.455 25.145 25.795 75-79 23.76 25.765 24.915000000000003 25.56 80-84 23.119999999999997 25.52 25.11 26.25 85-89 23.0 25.564999999999998 25.555 25.88 90-94 23.175 25.919999999999998 25.395 25.509999999999998 95-99 23.74 25.785000000000004 25.005 25.47 100-104 23.775 25.685000000000002 24.965 25.575 105-109 23.715 25.72 25.145 25.419999999999998 110-114 24.115000000000002 25.124999999999996 25.759999999999998 25.0 115-119 23.145 26.119999999999997 24.79 25.945 120-124 23.405 26.005 24.529999999999998 26.06 125-129 23.75 25.835 24.995 25.419999999999998 130-134 23.075000000000003 26.384999999999998 24.2 26.340000000000003 135-139 24.005000000000003 25.490000000000002 24.7 25.805 140-144 22.925 25.71 25.135 26.229999999999997 145-149 23.73 25.47 24.435000000000002 26.365 150-151 23.45 25.25 24.375 26.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.5 28 1.5 29 3.0 30 3.0 31 8.5 32 14.5 33 20.0 34 34.0 35 45.5 36 46.5 37 59.0 38 81.5 39 95.5 40 112.5 41 139.5 42 164.0 43 187.5 44 212.0 45 203.0 46 198.0 47 204.0 48 194.0 49 185.5 50 167.5 51 152.5 52 145.0 53 136.0 54 115.0 55 110.0 56 106.5 57 78.5 58 73.0 59 72.0 60 70.0 61 64.5 62 56.5 63 66.0 64 64.0 65 51.0 66 45.5 67 44.5 68 40.0 69 34.5 70 25.5 71 16.0 72 11.0 73 11.5 74 11.0 75 6.0 76 3.5 77 2.0 78 1.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.95 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.13025780189959 84.875 2 7.245590230664857 13.350000000000001 3 0.5698778833107192 1.575 4 0.054274084124830396 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.025 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0125 0.025 0.0 0.0 0.0 64-65 0.05 0.025 0.0 0.0 0.0 66-67 0.05 0.025 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.1125 0.025 0.0 0.0 0.0 76-77 0.175 0.025 0.0 0.0 0.0 78-79 0.2375 0.025 0.0 0.0 0.0 80-81 0.25 0.025 0.0 0.0 0.0 82-83 0.275 0.025 0.0 0.0 0.0 84-85 0.375 0.025 0.0 0.0 0.0 86-87 0.4875 0.025 0.0 0.0 0.0 88-89 0.525 0.025 0.0 0.0 0.0 90-91 0.7125 0.025 0.0 0.0 0.0 92-93 0.925 0.025 0.0 0.0 0.0 94-95 1.0625 0.025 0.0 0.0 0.0 96-97 1.275 0.025 0.0 0.0 0.0 98-99 1.6 0.025 0.0 0.0 0.0 100-101 1.8125 0.025 0.0 0.0 0.0 102-103 2.125 0.025 0.0 0.0 0.0 104-105 2.525 0.025 0.0 0.0 0.0 106-107 2.7750000000000004 0.025 0.0 0.0 0.0 108-109 3.1624999999999996 0.025 0.0 0.0 0.0 110-111 3.5375 0.025 0.0 0.0 0.0 112-113 3.8875 0.025 0.0 0.0 0.0 114-115 4.137499999999999 0.025 0.0 0.0 0.0 116-117 4.7375 0.025 0.0 0.0 0.0 118-119 5.237500000000001 0.025 0.0 0.0 0.0 120-121 5.7625 0.025 0.0 0.0 0.0 122-123 6.262499999999999 0.025 0.0 0.0 0.0 124-125 6.6875 0.025 0.0 0.0 0.0 126-127 7.074999999999999 0.025 0.0 0.0 0.0 128-129 7.75 0.025 0.0 0.0 0.0 130-131 8.275 0.025 0.0 0.0 0.0 132-133 9.0375 0.025 0.0 0.0 0.0 134-135 9.662500000000001 0.025 0.0 0.0 0.0 136-137 10.3125 0.025 0.0 0.0 0.0 138-139 10.7625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12949794 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12949794_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3925 37.0 37.0 37.0 37.0 37.0 2 36.0295 37.0 37.0 37.0 37.0 37.0 3 36.1155 37.0 37.0 37.0 37.0 37.0 4 36.0675 37.0 37.0 37.0 37.0 37.0 5 36.157 37.0 37.0 37.0 37.0 37.0 6 36.1785 37.0 37.0 37.0 37.0 37.0 7 36.1705 37.0 37.0 37.0 37.0 37.0 8 36.129 37.0 37.0 37.0 37.0 37.0 9 36.295 37.0 37.0 37.0 37.0 37.0 10-14 36.2084 37.0 37.0 37.0 37.0 37.0 15-19 36.2098 37.0 37.0 37.0 37.0 37.0 20-24 36.1584 37.0 37.0 37.0 37.0 37.0 25-29 36.1808 37.0 37.0 37.0 37.0 37.0 30-34 36.0895 37.0 37.0 37.0 37.0 37.0 35-39 36.0917 37.0 37.0 37.0 37.0 37.0 40-44 36.0419 37.0 37.0 37.0 37.0 37.0 45-49 36.0551 37.0 37.0 37.0 37.0 37.0 50-54 36.0307 37.0 37.0 37.0 37.0 37.0 55-59 35.984 37.0 37.0 37.0 37.0 37.0 60-64 35.9574 37.0 37.0 37.0 37.0 37.0 65-69 35.9437 37.0 37.0 37.0 37.0 37.0 70-74 35.877300000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8883 37.0 37.0 37.0 37.0 37.0 80-84 35.859899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8326 37.0 37.0 37.0 37.0 37.0 90-94 35.8007 37.0 37.0 37.0 37.0 37.0 95-99 35.76520000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.742999999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.6842 37.0 37.0 37.0 37.0 37.0 110-114 35.707 37.0 37.0 37.0 37.0 37.0 115-119 35.65840000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.560700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6188 37.0 37.0 37.0 37.0 37.0 130-134 35.4775 37.0 37.0 37.0 37.0 37.0 135-139 35.400400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.310199999999995 37.0 37.0 37.0 34.6 37.0 145-149 35.2844 37.0 37.0 37.0 34.6 37.0 150-151 34.95675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 9.0 14 6.0 15 3.0 16 2.0 17 2.0 18 3.0 19 3.0 20 4.0 21 2.0 22 5.0 23 7.0 24 8.0 25 9.0 26 12.0 27 11.0 28 23.0 29 17.0 30 27.0 31 40.0 32 48.0 33 86.0 34 169.0 35 506.0 36 2609.0 37 389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.65 20.1 6.4750000000000005 23.775 2 29.099999999999998 22.1 27.275 21.525 3 23.125 23.575 31.775 21.525 4 28.175 28.65 21.075 22.1 5 29.225 31.95 19.55 19.275000000000002 6 23.9 35.099999999999994 19.025 21.975 7 23.95 20.349999999999998 32.85 22.85 8 23.325000000000003 22.175 25.75 28.749999999999996 9 24.8 21.25 26.525 27.425 10-14 26.655 26.105 23.095 24.145 15-19 26.235000000000003 24.565 25.25 23.95 20-24 25.919999999999998 25.169999999999998 24.33 24.58 25-29 26.16 25.380000000000003 23.990000000000002 24.47 30-34 25.924999999999997 24.9 24.34 24.834999999999997 35-39 25.765 25.525 24.385 24.325 40-44 26.47 25.245 24.23 24.055 45-49 26.755000000000003 25.395 23.715 24.135 50-54 26.22 26.224999999999998 24.09 23.465 55-59 27.339999999999996 24.88 23.945 23.835 60-64 25.805 25.040000000000003 24.654999999999998 24.5 65-69 26.665 25.324999999999996 24.395 23.615 70-74 26.82 25.96 23.895 23.325000000000003 75-79 26.41 25.61 24.465 23.515 80-84 26.75 25.585 24.345 23.32 85-89 26.325 25.365 24.26 24.05 90-94 26.155 25.5 25.045 23.3 95-99 26.205000000000002 25.595000000000002 24.995 23.205000000000002 100-104 26.435 25.679999999999996 24.45 23.435 105-109 26.645000000000003 25.45 25.080000000000002 22.825 110-114 27.325 26.14 23.724999999999998 22.81 115-119 26.69 25.924999999999997 24.485 22.900000000000002 120-124 27.015 25.865 24.335 22.785 125-129 26.625 26.41 23.97 22.994999999999997 130-134 27.33 26.51 23.7 22.46 135-139 27.6 25.874999999999996 23.990000000000002 22.535 140-144 27.584999999999997 26.435 23.45 22.53 145-149 27.805000000000003 26.009999999999998 24.15 22.035 150-151 28.775000000000002 25.05 23.9875 22.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 1.5 9 0.5 10 2.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 3.0 29 6.5 30 7.5 31 7.5 32 11.0 33 12.5 34 19.5 35 33.0 36 45.0 37 59.0 38 66.5 39 76.0 40 104.0 41 134.0 42 146.0 43 172.0 44 198.0 45 192.0 46 197.0 47 183.0 48 170.0 49 171.0 50 154.0 51 146.5 52 140.5 53 131.5 54 118.5 55 112.0 56 115.5 57 104.0 58 91.0 59 89.5 60 78.0 61 72.0 62 64.0 63 62.5 64 63.5 65 55.5 66 52.5 67 51.0 68 53.5 69 43.0 70 41.5 71 40.0 72 23.0 73 14.5 74 10.0 75 7.0 76 4.5 77 1.5 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 1.0 86 2.5 87 2.5 88 1.0 89 0.5 90 0.0 91 0.5 92 1.5 93 1.0 94 1.0 95 1.5 96 1.5 97 1.0 98 0.5 99 0.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53933803581118 85.275 2 6.782419967444383 12.5 3 0.5968529571351058 1.6500000000000001 4 0.05425935973955508 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02712967986977754 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.6125 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.15 0.0 0.0 0.0 0.0 104-105 2.525 0.0 0.0 0.0 0.0 106-107 2.7750000000000004 0.0 0.0 0.0 0.0 108-109 3.15 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 3.8625 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.7125 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.637499999999999 0.0 0.0 0.0 0.0 126-127 7.0375 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.275 0.0 0.0 0.0 0.0 132-133 9.0375 0.0 0.0 0.0 0.0 134-135 9.662500000000001 0.0 0.0 0.0 0.0 136-137 10.3125 0.0 0.0 0.0 0.0 138-139 10.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra Read 1348456 spots for SRR12949794.sra Written 1348456 spots for SRR12949794.sra SRR ids: ['SRR12949794.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_taaxvhvm SRR12949794.sra spots: 26969120 blocks: [[1, 1348456], [1348457, 2696912], [2696913, 4045368], [4045369, 5393824], [5393825, 6742280], [6742281, 8090736], [8090737, 9439192], [9439193, 10787648], [10787649, 12136104], [12136105, 13484560], [13484561, 14833016], [14833017, 16181472], [16181473, 17529928], [17529929, 18878384], [18878385, 20226840], [20226841, 21575296], [21575297, 22923752], [22923753, 24272208], [24272209, 25620664], [25620665, 26969120]] SRR12949794 file size 9143586 SRR12949794 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12949794 SRR12949794_1.fastq SRR12949794_2.fastq Input file: SRR12949794_1.fastq Paired file: SRR12949794_2.fastq trimmed: SRR12949794-trimmed-pair1.fastq, SRR12949794-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:13:30 2024 >> started Thu Dec 12 02:14:02 2024 >> done (31.066s) 26969120 read pairs processed; of these: 139 ( 0.00%) short read pairs filtered out after trimming by size control 13921 ( 0.05%) empty read pairs filtered out after trimming by size control 26955060 (99.95%) read pairs available; of these: 4069063 (15.10%) trimmed read pairs available after processing 22885997 (84.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 8 0.00% 21 14 0.00% 22 17 0.00% 23 19 0.00% 24 14 0.00% 25 26 0.00% 26 41 0.00% 27 23 0.00% 28 22 0.00% 29 43 0.00% 30 26 0.00% 31 37 0.00% 32 44 0.00% 33 41 0.00% 34 43 0.00% 35 43 0.00% 36 68 0.00% 37 63 0.00% 38 71 0.00% 39 72 0.00% 40 87 0.00% 41 78 0.00% 42 105 0.00% 43 84 0.00% 44 91 0.00% 45 115 0.00% 46 141 0.00% 47 137 0.00% 48 192 0.00% 49 203 0.00% 50 234 0.00% 51 264 0.00% 52 279 0.00% 53 328 0.00% 54 348 0.00% 55 386 0.00% 56 397 0.00% 57 465 0.00% 58 566 0.00% 59 691 0.00% 60 817 0.00% 61 923 0.00% 62 1058 0.00% 63 1212 0.00% 64 1362 0.01% 65 1488 0.01% 66 1648 0.01% 67 1810 0.01% 68 2157 0.01% 69 2427 0.01% 70 2785 0.01% 71 3256 0.01% 72 3625 0.01% 73 4143 0.02% 74 4710 0.02% 75 5175 0.02% 76 5664 0.02% 77 6363 0.02% 78 7061 0.03% 79 7747 0.03% 80 8576 0.03% 81 9378 0.03% 82 10675 0.04% 83 11444 0.04% 84 12719 0.05% 85 13993 0.05% 86 15122 0.06% 87 16297 0.06% 88 17146 0.06% 89 18343 0.07% 90 19768 0.07% 91 20791 0.08% 92 22123 0.08% 93 23529 0.09% 94 25461 0.09% 95 26848 0.10% 96 28964 0.11% 97 30229 0.11% 98 31204 0.12% 99 32421 0.12% 100 34285 0.13% 101 34886 0.13% 102 36776 0.14% 103 38142 0.14% 104 39814 0.15% 105 42198 0.16% 106 43366 0.16% 107 44796 0.17% 108 46577 0.17% 109 48549 0.18% 110 49308 0.18% 111 50892 0.19% 112 52653 0.20% 113 53460 0.20% 114 55221 0.20% 115 57891 0.21% 116 59350 0.22% 117 61436 0.23% 118 62626 0.23% 119 63988 0.24% 120 65524 0.24% 121 66815 0.25% 122 67405 0.25% 123 69080 0.26% 124 70573 0.26% 125 71415 0.26% 126 74095 0.27% 127 75343 0.28% 128 77322 0.29% 129 79093 0.29% 130 79779 0.30% 131 80365 0.30% 132 82032 0.30% 133 82983 0.31% 134 83867 0.31% 135 85459 0.32% 136 86745 0.32% 137 87281 0.32% 138 89056 0.33% 139 91462 0.34% 140 91512 0.34% 141 93339 0.35% 142 94532 0.35% 143 94148 0.35% 144 95218 0.35% 145 96381 0.36% 146 96615 0.36% 147 97763 0.36% 148 99480 0.37% 149 99873 0.37% 150 101882 0.38% 151 22885997 84.90% 26955060 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.57 fanout-score-rank=26 prefix-density=0.23 prefix-fanout=4.3 sequence=GGCAGCCTCCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=1225.09 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=26.3 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=34 prefix-density=0.40 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=198.80 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=19.7 sequence=CGCCGCCGCCGTC SRR12949794 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:15:38 Started mapping on | Dec 12 02:15:39 Finished on | Dec 12 02:17:45 Mapping speed, Million of reads per hour | 770.14 Number of input reads | 26955060 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 22431228 Uniquely mapped reads % | 83.22% Average mapped length | 292.64 Number of splices: Total | 24074838 Number of splices: Annotated (sjdb) | 22682565 Number of splices: GT/AG | 23755114 Number of splices: GC/AG | 278526 Number of splices: AT/AC | 16854 Number of splices: Non-canonical | 24344 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283589 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 65471 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.58% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4240243 4240243 4240243 N_multimapping 283589 283589 283589 N_noFeature 765034 21890547 936977 N_ambiguous 490580 5239 122206 UnstrandedReadsAssigned:21175614 PositiveStrandReadsAssigned:535442 NegativeStrandReadsAssigned:21372045 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12949794 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12949794-trimmed-pair1.fastq SRR12949794-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,955,060 reads, 24,791,080 reads pseudoaligned [quant] estimated average fragment length: 259.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR12949794.ke.tsv 35125 SRR12949794.se.tsv 88098 total ==> SRR12949794.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.464 0 0 PNS24247 1044 785.915 118.037 9.5799 PNS24249 1928 1669.92 133.085 5.08338 PNS24246 1044 785.915 118.037 9.5799 PNS24248 1044 785.915 118.037 9.5799 PNS24244 1471 1212.92 218.802 11.5064 PNS24243 293 106.648 2 1.19618 KQK14069 1603 1344.92 6892.96 326.91 KQK14071 474 244.695 143.866 37.5016 ==> SRR12949794.se.tsv <== BRADI_1g14170v3 5986 BRADI_1g53295v3 129 BRADI_1g59795v3 515 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 1195 BRADI_1g74790v3 45 BRADI_1g09890v3 0 BRADI_1g77505v3 162 BRADI_1g48960v3 0 SRR12949794 completed mapping pipeline successfully