Starting /dee2/code/volunteer_pipeline.sh SRR12951283 current disk space = 1543718109184 free memory = 1600566076 SRR12951283 SRAfilesize 92e34010458b31d8e32b4e4f56c0def9 SRR12951283.sra SRR12951283.sra file validated SRR12951283 is paired end SRR12951283 is conventional basespace SRR12951283 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951283_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5145 37.0 37.0 37.0 37.0 37.0 2 36.15875 37.0 37.0 37.0 37.0 37.0 3 36.431 37.0 37.0 37.0 37.0 37.0 4 36.5785 37.0 37.0 37.0 37.0 37.0 5 36.5855 37.0 37.0 37.0 37.0 37.0 6 36.577 37.0 37.0 37.0 37.0 37.0 7 36.5235 37.0 37.0 37.0 37.0 37.0 8 36.6325 37.0 37.0 37.0 37.0 37.0 9 36.526 37.0 37.0 37.0 37.0 37.0 10-14 36.5836 37.0 37.0 37.0 37.0 37.0 15-19 36.5437 37.0 37.0 37.0 37.0 37.0 20-24 36.5261 37.0 37.0 37.0 37.0 37.0 25-29 36.5058 37.0 37.0 37.0 37.0 37.0 30-34 36.5081 37.0 37.0 37.0 37.0 37.0 35-39 36.463499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4551 37.0 37.0 37.0 37.0 37.0 45-49 36.3865 37.0 37.0 37.0 37.0 37.0 50-54 36.3642 37.0 37.0 37.0 37.0 37.0 55-59 36.3382 37.0 37.0 37.0 37.0 37.0 60-64 36.329699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2537 37.0 37.0 37.0 37.0 37.0 70-74 36.3047 37.0 37.0 37.0 37.0 37.0 75-79 36.3347 37.0 37.0 37.0 37.0 37.0 80-84 36.293899999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.297 37.0 37.0 37.0 37.0 37.0 90-94 36.283699999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.237199999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.22409999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.242399999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.191 37.0 37.0 37.0 37.0 37.0 115-119 36.2552 37.0 37.0 37.0 37.0 37.0 120-124 36.15559999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.068799999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.026300000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.9866 37.0 37.0 37.0 37.0 37.0 140-144 35.8264 37.0 37.0 37.0 37.0 37.0 145-149 35.7961 37.0 37.0 37.0 37.0 37.0 150-151 35.65025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 0.0 25 6.0 26 6.0 27 8.0 28 7.0 29 14.0 30 21.0 31 28.0 32 47.0 33 92.0 34 118.0 35 302.0 36 2866.0 37 483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.2 10.6 4.825 34.375 2 20.50314465408805 10.716981132075471 36.528301886792455 32.25157232704402 3 19.950000000000003 14.875 27.425 37.75 4 24.975 22.15 22.400000000000002 30.475 5 26.85 26.650000000000002 24.8 21.7 6 24.175 30.475 22.625 22.725 7 18.625 25.3 36.625 19.45 8 19.925 24.025 28.799999999999997 27.250000000000004 9 21.675 20.5 32.0 25.825 10-14 24.26 26.155 24.5 25.085 15-19 23.91 25.025 25.27 25.795 20-24 23.375 25.295 25.380000000000003 25.95 25-29 23.75 24.81 24.725 26.715 30-34 24.07 24.945 24.845 26.14 35-39 24.46 24.834999999999997 24.705 26.0 40-44 24.240000000000002 25.88 24.245 25.635 45-49 24.385 24.759999999999998 24.8 26.055 50-54 23.845 25.145 24.635 26.375 55-59 24.325 25.505 24.125 26.045 60-64 24.805 25.080000000000002 24.675 25.44 65-69 24.495 25.240000000000002 24.240000000000002 26.025 70-74 24.775 24.39 24.8 26.035000000000004 75-79 24.845 24.695 23.775 26.685 80-84 24.575 24.195 24.845 26.384999999999998 85-89 24.705 24.044999999999998 24.665 26.584999999999997 90-94 25.180000000000003 24.19 24.05 26.58 95-99 25.3 25.629999999999995 22.99 26.08 100-104 24.665 24.9 24.195 26.240000000000002 105-109 25.619999999999997 24.154999999999998 23.705000000000002 26.52 110-114 24.86 25.05 24.58 25.509999999999998 115-119 25.135 24.165 24.525 26.174999999999997 120-124 25.575 24.34 23.135 26.950000000000003 125-129 25.035 24.945 23.419999999999998 26.6 130-134 25.169999999999998 24.385 23.985 26.46 135-139 25.230000000000004 24.055 23.585 27.13 140-144 25.230000000000004 24.265 24.245 26.26 145-149 25.355 24.645 23.56 26.44 150-151 24.962500000000002 23.9125 24.6125 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.0 28 1.5 29 2.5 30 4.0 31 5.0 32 12.5 33 23.5 34 33.5 35 42.5 36 48.5 37 64.5 38 76.5 39 84.5 40 111.0 41 139.0 42 141.5 43 140.5 44 159.5 45 180.0 46 184.0 47 187.5 48 177.5 49 169.0 50 178.0 51 162.5 52 135.5 53 124.5 54 117.5 55 107.5 56 82.5 57 69.5 58 80.0 59 76.5 60 70.5 61 71.5 62 68.0 63 69.0 64 75.5 65 63.5 66 62.5 67 70.0 68 51.0 69 40.5 70 46.5 71 44.0 72 34.5 73 23.5 74 20.0 75 18.5 76 14.5 77 11.5 78 6.0 79 3.0 80 2.5 81 3.5 82 3.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.2 #Duplication Level Percentage of deduplicated Percentage of total 1 84.61538461538461 70.39999999999999 2 11.899038461538462 19.8 3 2.433894230769231 6.075 4 0.78125 2.6 5 0.2704326923076923 1.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCATCTGAGCTTCTTTTGGGAGATCATCGTCGTCCTCGGTGGCTTCAG 5 0.125 No Hit CTTCTCAATGAGCTCATCGACTGGAAGTGATTCAAGTGAACCATCCTTGC 5 0.125 No Hit CCCAAATTATAGGTTCATGAATATTCAATCTCCATGTTTGGTCAGTTACC 5 0.125 No Hit CCTAGACACACCTCCTCAACTAAGGAACAACCCAATCTAATCTCATTCCA 5 0.125 No Hit CCTTGGCCTGCGGTGCATCCTCCGTTAATAGTGCACCCTGCTTCTCAGGA 5 0.125 No Hit GCATTGATGAACTCCACTGGGGACTGGCTGAACCCAAGGAAGAATGCCCT 5 0.125 No Hit CCATCCTTGGGCCCTCACCCAAATACTTCTGCACAAATTCTGAACCAACA 5 0.125 No Hit GCCTGAACTAGGAAAGTAGCAACATTCTTACGCTGATCACCTTGAAGCTG 5 0.125 No Hit GTCCTATGTGCTCCCCTTCCATCAGTTTCATCAACCCTTCCACCAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.9625 0.0 0.0 0.0 0.0 92-93 1.05 0.0 0.0 0.0 0.0 94-95 1.1749999999999998 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.825 0.0 0.0 0.0 0.0 102-103 2.0999999999999996 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.9749999999999996 0.0 0.0 0.0 0.0375 108-109 3.5875 0.0 0.0 0.0 0.075 110-111 3.9375 0.0 0.0 0.0 0.075 112-113 4.425 0.0 0.0 0.0 0.075 114-115 4.7875 0.0 0.0 0.0 0.075 116-117 5.2625 0.0 0.0 0.0 0.075 118-119 5.7875 0.0 0.0 0.0 0.075 120-121 6.1625 0.0 0.0 0.0 0.075 122-123 6.9 0.0 0.0 0.0 0.075 124-125 7.7125 0.0 0.0 0.0 0.075 126-127 8.3625 0.0 0.0 0.0 0.075 128-129 8.6875 0.0 0.0 0.0 0.075 130-131 9.350000000000001 0.0 0.0 0.0 0.075 132-133 10.2375 0.0 0.0 0.0 0.075 134-135 11.0125 0.0 0.0 0.0 0.075 136-137 11.7875 0.0 0.0 0.0 0.075 138-139 12.5375 0.0 0.0 0.0 0.075 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGTCTG 45 0.008957279 48.333332 145 GGGGGGG 80 3.1520904E-7 18.125 140-144 >>END_MODULE SRR12951283 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951283_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1915 37.0 37.0 37.0 37.0 37.0 2 36.216 37.0 37.0 37.0 37.0 37.0 3 36.197 37.0 37.0 37.0 37.0 37.0 4 36.296 37.0 37.0 37.0 37.0 37.0 5 36.337 37.0 37.0 37.0 37.0 37.0 6 36.3005 37.0 37.0 37.0 37.0 37.0 7 36.367 37.0 37.0 37.0 37.0 37.0 8 36.333 37.0 37.0 37.0 37.0 37.0 9 36.2635 37.0 37.0 37.0 37.0 37.0 10-14 36.239 37.0 37.0 37.0 37.0 37.0 15-19 36.2745 37.0 37.0 37.0 37.0 37.0 20-24 36.21079999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.176100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1236 37.0 37.0 37.0 37.0 37.0 35-39 36.1186 37.0 37.0 37.0 37.0 37.0 40-44 36.09779999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1275 37.0 37.0 37.0 37.0 37.0 50-54 36.0529 37.0 37.0 37.0 37.0 37.0 55-59 36.06849999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.0207 37.0 37.0 37.0 37.0 37.0 65-69 35.9919 37.0 37.0 37.0 37.0 37.0 70-74 35.9818 37.0 37.0 37.0 37.0 37.0 75-79 35.9029 37.0 37.0 37.0 37.0 37.0 80-84 35.9534 37.0 37.0 37.0 37.0 37.0 85-89 35.926899999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.9645 37.0 37.0 37.0 37.0 37.0 95-99 35.8808 37.0 37.0 37.0 37.0 37.0 100-104 35.907599999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.8294 37.0 37.0 37.0 37.0 37.0 110-114 35.8365 37.0 37.0 37.0 37.0 37.0 115-119 35.8919 37.0 37.0 37.0 37.0 37.0 120-124 35.796299999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6457 37.0 37.0 37.0 37.0 37.0 130-134 35.5312 37.0 37.0 37.0 37.0 37.0 135-139 35.4932 37.0 37.0 37.0 37.0 37.0 140-144 35.3484 37.0 37.0 37.0 37.0 37.0 145-149 35.09830000000001 37.0 37.0 37.0 29.8 37.0 150-151 34.820499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 6.0 15 1.0 16 1.0 17 3.0 18 3.0 19 3.0 20 1.0 21 4.0 22 6.0 23 6.0 24 6.0 25 3.0 26 10.0 27 9.0 28 10.0 29 18.0 30 17.0 31 38.0 32 41.0 33 88.0 34 185.0 35 555.0 36 2695.0 37 286.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.375 22.400000000000002 6.825 24.4 2 30.725 20.599999999999998 25.025 23.65 3 23.400000000000002 26.625 27.575 22.400000000000002 4 26.3 29.9 21.224999999999998 22.575 5 27.325 32.175 19.400000000000002 21.099999999999998 6 24.25 33.825 18.65 23.275000000000002 7 23.275000000000002 19.475 34.300000000000004 22.95 8 24.0 22.05 23.474999999999998 30.475 9 23.925 21.475 24.65 29.95 10-14 26.834999999999997 24.425 22.7 26.040000000000003 15-19 26.345000000000002 23.97 23.674999999999997 26.009999999999998 20-24 26.540000000000003 24.48 23.27 25.71 25-29 26.88 24.025 23.34 25.755 30-34 25.96 24.87 22.98 26.19 35-39 25.945 23.845 23.61 26.6 40-44 27.16 23.505000000000003 23.39 25.945 45-49 26.75 24.305 23.32 25.624999999999996 50-54 26.39 24.21 23.71 25.69 55-59 26.479999999999997 24.565 23.135 25.82 60-64 26.415 23.96 23.919999999999998 25.705 65-69 26.895000000000003 24.705 23.46 24.94 70-74 26.545 24.779999999999998 23.095 25.580000000000002 75-79 27.034999999999997 24.025 23.705000000000002 25.235000000000003 80-84 27.1 24.62 22.975 25.305 85-89 27.48 23.265 23.880000000000003 25.374999999999996 90-94 27.485 23.95 23.865 24.7 95-99 27.060000000000002 24.18 23.494999999999997 25.264999999999997 100-104 27.145000000000003 24.245 23.35 25.259999999999998 105-109 27.495000000000005 24.285 23.055 25.165 110-114 27.345000000000002 25.235000000000003 23.115 24.305 115-119 27.985 24.185000000000002 23.01 24.82 120-124 28.155 24.34 22.61 24.895 125-129 28.225 25.014999999999997 22.63 24.13 130-134 28.265 25.285000000000004 22.95 23.5 135-139 29.18 24.085 22.905 23.830000000000002 140-144 28.785 24.66 23.1 23.455000000000002 145-149 29.365000000000002 24.665 22.884999999999998 23.085 150-151 29.049999999999997 24.425 22.9625 23.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.0 29 5.0 30 5.5 31 7.5 32 8.5 33 11.5 34 19.0 35 24.0 36 43.0 37 56.0 38 60.0 39 70.5 40 99.0 41 132.0 42 152.5 43 158.5 44 141.0 45 144.0 46 152.5 47 143.0 48 162.5 49 171.0 50 147.5 51 138.5 52 129.0 53 112.5 54 114.0 55 107.0 56 92.0 57 93.5 58 97.5 59 89.5 60 81.5 61 81.0 62 77.5 63 91.0 64 95.5 65 76.0 66 64.0 67 66.5 68 71.0 69 65.0 70 53.0 71 44.0 72 48.0 73 50.5 74 40.0 75 25.0 76 14.5 77 7.5 78 6.0 79 8.0 80 7.0 81 4.5 82 1.5 83 1.0 84 0.5 85 0.5 86 1.0 87 1.5 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 2.0 94 2.0 95 0.0 96 1.0 97 2.0 98 2.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.58308338332333 70.5 2 12.11757648470306 20.200000000000003 3 2.3095380923815236 5.775 4 0.7498500299940012 2.5 5 0.20995800839832035 0.8750000000000001 6 0.029994001199760045 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GATCGATCTGCTCTTCCACGCGCCCATATAAAAGACCAACAAAGTGAACG 5 0.125 No Hit TGATCTTCCAGCTGCTGTTCACTCTATCCTGATCCAGACACCCTCAGGAA 5 0.125 No Hit ATTAGGGAGGCTGTTGAGCTTCCATTGACACATCATGAGTTGTACAAGCA 5 0.125 No Hit GCTTTGGCAACTGAGAGCATGCCTGACTCAAACCATCCTGTTTTCAAAGC 5 0.125 No Hit TGAAGAAGGCGCCCAGGACAGAGAGAGGGGCCCTCGGCCACCCTACCAGG 5 0.125 No Hit GGCAAAGAGGATTGGTGCAAGGTTTCTCCTCACCAGCACAAGTGAAGTCT 5 0.125 No Hit GGGAAAACCTGGGGCCTGTTCTCCTGGGAAACCTAAAGACTTCCTGAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.45 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 3.9125 0.0 0.0 0.0 0.0 112-113 4.4 0.0 0.0 0.0 0.0 114-115 4.800000000000001 0.0 0.0 0.0 0.0 116-117 5.2875 0.0 0.0 0.0 0.0 118-119 5.8125 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.95 0.0 0.0 0.0 0.0 124-125 7.762499999999999 0.0 0.0 0.0 0.0 126-127 8.4 0.0 0.0 0.0 0.0 128-129 8.712499999999999 0.0 0.0 0.0 0.0 130-131 9.375 0.0 0.0 0.0 0.0 132-133 10.275 0.0 0.0 0.0 0.0 134-135 11.0625 0.0 0.0 0.0 0.0 136-137 11.850000000000001 0.0 0.0 0.0 0.0 138-139 12.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAAAC 10 0.006830828 145.0 3 GAAACAA 10 0.006830828 145.0 5 CAACACA 10 0.006830828 145.0 9 AGAAACA 10 0.006830828 145.0 4 GGAGGTA 10 0.006830828 145.0 145 ACAACAC 10 0.006830828 145.0 8 GCGAGAA 10 0.006830828 145.0 1 GGGGGGG 170 7.2465907E-4 8.529412 145 >>END_MODULE Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928774 spots for SRR12951283.sra Written 1928774 spots for SRR12951283.sra Read 1928782 spots for SRR12951283.sra Written 1928782 spots for SRR12951283.sra SRR ids: ['SRR12951283.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ik05m45w SRR12951283.sra spots: 38575488 blocks: [[1, 1928774], [1928775, 3857548], [3857549, 5786322], [5786323, 7715096], [7715097, 9643870], [9643871, 11572644], [11572645, 13501418], [13501419, 15430192], [15430193, 17358966], [17358967, 19287740], [19287741, 21216514], [21216515, 23145288], [23145289, 25074062], [25074063, 27002836], [27002837, 28931610], [28931611, 30860384], [30860385, 32789158], [32789159, 34717932], [34717933, 36646706], [36646707, 38575488]] SRR12951283 file size 13087938 SRR12951283 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951283 SRR12951283_1.fastq SRR12951283_2.fastq Input file: SRR12951283_1.fastq Paired file: SRR12951283_2.fastq trimmed: SRR12951283-trimmed-pair1.fastq, SRR12951283-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:21:45 2024 >> started Sat Dec 7 10:22:26 2024 >> done (40.758s) 38575488 read pairs processed; of these: 383 ( 0.00%) short read pairs filtered out after trimming by size control 52456 ( 0.14%) empty read pairs filtered out after trimming by size control 38522649 (99.86%) read pairs available; of these: 6225711 (16.16%) trimmed read pairs available after processing 32296938 (83.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 35 0.00% 20 36 0.00% 21 35 0.00% 22 49 0.00% 23 57 0.00% 24 74 0.00% 25 64 0.00% 26 62 0.00% 27 91 0.00% 28 97 0.00% 29 86 0.00% 30 83 0.00% 31 75 0.00% 32 111 0.00% 33 106 0.00% 34 102 0.00% 35 121 0.00% 36 102 0.00% 37 125 0.00% 38 103 0.00% 39 136 0.00% 40 133 0.00% 41 136 0.00% 42 171 0.00% 43 160 0.00% 44 163 0.00% 45 233 0.00% 46 211 0.00% 47 245 0.00% 48 246 0.00% 49 342 0.00% 50 304 0.00% 51 355 0.00% 52 467 0.00% 53 433 0.00% 54 494 0.00% 55 605 0.00% 56 694 0.00% 57 729 0.00% 58 897 0.00% 59 1012 0.00% 60 1199 0.00% 61 1321 0.00% 62 1586 0.00% 63 1698 0.00% 64 1886 0.00% 65 2063 0.01% 66 2220 0.01% 67 2799 0.01% 68 2903 0.01% 69 3493 0.01% 70 4056 0.01% 71 4666 0.01% 72 5319 0.01% 73 6060 0.02% 74 6797 0.02% 75 7408 0.02% 76 8037 0.02% 77 8869 0.02% 78 10004 0.03% 79 11114 0.03% 80 12546 0.03% 81 14017 0.04% 82 15995 0.04% 83 17766 0.05% 84 19787 0.05% 85 21391 0.06% 86 22665 0.06% 87 24128 0.06% 88 26229 0.07% 89 27696 0.07% 90 30120 0.08% 91 32636 0.08% 92 35185 0.09% 93 38410 0.10% 94 41629 0.11% 95 43730 0.11% 96 46038 0.12% 97 48568 0.13% 98 49012 0.13% 99 50954 0.13% 100 54249 0.14% 101 56816 0.15% 102 59979 0.16% 103 63942 0.17% 104 65286 0.17% 105 69353 0.18% 106 71434 0.19% 107 72389 0.19% 108 74784 0.19% 109 77111 0.20% 110 77542 0.20% 111 80600 0.21% 112 84709 0.22% 113 86070 0.22% 114 91104 0.24% 115 94336 0.24% 116 95239 0.25% 117 97065 0.25% 118 98555 0.26% 119 98977 0.26% 120 101334 0.26% 121 103366 0.27% 122 105035 0.27% 123 108594 0.28% 124 111967 0.29% 125 113520 0.29% 126 117023 0.30% 127 116989 0.30% 128 117798 0.31% 129 119399 0.31% 130 119473 0.31% 131 120575 0.31% 132 123329 0.32% 133 125660 0.33% 134 126215 0.33% 135 129818 0.34% 136 131314 0.34% 137 131049 0.34% 138 132154 0.34% 139 135437 0.35% 140 133345 0.35% 141 134676 0.35% 142 137209 0.36% 143 137066 0.36% 144 139350 0.36% 145 143041 0.37% 146 142338 0.37% 147 144574 0.38% 148 144270 0.37% 149 143847 0.37% 150 144594 0.38% 151 32296938 83.84% 38522649 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=32 prefix-density=0.40 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=109.76 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.5 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=23 prefix-density=0.38 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=210.00 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=22.9 sequence=CGCCGCCGCCGTC SRR12951283 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:23:15 Started mapping on | Dec 07 10:23:15 Finished on | Dec 07 10:27:08 Mapping speed, Million of reads per hour | 595.20 Number of input reads | 38522649 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 36271333 Uniquely mapped reads % | 94.16% Average mapped length | 291.99 Number of splices: Total | 36374315 Number of splices: Annotated (sjdb) | 34154323 Number of splices: GT/AG | 35867525 Number of splices: GC/AG | 421846 Number of splices: AT/AC | 21473 Number of splices: Non-canonical | 63471 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379988 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 28757 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.41% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1871328 1871328 1871328 N_multimapping 379988 379988 379988 N_noFeature 1268853 35351511 1560373 N_ambiguous 755012 5504 128640 UnstrandedReadsAssigned:34247468 PositiveStrandReadsAssigned:914318 NegativeStrandReadsAssigned:34582320 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951283 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951283-trimmed-pair1.fastq SRR12951283-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,522,649 reads, 35,057,399 reads pseudoaligned [quant] estimated average fragment length: 255.088 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52973 SRR12951283.ke.tsv 35125 SRR12951283.se.tsv 88098 total ==> SRR12951283.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.443 0 0 PNS24247 1044 789.912 117.341 6.20969 PNS24249 1928 1673.91 391.232 9.77011 PNS24246 1044 789.912 117.341 6.20969 PNS24248 1044 789.912 117.341 6.20969 PNS24244 1471 1216.91 143.745 4.93777 PNS24243 293 107.78 1 0.387848 KQK14069 1603 1348.91 2398.06 74.3145 KQK14071 474 245.879 18.9119 3.21522 ==> SRR12951283.se.tsv <== BRADI_1g14170v3 2490 BRADI_1g53295v3 71 BRADI_1g59795v3 811 BRADI_1g07683v3 0 BRADI_1g00485v3 156 BRADI_1g20270v3 4501 BRADI_1g74790v3 498 BRADI_1g09890v3 52 BRADI_1g77505v3 678 BRADI_1g48960v3 3 SRR12951283 completed mapping pipeline successfully