Starting /dee2/code/volunteer_pipeline.sh SRR12951284 current disk space = 1543647100928 free memory = 1597302728 SRR12951284 SRAfilesize 7e004c07a9273adb57ca49b063007c5b SRR12951284.sra SRR12951284.sra file validated SRR12951284 is paired end SRR12951284 is conventional basespace SRR12951284 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951284_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4625 37.0 37.0 37.0 37.0 37.0 2 36.22775 37.0 37.0 37.0 37.0 37.0 3 36.4915 37.0 37.0 37.0 37.0 37.0 4 36.5375 37.0 37.0 37.0 37.0 37.0 5 36.581 37.0 37.0 37.0 37.0 37.0 6 36.5185 37.0 37.0 37.0 37.0 37.0 7 36.571 37.0 37.0 37.0 37.0 37.0 8 36.55 37.0 37.0 37.0 37.0 37.0 9 36.5415 37.0 37.0 37.0 37.0 37.0 10-14 36.59589999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.537099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5226 37.0 37.0 37.0 37.0 37.0 25-29 36.5642 37.0 37.0 37.0 37.0 37.0 30-34 36.5336 37.0 37.0 37.0 37.0 37.0 35-39 36.474000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.479699999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.43599999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4446 37.0 37.0 37.0 37.0 37.0 55-59 36.3775 37.0 37.0 37.0 37.0 37.0 60-64 36.3868 37.0 37.0 37.0 37.0 37.0 65-69 36.357299999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3263 37.0 37.0 37.0 37.0 37.0 75-79 36.312200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3626 37.0 37.0 37.0 37.0 37.0 85-89 36.2827 37.0 37.0 37.0 37.0 37.0 90-94 36.3245 37.0 37.0 37.0 37.0 37.0 95-99 36.2413 37.0 37.0 37.0 37.0 37.0 100-104 36.270799999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.273700000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.2202 37.0 37.0 37.0 37.0 37.0 115-119 36.249300000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0702 37.0 37.0 37.0 37.0 37.0 125-129 36.021 37.0 37.0 37.0 37.0 37.0 130-134 36.073899999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.0282 37.0 37.0 37.0 37.0 37.0 140-144 35.9259 37.0 37.0 37.0 37.0 37.0 145-149 35.9088 37.0 37.0 37.0 37.0 37.0 150-151 35.6515 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 6.0 27 7.0 28 7.0 29 14.0 30 31.0 31 27.0 32 50.0 33 77.0 34 103.0 35 300.0 36 2858.0 37 516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.85 11.5 4.0 34.65 2 20.842738901429648 10.709806872335088 36.2929520943065 32.15450213192877 3 21.349999999999998 14.374999999999998 28.050000000000004 36.225 4 26.35 20.849999999999998 24.175 28.625 5 29.475 26.6 21.85 22.075 6 24.925 30.925000000000004 20.275000000000002 23.875 7 19.15 24.474999999999998 38.7 17.675 8 21.075 20.825 32.175 25.924999999999997 9 21.625 20.65 32.6 25.124999999999996 10-14 23.880000000000003 25.945 24.37 25.805 15-19 23.880000000000003 24.2 25.755 26.165 20-24 24.060000000000002 24.955 25.395 25.590000000000003 25-29 23.985 25.724999999999998 24.37 25.919999999999998 30-34 23.95 24.425 24.68 26.945000000000004 35-39 24.044999999999998 24.985 24.465 26.505000000000003 40-44 23.990000000000002 25.245 25.575 25.19 45-49 23.419999999999998 24.709999999999997 25.22 26.650000000000002 50-54 24.235 25.35 24.445 25.97 55-59 24.07 25.009999999999998 24.755 26.165 60-64 24.64 25.165 24.45 25.745 65-69 24.044999999999998 24.825 24.740000000000002 26.39 70-74 24.29 24.97 24.9 25.840000000000003 75-79 25.145 24.13 24.75 25.974999999999998 80-84 24.725 25.44 23.95 25.885 85-89 24.709999999999997 24.925 24.36 26.005 90-94 25.055 24.45 24.44 26.055 95-99 25.540000000000003 25.080000000000002 24.044999999999998 25.335 100-104 25.290000000000003 24.44 24.23 26.040000000000003 105-109 24.825 24.38 24.865000000000002 25.929999999999996 110-114 24.47 25.53 23.82 26.179999999999996 115-119 25.674999999999997 24.925 23.97 25.430000000000003 120-124 25.365 24.875 23.53 26.229999999999997 125-129 25.52 24.825 23.455000000000002 26.200000000000003 130-134 25.09 24.635 24.22 26.055 135-139 25.564999999999998 24.310000000000002 24.005000000000003 26.119999999999997 140-144 24.895 24.255 23.93 26.919999999999998 145-149 24.875 24.195 24.315 26.615 150-151 25.75 24.2375 23.674999999999997 26.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 0.0 27 0.5 28 3.5 29 5.5 30 5.0 31 8.5 32 13.5 33 19.5 34 23.0 35 34.5 36 48.0 37 49.5 38 63.5 39 90.5 40 114.0 41 129.5 42 150.5 43 173.0 44 177.0 45 183.5 46 200.0 47 196.5 48 180.5 49 172.0 50 170.5 51 160.5 52 137.5 53 125.5 54 115.0 55 99.5 56 90.5 57 85.0 58 81.0 59 71.0 60 66.5 61 66.0 62 61.0 63 63.0 64 60.5 65 51.5 66 58.5 67 59.0 68 52.5 69 44.0 70 32.0 71 27.5 72 31.0 73 36.5 74 31.0 75 24.0 76 17.0 77 14.0 78 12.5 79 6.5 80 1.5 81 1.5 82 1.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.5 #Duplication Level Percentage of deduplicated Percentage of total 1 80.9119496855346 64.325 2 14.40251572327044 22.900000000000002 3 3.238993710691824 7.725 4 0.9433962264150944 3.0 5 0.4716981132075472 1.875 6 0.0 0.0 7 0.031446540880503145 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTACACGTGGCGCTGCCATGAAATAGCTGCGATATTTGAACGGTCCTGCC 7 0.17500000000000002 No Hit GTTGGACTTGGGGTATGCGTGGCAGGTGAGCACCCACCCGGCCTCCATCT 5 0.125 No Hit ACGCTTTGTATTGAGGGCCCATAGATGAATATGAAACATAATTAGAGACA 5 0.125 No Hit GGCCATTCCTCAGTTGGGCTCACTGCAGACCTTTTATATTTACTCAGCTC 5 0.125 No Hit CAGCAAAGTATCCAAGTCTGTTCGAACCAGAACATACTCCTGAAAGTCGC 5 0.125 No Hit CCCATAAGTTTCCACCAACATCACTAAACTACATCCTTCACAGCAGCTTC 5 0.125 No Hit CGCTCCTCAGACAATGTAATCCCTGTGTATTTGCAGCCAGTTTGCTTCAC 5 0.125 No Hit CTCTTCTTCTCCGGTTGAGATGCCGCTGCCGTGATCTCAGAGCTGAAATC 5 0.125 No Hit GGGGAAGTTGACGGCGAAGGAGAAGGCGCCCGGCATGATCCAGAGCGCGA 5 0.125 No Hit GTGTGCACTCTGATGCGGACTATGGCAGTCCAGAAGATACACGAACAAAG 5 0.125 No Hit CTTGTGCGTCTCGATGACGAGGTCGGACTTGGGGTATGCGTGGCAGGTGA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAGTGTTATCTCGTAT 5 0.125 TruSeq Adapter, Index 5 (97% over 39bp) GCCTCTTCTCCGGCCTCGGCGGGTCGTACCCGTACAGCGCCTGCCTGTTG 5 0.125 No Hit CAGCAAATGTACTTGAGGCACCCAACAAAATATTATAATTAAAAAACCTA 5 0.125 No Hit AGCGCGTAGTCGAGCGAGATGACGCCCGCGTTCTCCGCGTAGGCGAAGAA 5 0.125 No Hit AGAATCACTCCACAAGTGTGACGTCGAAATGTTACCGATTTCATCCCTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.7250000000000001 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.3 0.0 0.0 0.0 0.0 90-91 1.6375 0.0 0.0 0.0 0.0 92-93 1.7875 0.0 0.0 0.0 0.0 94-95 2.0625 0.0 0.0 0.0 0.0 96-97 2.275 0.0 0.0 0.0 0.0 98-99 2.4375 0.0 0.0 0.0 0.0 100-101 2.875 0.0 0.0 0.0 0.0 102-103 3.2625 0.0 0.0 0.0 0.0 104-105 3.5875 0.0 0.0 0.0 0.0 106-107 3.8875 0.0 0.0 0.0 0.0 108-109 4.2875 0.0 0.0 0.0 0.0 110-111 4.9375 0.0 0.0 0.0 0.0 112-113 5.65 0.0 0.0 0.0 0.0 114-115 6.25 0.0 0.0 0.0 0.0 116-117 6.775 0.0 0.0 0.0 0.0 118-119 7.574999999999999 0.0 0.0 0.0 0.0 120-121 8.287500000000001 0.0 0.0 0.0 0.0 122-123 8.975000000000001 0.0 0.0 0.0 0.0 124-125 9.725 0.0 0.0 0.0 0.0 126-127 10.4875 0.0 0.0 0.0 0.0 128-129 11.125 0.0 0.0 0.0 0.0 130-131 11.875 0.0 0.0 0.0 0.0 132-133 12.6125 0.0 0.0 0.0 0.0 134-135 13.425 0.0 0.0 0.0 0.0 136-137 14.425 0.0 0.0 0.0 0.0 138-139 15.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCCA 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR12951284 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951284_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1475 37.0 37.0 37.0 37.0 37.0 2 36.087 37.0 37.0 37.0 37.0 37.0 3 36.1195 37.0 37.0 37.0 37.0 37.0 4 36.0035 37.0 37.0 37.0 37.0 37.0 5 35.9585 37.0 37.0 37.0 37.0 37.0 6 35.988 37.0 37.0 37.0 37.0 37.0 7 35.9745 37.0 37.0 37.0 37.0 37.0 8 36.2145 37.0 37.0 37.0 37.0 37.0 9 36.142 37.0 37.0 37.0 37.0 37.0 10-14 36.1155 37.0 37.0 37.0 37.0 37.0 15-19 36.08819999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.0305 37.0 37.0 37.0 37.0 37.0 25-29 35.990899999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9495 37.0 37.0 37.0 37.0 37.0 35-39 35.9489 37.0 37.0 37.0 37.0 37.0 40-44 35.9139 37.0 37.0 37.0 37.0 37.0 45-49 35.895799999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.8374 37.0 37.0 37.0 37.0 37.0 55-59 35.854699999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.84689999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.8394 37.0 37.0 37.0 37.0 37.0 70-74 35.7804 37.0 37.0 37.0 37.0 37.0 75-79 35.7327 37.0 37.0 37.0 37.0 37.0 80-84 35.74870000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.6681 37.0 37.0 37.0 37.0 37.0 90-94 35.7124 37.0 37.0 37.0 37.0 37.0 95-99 35.643600000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.616200000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.5147 37.0 37.0 37.0 37.0 37.0 110-114 35.54260000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.563300000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.395599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.3553 37.0 37.0 37.0 37.0 37.0 130-134 35.1978 37.0 37.0 37.0 34.6 37.0 135-139 35.1126 37.0 37.0 37.0 29.8 37.0 140-144 35.0957 37.0 37.0 37.0 27.4 37.0 145-149 34.888099999999994 37.0 37.0 37.0 25.0 37.0 150-151 34.60275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 5.0 15 6.0 16 3.0 17 3.0 18 1.0 19 6.0 20 7.0 21 12.0 22 9.0 23 10.0 24 8.0 25 8.0 26 11.0 27 16.0 28 17.0 29 13.0 30 36.0 31 34.0 32 63.0 33 78.0 34 198.0 35 550.0 36 2623.0 37 273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.725 21.025 6.2 27.05 2 31.324999999999996 22.925 24.3 21.45 3 24.775 23.799999999999997 29.725 21.7 4 26.150000000000002 31.424999999999997 19.625 22.8 5 25.95 33.525 19.275000000000002 21.25 6 24.025 35.25 18.275 22.45 7 24.95 19.675 32.675 22.7 8 22.0 22.125 23.5 32.375 9 26.875 22.975 24.3 25.85 10-14 27.189999999999998 24.455 22.23 26.125 15-19 27.12 24.585 22.865 25.430000000000003 20-24 26.525 25.119999999999997 23.255 25.1 25-29 26.740000000000002 25.005 22.82 25.435000000000002 30-34 26.595000000000002 24.705 23.465 25.235000000000003 35-39 26.345000000000002 24.66 23.575 25.419999999999998 40-44 26.97 24.395 23.54 25.095 45-49 26.345000000000002 24.715 23.46 25.480000000000004 50-54 26.505000000000003 23.97 23.855 25.669999999999998 55-59 26.619999999999997 24.515 23.36 25.505 60-64 26.82 24.775 23.625 24.779999999999998 65-69 26.125 25.845000000000002 23.47 24.560000000000002 70-74 26.474999999999998 25.124999999999996 23.16 25.240000000000002 75-79 26.44 25.09 23.59 24.88 80-84 26.369999999999997 25.16 23.549999999999997 24.92 85-89 26.945000000000004 24.315 23.875 24.865000000000002 90-94 26.735 25.205 24.04 24.02 95-99 26.645000000000003 24.915000000000003 23.745 24.695 100-104 27.21 25.380000000000003 23.24 24.169999999999998 105-109 26.919999999999998 24.610000000000003 23.5 24.97 110-114 27.005000000000003 24.57 23.830000000000002 24.595 115-119 27.625 25.080000000000002 22.785 24.51 120-124 28.165000000000003 24.9 23.305 23.630000000000003 125-129 28.549999999999997 25.25 23.09 23.11 130-134 29.81 24.935 21.884999999999998 23.369999999999997 135-139 29.054999999999996 24.985 23.26 22.7 140-144 30.099999999999998 24.474999999999998 23.150000000000002 22.275 145-149 30.895 24.695 22.345000000000002 22.065 150-151 31.0625 23.962500000000002 23.375 21.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 4.0 28 6.5 29 6.5 30 7.0 31 6.5 32 8.0 33 10.5 34 19.0 35 27.5 36 34.5 37 44.5 38 58.0 39 77.5 40 108.0 41 143.5 42 151.5 43 162.0 44 169.5 45 163.5 46 166.0 47 179.5 48 166.5 49 152.0 50 156.5 51 136.0 52 130.0 53 136.5 54 125.5 55 105.0 56 98.5 57 87.0 58 69.5 59 71.0 60 78.0 61 86.5 62 71.5 63 64.0 64 78.0 65 65.0 66 59.5 67 76.0 68 64.0 69 49.5 70 51.0 71 52.0 72 51.0 73 32.5 74 19.5 75 17.5 76 16.0 77 13.0 78 10.0 79 6.0 80 2.0 81 3.0 82 3.5 83 2.0 84 2.0 85 2.0 86 1.0 87 1.0 88 1.0 89 0.5 90 1.0 91 1.5 92 0.5 93 2.0 94 2.5 95 1.0 96 2.0 97 2.5 98 1.5 99 2.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.45 #Duplication Level Percentage of deduplicated Percentage of total 1 81.85208203853324 65.85 2 13.766314481044125 22.15 3 3.2318210068365447 7.8 4 0.8079552517091362 2.6 5 0.27967681789931637 1.125 6 0.0 0.0 7 0.031075201988812924 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.031075201988812924 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GTAGCAGCGGCGGCTGCTTATCTGAAGGATACCATAGGGAAGGAAGGCGT 7 0.17500000000000002 No Hit GAGGAAGAAGGGATCGACCTGCCCTACTCGTGCAGGGCCGGGTCGTGCTC 5 0.125 No Hit GTGGTGAGCCTCCTCAAGCAGCACGGCATCACGCAGGTGAAGCTCTACGA 5 0.125 No Hit AGGAAAGGGAAACAAGAACTGGAAGTGCGAGAGAGATGCCGGAGCTGCCG 5 0.125 No Hit AGAATCCCGAGGACAACTCCGCCTACGTCTCCGTCTTCATCGCGCTCGCC 5 0.125 No Hit TGGGCACCAATGGTGTACATAGTCACCAACAGCTAACCTTAGTACTGTGT 5 0.125 No Hit AGAAGATAGTAGGATCTCCTGATTGGCTACTTAATTGTGGCGTGGTTAAT 5 0.125 No Hit AAGTAGCCCAGCTACGTAAAGTTAACCTCCTAATAGACAAGGCTAAGGTG 5 0.125 No Hit CCATCTTTTCATGAGAACCCTTATTGCAAGGCATTAAATAATGCCAAGGA 5 0.125 No Hit CCCCATTTTCCTACTCCCCTGTTATTGTCCACTTTGAGAACAACAACCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.025 0.0 0.025 0.0 0.0 40-41 0.05 0.0 0.025 0.0 0.0 42-43 0.05 0.0 0.025 0.0 0.0 44-45 0.05 0.0 0.025 0.0 0.0 46-47 0.05 0.0 0.025 0.0 0.0 48-49 0.05 0.0 0.025 0.0 0.0 50-51 0.075 0.0 0.025 0.0 0.0 52-53 0.075 0.0 0.025 0.0 0.0 54-55 0.075 0.0 0.025 0.0 0.0 56-57 0.075 0.0 0.025 0.0 0.0 58-59 0.075 0.0 0.025 0.0 0.0 60-61 0.075 0.0 0.025 0.0 0.0 62-63 0.0875 0.0 0.025 0.0 0.0 64-65 0.1 0.0 0.025 0.0 0.0 66-67 0.1 0.0 0.025 0.0 0.0 68-69 0.1 0.0 0.025 0.0 0.0 70-71 0.2 0.0 0.025 0.0 0.0 72-73 0.275 0.0 0.025 0.0 0.0 74-75 0.325 0.0 0.025 0.0 0.0 76-77 0.375 0.0 0.025 0.0 0.0 78-79 0.44999999999999996 0.0 0.025 0.0 0.0 80-81 0.55 0.0 0.025 0.0 0.0 82-83 0.7 0.0 0.025 0.0 0.0 84-85 0.8625 0.0 0.025 0.0 0.0 86-87 1.0 0.0 0.025 0.0 0.0 88-89 1.275 0.0 0.025 0.0 0.0 90-91 1.6 0.0 0.025 0.0 0.0 92-93 1.7375 0.0 0.025 0.0 0.0 94-95 2.0125 0.0 0.025 0.0 0.0 96-97 2.25 0.0 0.025 0.0 0.0 98-99 2.4124999999999996 0.0 0.025 0.0 0.0 100-101 2.85 0.0 0.025 0.0 0.0 102-103 3.275 0.0 0.025 0.0 0.0 104-105 3.6125 0.0 0.025 0.0 0.0 106-107 3.9125 0.0 0.025 0.0 0.0 108-109 4.3375 0.0 0.025 0.0 0.0 110-111 4.987500000000001 0.0 0.025 0.0 0.0 112-113 5.7 0.0 0.025 0.0 0.0 114-115 6.3 0.0 0.025 0.0 0.0 116-117 6.824999999999999 0.0 0.025 0.0 0.0 118-119 7.625 0.0 0.025 0.0 0.0 120-121 8.3125 0.0 0.025 0.0 0.0 122-123 9.0 0.0 0.025 0.0 0.0 124-125 9.75 0.0 0.025 0.0 0.0 126-127 10.525 0.0 0.025 0.0 0.0 128-129 11.175 0.0 0.025 0.0 0.0 130-131 11.9125 0.0 0.025 0.0 0.0 132-133 12.6125 0.0 0.025 0.0 0.0 134-135 13.425 0.0 0.025 0.0 0.0 136-137 14.4125 0.0 0.025 0.0 0.0 138-139 15.0875 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTAA 10 0.006830828 145.0 8 TGTAGGG 35 0.0035366106 20.714287 135-139 >>END_MODULE Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799466 spots for SRR12951284.sra Written 1799466 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra Read 1799453 spots for SRR12951284.sra Written 1799453 spots for SRR12951284.sra SRR ids: ['SRR12951284.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mwfxombk SRR12951284.sra spots: 35989073 blocks: [[1, 1799453], [1799454, 3598906], [3598907, 5398359], [5398360, 7197812], [7197813, 8997265], [8997266, 10796718], [10796719, 12596171], [12596172, 14395624], [14395625, 16195077], [16195078, 17994530], [17994531, 19793983], [19793984, 21593436], [21593437, 23392889], [23392890, 25192342], [25192343, 26991795], [26991796, 28791248], [28791249, 30590701], [30590702, 32390154], [32390155, 34189607], [34189608, 35989073]] SRR12951284 file size 12208961 SRR12951284 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951284 SRR12951284_1.fastq SRR12951284_2.fastq Input file: SRR12951284_1.fastq Paired file: SRR12951284_2.fastq trimmed: SRR12951284-trimmed-pair1.fastq, SRR12951284-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:22:42 2024 >> started Sat Dec 7 10:23:29 2024 >> done (46.175s) 35989073 read pairs processed; of these: 370 ( 0.00%) short read pairs filtered out after trimming by size control 86911 ( 0.24%) empty read pairs filtered out after trimming by size control 35901792 (99.76%) read pairs available; of these: 6620992 (18.44%) trimmed read pairs available after processing 29280800 (81.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 31 0.00% 20 32 0.00% 21 46 0.00% 22 47 0.00% 23 58 0.00% 24 76 0.00% 25 73 0.00% 26 90 0.00% 27 113 0.00% 28 105 0.00% 29 95 0.00% 30 116 0.00% 31 133 0.00% 32 125 0.00% 33 124 0.00% 34 133 0.00% 35 141 0.00% 36 142 0.00% 37 151 0.00% 38 186 0.00% 39 198 0.00% 40 207 0.00% 41 198 0.00% 42 167 0.00% 43 227 0.00% 44 203 0.00% 45 244 0.00% 46 262 0.00% 47 319 0.00% 48 388 0.00% 49 429 0.00% 50 464 0.00% 51 562 0.00% 52 645 0.00% 53 605 0.00% 54 703 0.00% 55 784 0.00% 56 877 0.00% 57 1049 0.00% 58 1262 0.00% 59 1368 0.00% 60 1701 0.00% 61 1941 0.01% 62 2176 0.01% 63 2421 0.01% 64 2660 0.01% 65 2860 0.01% 66 3277 0.01% 67 3814 0.01% 68 4219 0.01% 69 4889 0.01% 70 5723 0.02% 71 6598 0.02% 72 7743 0.02% 73 8584 0.02% 74 9353 0.03% 75 10531 0.03% 76 11261 0.03% 77 12406 0.03% 78 13552 0.04% 79 15317 0.04% 80 16631 0.05% 81 19020 0.05% 82 21188 0.06% 83 23124 0.06% 84 25779 0.07% 85 27282 0.08% 86 28963 0.08% 87 30353 0.08% 88 32264 0.09% 89 34057 0.09% 90 36772 0.10% 91 39595 0.11% 92 42065 0.12% 93 45859 0.13% 94 49124 0.14% 95 51375 0.14% 96 53559 0.15% 97 55412 0.15% 98 57003 0.16% 99 59458 0.17% 100 61157 0.17% 101 64557 0.18% 102 67440 0.19% 103 70236 0.20% 104 73266 0.20% 105 76682 0.21% 106 78850 0.22% 107 79712 0.22% 108 81617 0.23% 109 83619 0.23% 110 84869 0.24% 111 88099 0.25% 112 91478 0.25% 113 93030 0.26% 114 96981 0.27% 115 99604 0.28% 116 102601 0.29% 117 103784 0.29% 118 104321 0.29% 119 106107 0.30% 120 106560 0.30% 121 108814 0.30% 122 110922 0.31% 123 114239 0.32% 124 118309 0.33% 125 118740 0.33% 126 121707 0.34% 127 121675 0.34% 128 122957 0.34% 129 124888 0.35% 130 123631 0.34% 131 123780 0.34% 132 127516 0.36% 133 129127 0.36% 134 129976 0.36% 135 132693 0.37% 136 134073 0.37% 137 134316 0.37% 138 134692 0.38% 139 137122 0.38% 140 135541 0.38% 141 136164 0.38% 142 137787 0.38% 143 137311 0.38% 144 141109 0.39% 145 142782 0.40% 146 142168 0.40% 147 144593 0.40% 148 141769 0.39% 149 141972 0.40% 150 142943 0.40% 151 29280800 81.56% 35901792 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.33 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=108.80 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.9 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.21 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=210.63 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=21.6 sequence=CGCCGCCGCCGTC SRR12951284 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:24:10 Started mapping on | Dec 07 10:24:10 Finished on | Dec 07 10:27:52 Mapping speed, Million of reads per hour | 582.19 Number of input reads | 35901792 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 33964793 Uniquely mapped reads % | 94.60% Average mapped length | 290.36 Number of splices: Total | 34487526 Number of splices: Annotated (sjdb) | 32424186 Number of splices: GT/AG | 34016860 Number of splices: GC/AG | 391842 Number of splices: AT/AC | 21251 Number of splices: Non-canonical | 57573 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.72 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377649 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 38799 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1559350 1559350 1559350 N_multimapping 377649 377649 377649 N_noFeature 1118908 33124332 1376726 N_ambiguous 684208 5175 102910 UnstrandedReadsAssigned:32161677 PositiveStrandReadsAssigned:835286 NegativeStrandReadsAssigned:32485157 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951284 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951284-trimmed-pair1.fastq SRR12951284-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,901,792 reads, 32,985,256 reads pseudoaligned [quant] estimated average fragment length: 245.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52973 SRR12951284.ke.tsv 35125 SRR12951284.se.tsv 88098 total ==> SRR12951284.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.369 0 0 PNS24247 1044 799.046 69.8552 3.93872 PNS24249 1928 1683.05 373.157 9.98905 PNS24246 1044 799.046 69.8552 3.93872 PNS24248 1044 799.046 69.8552 3.93872 PNS24244 1471 1226.05 158.277 5.8162 PNS24243 293 111.147 1 0.40535 KQK14069 1603 1358.05 1423.66 47.2304 KQK14071 474 252.43 22.3541 3.98973 ==> SRR12951284.se.tsv <== BRADI_1g14170v3 1598 BRADI_1g53295v3 57 BRADI_1g59795v3 630 BRADI_1g07683v3 0 BRADI_1g00485v3 165 BRADI_1g20270v3 6001 BRADI_1g74790v3 349 BRADI_1g09890v3 54 BRADI_1g77505v3 597 BRADI_1g48960v3 1 SRR12951284 completed mapping pipeline successfully