Starting /dee2/code/volunteer_pipeline.sh SRR12951286 current disk space = 1543574540288 free memory = 1598509800 SRR12951286 SRAfilesize 7c213d9b070d83c0575999e691a805fa SRR12951286.sra SRR12951286.sra file validated SRR12951286 is paired end SRR12951286 is conventional basespace SRR12951286 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951286_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5675 37.0 37.0 37.0 37.0 37.0 2 36.29225 37.0 37.0 37.0 37.0 37.0 3 36.494 37.0 37.0 37.0 37.0 37.0 4 36.5505 37.0 37.0 37.0 37.0 37.0 5 36.6935 37.0 37.0 37.0 37.0 37.0 6 36.609 37.0 37.0 37.0 37.0 37.0 7 36.5365 37.0 37.0 37.0 37.0 37.0 8 36.647 37.0 37.0 37.0 37.0 37.0 9 36.666 37.0 37.0 37.0 37.0 37.0 10-14 36.6469 37.0 37.0 37.0 37.0 37.0 15-19 36.6044 37.0 37.0 37.0 37.0 37.0 20-24 36.6052 37.0 37.0 37.0 37.0 37.0 25-29 36.531099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5805 37.0 37.0 37.0 37.0 37.0 35-39 36.53099999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4513 37.0 37.0 37.0 37.0 37.0 45-49 36.4595 37.0 37.0 37.0 37.0 37.0 50-54 36.459 37.0 37.0 37.0 37.0 37.0 55-59 36.451 37.0 37.0 37.0 37.0 37.0 60-64 36.399800000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3628 37.0 37.0 37.0 37.0 37.0 70-74 36.3019 37.0 37.0 37.0 37.0 37.0 75-79 36.3356 37.0 37.0 37.0 37.0 37.0 80-84 36.3964 37.0 37.0 37.0 37.0 37.0 85-89 36.352 37.0 37.0 37.0 37.0 37.0 90-94 36.353300000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.3447 37.0 37.0 37.0 37.0 37.0 100-104 36.3106 37.0 37.0 37.0 37.0 37.0 105-109 36.2714 37.0 37.0 37.0 37.0 37.0 110-114 36.2105 37.0 37.0 37.0 37.0 37.0 115-119 36.2322 37.0 37.0 37.0 37.0 37.0 120-124 36.151799999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.1176 37.0 37.0 37.0 37.0 37.0 130-134 36.105399999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.117200000000004 37.0 37.0 37.0 37.0 37.0 140-144 36.0141 37.0 37.0 37.0 37.0 37.0 145-149 36.0662 37.0 37.0 37.0 37.0 37.0 150-151 35.92225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 3.0 25 0.0 26 1.0 27 6.0 28 8.0 29 11.0 30 17.0 31 31.0 32 50.0 33 61.0 34 118.0 35 268.0 36 2918.0 37 505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.875 11.75 3.5249999999999995 41.85 2 19.83429575696711 10.343961837810696 37.30856138589003 32.51318101933216 3 16.825000000000003 13.600000000000001 26.6 42.975 4 25.2 20.225 21.925 32.65 5 26.5 26.224999999999998 22.975 24.3 6 23.65 30.0 22.225 24.125 7 19.75 24.25 37.724999999999994 18.275 8 18.875 23.75 29.525000000000002 27.85 9 20.1 21.2 32.625 26.075 10-14 23.345 26.33 24.685000000000002 25.64 15-19 23.41 25.55 24.845 26.195 20-24 23.630000000000003 24.990000000000002 25.155 26.224999999999998 25-29 23.44 25.135 24.779999999999998 26.645000000000003 30-34 24.224999999999998 24.545 24.515 26.715 35-39 23.93 24.29 25.480000000000004 26.3 40-44 23.815 24.94 25.005 26.240000000000002 45-49 23.74 24.515 25.19 26.555 50-54 23.849999999999998 24.995 24.45 26.705000000000002 55-59 23.98 24.27 25.1 26.650000000000002 60-64 24.42 24.515 24.455 26.61 65-69 24.07 24.955 24.765 26.21 70-74 24.245 25.259999999999998 24.135 26.36 75-79 24.26 24.495 24.44 26.805 80-84 24.59 24.185000000000002 24.65 26.575 85-89 24.03 24.565 25.064999999999998 26.340000000000003 90-94 24.715 24.685000000000002 24.42 26.179999999999996 95-99 25.009999999999998 24.725 24.145 26.119999999999997 100-104 24.32 24.77 24.715 26.195 105-109 24.725 24.67 24.895 25.71 110-114 24.95 24.865000000000002 24.235 25.95 115-119 24.895 24.335 24.560000000000002 26.21 120-124 25.430000000000003 24.535 23.645 26.39 125-129 24.93 24.79 23.925 26.355 130-134 25.185000000000002 24.240000000000002 23.799999999999997 26.775 135-139 24.945 25.09 23.630000000000003 26.334999999999997 140-144 24.93 24.83 23.96 26.279999999999998 145-149 24.72 24.785 23.580000000000002 26.915 150-151 24.5125 25.087500000000002 23.3125 27.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.0 28 1.5 29 2.5 30 4.5 31 6.5 32 9.5 33 11.0 34 11.5 35 28.0 36 45.5 37 62.0 38 74.0 39 84.5 40 98.5 41 106.0 42 147.5 43 180.5 44 200.0 45 218.5 46 215.5 47 192.5 48 174.5 49 177.5 50 170.5 51 161.5 52 153.5 53 126.0 54 118.5 55 111.5 56 77.5 57 57.5 58 62.5 59 72.5 60 64.0 61 61.5 62 61.5 63 51.5 64 50.5 65 70.0 66 67.5 67 58.5 68 48.5 69 44.5 70 46.0 71 38.0 72 42.5 73 37.0 74 25.5 75 17.0 76 14.5 77 14.0 78 8.5 79 5.0 80 2.5 81 3.0 82 2.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.5 #Duplication Level Percentage of deduplicated Percentage of total 1 81.86335403726707 65.9 2 13.881987577639752 22.35 3 2.981366459627329 7.199999999999999 4 0.9006211180124223 2.9000000000000004 5 0.2484472049689441 1.0 6 0.09316770186335403 0.44999999999999996 7 0.0 0.0 8 0.031055900621118012 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTCTTCTAAATTCTCCAGGTCTTGTACAACGGAGCTTCAAGAGATCTG 8 0.2 No Hit CCTGCAGCTTGTGCAGCATTCTTCATCTCCTCACCATACTTGTCCTTTCC 6 0.15 No Hit GTCAGATCGAGATGGTCTGCGCGCTCCAGGACCAAGCACGCGGCGCCGGA 6 0.15 No Hit GGGCATATATCAGACCGGAGTTTTGCTTCTAGATTCCCAGTAGCTTGAGC 6 0.15 No Hit CGTTGCTCTCAAGGACGCCCAGGAGGCACTCGACCGCACCAGCCTCCACC 5 0.125 No Hit CATAAGGACAAATAAGATTATGCCACAGGACCAAACATCAGCAGCCATAC 5 0.125 No Hit TTTTTTTTTTTTTACTGTCCGGCTATGTAAGCTGCCGTCTGGAAGAGTTA 5 0.125 No Hit CCTGCATCCTTCAGTCCATCAACTAGTAATGCTTTCTTTGCGCTGTAGTC 5 0.125 No Hit CCGAGAGAAGCTAAACCATAGGCATACTGTGCAACATTTGTGCGGTCTAA 5 0.125 No Hit CGCCAGATGACGTCCGTCTGAATGTGAAAGAGCCTAACCTAGCTGCTAGA 5 0.125 No Hit GGTGCTTATTTTCGTCACAATCTCCACAACAATCACTTTGTCATGCTGCC 5 0.125 No Hit CCGGGCATCAGGCTCAGCGTCGTCGCCGGGGCGCGGGGCGCGGTCGCCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.65 0.0 0.0 0.0 0.0 116-117 4.2625 0.0 0.0 0.0 0.0 118-119 4.675000000000001 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 5.9125 0.0 0.0 0.0 0.0 126-127 6.45 0.0 0.0 0.0 0.0 128-129 7.074999999999999 0.0 0.0 0.0 0.0 130-131 7.7125 0.0 0.0 0.0 0.0 132-133 8.399999999999999 0.0 0.0 0.0 0.0 134-135 9.2625 0.0 0.0 0.0 0.0 136-137 10.0375 0.0 0.0 0.0 0.0 138-139 10.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTGAC 10 0.006830828 145.0 3 TCTAATT 10 0.006830828 145.0 8 CTAATTG 10 0.006830828 145.0 9 TATTCTA 10 0.006830828 145.0 5 TTCTAAT 10 0.006830828 145.0 7 ATTCTAA 10 0.006830828 145.0 6 CATATTC 10 0.006830828 145.0 3 ATATTCT 10 0.006830828 145.0 4 GCATATT 10 0.006830828 145.0 2 AAAAAAA 20 0.00593511 29.0 115-119 >>END_MODULE SRR12951286 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951286_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.214 37.0 37.0 37.0 37.0 37.0 2 36.202 37.0 37.0 37.0 37.0 37.0 3 36.212 37.0 37.0 37.0 37.0 37.0 4 36.274 37.0 37.0 37.0 37.0 37.0 5 36.3135 37.0 37.0 37.0 37.0 37.0 6 36.228 37.0 37.0 37.0 37.0 37.0 7 36.124 37.0 37.0 37.0 37.0 37.0 8 36.2715 37.0 37.0 37.0 37.0 37.0 9 36.3795 37.0 37.0 37.0 37.0 37.0 10-14 36.3163 37.0 37.0 37.0 37.0 37.0 15-19 36.260299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.225300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.199 37.0 37.0 37.0 37.0 37.0 30-34 36.1716 37.0 37.0 37.0 37.0 37.0 35-39 36.146100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1253 37.0 37.0 37.0 37.0 37.0 45-49 36.144400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.095800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0882 37.0 37.0 37.0 37.0 37.0 60-64 36.0502 37.0 37.0 37.0 37.0 37.0 65-69 36.06 37.0 37.0 37.0 37.0 37.0 70-74 36.0098 37.0 37.0 37.0 37.0 37.0 75-79 35.9636 37.0 37.0 37.0 37.0 37.0 80-84 36.002300000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8928 37.0 37.0 37.0 37.0 37.0 90-94 35.9334 37.0 37.0 37.0 37.0 37.0 95-99 35.9457 37.0 37.0 37.0 37.0 37.0 100-104 35.8789 37.0 37.0 37.0 37.0 37.0 105-109 35.846599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.8154 37.0 37.0 37.0 37.0 37.0 115-119 35.8731 37.0 37.0 37.0 37.0 37.0 120-124 35.7922 37.0 37.0 37.0 37.0 37.0 125-129 35.74589999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.6489 37.0 37.0 37.0 37.0 37.0 135-139 35.6396 37.0 37.0 37.0 37.0 37.0 140-144 35.4827 37.0 37.0 37.0 37.0 37.0 145-149 35.32170000000001 37.0 37.0 37.0 34.6 37.0 150-151 35.06225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 2.0 16 4.0 17 3.0 18 8.0 19 5.0 20 3.0 21 4.0 22 6.0 23 4.0 24 6.0 25 2.0 26 5.0 27 10.0 28 11.0 29 11.0 30 14.0 31 31.0 32 44.0 33 65.0 34 172.0 35 485.0 36 2758.0 37 338.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 25.374999999999996 6.0249999999999995 29.775000000000002 2 29.975 22.825 27.975 19.225 3 21.45 24.775 31.025000000000002 22.75 4 25.124999999999996 28.749999999999996 21.375 24.75 5 27.250000000000004 32.75 19.400000000000002 20.599999999999998 6 24.175 34.449999999999996 19.825 21.55 7 24.325 18.625 33.975 23.075000000000003 8 24.6 23.925 24.15 27.325 9 23.375 22.075 26.924999999999997 27.625 10-14 26.640000000000004 25.674999999999997 22.14 25.545 15-19 26.595000000000002 24.37 23.78 25.255 20-24 26.784999999999997 25.335 23.01 24.87 25-29 26.68 24.45 24.03 24.84 30-34 26.6 25.285000000000004 23.26 24.855 35-39 27.134999999999998 24.97 22.89 25.005 40-44 26.484999999999996 24.38 23.325000000000003 25.81 45-49 25.985000000000003 24.685000000000002 24.0 25.330000000000002 50-54 26.490000000000002 24.775 24.125 24.610000000000003 55-59 27.16 23.845 24.175 24.82 60-64 27.224999999999998 24.095 24.145 24.535 65-69 27.474999999999998 25.119999999999997 23.330000000000002 24.075 70-74 27.450000000000003 24.425 23.29 24.834999999999997 75-79 27.01 24.085 24.09 24.815 80-84 25.77 24.485 24.740000000000002 25.005 85-89 27.315 24.365000000000002 24.425 23.895 90-94 26.695 24.315 24.15 24.84 95-99 27.76 23.735 23.94 24.565 100-104 27.515 25.569999999999997 23.05 23.865 105-109 27.944999999999997 24.48 23.525 24.05 110-114 27.165 24.695 23.505000000000003 24.635 115-119 27.52 25.095 23.080000000000002 24.305 120-124 27.450000000000003 24.915000000000003 23.62 24.015 125-129 28.249999999999996 24.87 23.62 23.26 130-134 28.970000000000002 24.965 22.645 23.419999999999998 135-139 28.794999999999998 24.715 22.85 23.64 140-144 29.360000000000003 25.555 22.35 22.735 145-149 29.775000000000002 24.625 22.905 22.695 150-151 29.212500000000002 25.275 21.725 23.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 0.5 28 1.0 29 2.0 30 2.0 31 3.5 32 9.5 33 14.0 34 20.5 35 28.5 36 37.0 37 55.0 38 69.0 39 85.5 40 109.5 41 138.0 42 152.0 43 163.5 44 176.5 45 177.0 46 187.0 47 182.0 48 162.0 49 149.5 50 134.0 51 140.5 52 142.5 53 121.5 54 116.5 55 96.5 56 82.5 57 81.0 58 73.0 59 78.0 60 78.0 61 73.5 62 77.5 63 76.0 64 66.0 65 65.5 66 68.0 67 74.5 68 72.0 69 52.0 70 51.5 71 47.0 72 38.5 73 37.0 74 26.5 75 20.0 76 18.0 77 17.0 78 11.0 79 6.0 80 3.0 81 1.0 82 2.0 83 1.0 84 0.5 85 0.5 86 0.5 87 1.0 88 1.0 89 1.0 90 0.5 91 0.0 92 0.5 93 1.0 94 1.0 95 0.5 96 0.5 97 1.0 98 2.0 99 2.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.575 #Duplication Level Percentage of deduplicated Percentage of total 1 82.46974868135277 66.45 2 13.217499224325163 21.3 3 2.94756438101148 7.124999999999999 4 0.8687558175612783 2.8000000000000003 5 0.31026993484331367 1.25 6 0.09308098045299411 0.44999999999999996 7 0.031026993484331366 0.17500000000000002 8 0.031026993484331366 0.2 9 0.0 0.0 >10 0.031026993484331366 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GCCGCCATCGAAAAGTTCCTCCAGTTCCAGGACGCCGTGCCCTGCAAGAT 8 0.2 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit GCCTCACTCTGTTGCCTCTCAGCTCTCAGGTCTACTGACTTCCTCTCCGT 6 0.15 No Hit AGGGCGGCTACTAGGTTCCTGGTCCCGCGACGAGGACTGTCCCTTTGAAC 6 0.15 No Hit CATCAACAGAGCCCTCGCCAAACACTGACCTCAGATCTCTCTCGCCTTAC 6 0.15 No Hit GCACAAGGCAAGAAGATCGAAGCAAGGAAAGCACAAGCGCGAGCGTCTTC 5 0.125 No Hit CTTCTACGACATGCTGGAAAAGGGGCAGATCAGCGTCGTCGTCAAGGAGT 5 0.125 No Hit AGATGAAGCCCGAAGATACTTCCATCAACTTATAAATGCAGTGGATTATT 5 0.125 No Hit GGTCTGGACATCAATGATGTGCAGCTTATCATTCAGTGTGAGCCTCCACG 5 0.125 No Hit CTACCATAATTATTGTATATGCAGTAATAGAGATACCTTCTGATGCCAGC 5 0.125 No Hit GGATGATTTTCGGTCTATGAACAAGTGTGATTATGGACTTGGAGGAATTC 5 0.125 No Hit AGACGGCTTCGACCGCAAGTGGAAGTGGGAGGCCAAGTCCAAGCCCGGCG 5 0.125 No Hit GGCGAAAATCATTTGAAATTTTTACATTGGGATCTTAATAAAAGCACTCG 5 0.125 No Hit TGCAAAGACATACTTGGAGGGCCTTGTGGGCTCGCTCGTCCGGCTGACGA 5 0.125 No Hit CACACTCATTCCTCACGTTTGCCACCTCCACGCCAATGCAATCAGCAGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.2875 0.0 0.0 0.0 0.0 118-119 4.7125 0.0 0.0 0.0 0.0 120-121 5.275 0.0 0.0 0.0 0.0 122-123 5.6125 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 7.0875 0.0 0.0 0.0 0.0 130-131 7.7125 0.0 0.0 0.0 0.0 132-133 8.425 0.0 0.0 0.0 0.0 134-135 9.25 0.0 0.0 0.0 0.0 136-137 10.0125 0.0 0.0 0.0 0.0 138-139 10.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012662 spots for SRR12951286.sra Written 2012662 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra Read 2012648 spots for SRR12951286.sra Written 2012648 spots for SRR12951286.sra SRR ids: ['SRR12951286.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pkolydr4 SRR12951286.sra spots: 40252974 blocks: [[1, 2012648], [2012649, 4025296], [4025297, 6037944], [6037945, 8050592], [8050593, 10063240], [10063241, 12075888], [12075889, 14088536], [14088537, 16101184], [16101185, 18113832], [18113833, 20126480], [20126481, 22139128], [22139129, 24151776], [24151777, 26164424], [26164425, 28177072], [28177073, 30189720], [30189721, 32202368], [32202369, 34215016], [34215017, 36227664], [36227665, 38240312], [38240313, 40252974]] SRR12951286 file size 13658021 SRR12951286 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951286 SRR12951286_1.fastq SRR12951286_2.fastq Input file: SRR12951286_1.fastq Paired file: SRR12951286_2.fastq trimmed: SRR12951286-trimmed-pair1.fastq, SRR12951286-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:28:54 2024 >> started Sat Dec 7 10:29:55 2024 >> done (60.931s) 40252974 read pairs processed; of these: 329 ( 0.00%) short read pairs filtered out after trimming by size control 17667 ( 0.04%) empty read pairs filtered out after trimming by size control 40234978 (99.96%) read pairs available; of these: 5726193 (14.23%) trimmed read pairs available after processing 34508785 (85.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 28 0.00% 20 39 0.00% 21 49 0.00% 22 63 0.00% 23 60 0.00% 24 93 0.00% 25 109 0.00% 26 113 0.00% 27 110 0.00% 28 146 0.00% 29 122 0.00% 30 156 0.00% 31 167 0.00% 32 136 0.00% 33 163 0.00% 34 153 0.00% 35 160 0.00% 36 187 0.00% 37 139 0.00% 38 155 0.00% 39 167 0.00% 40 197 0.00% 41 144 0.00% 42 186 0.00% 43 182 0.00% 44 191 0.00% 45 226 0.00% 46 189 0.00% 47 260 0.00% 48 277 0.00% 49 324 0.00% 50 321 0.00% 51 407 0.00% 52 411 0.00% 53 439 0.00% 54 412 0.00% 55 458 0.00% 56 498 0.00% 57 588 0.00% 58 700 0.00% 59 784 0.00% 60 878 0.00% 61 999 0.00% 62 1139 0.00% 63 1276 0.00% 64 1353 0.00% 65 1503 0.00% 66 1571 0.00% 67 1818 0.00% 68 2025 0.01% 69 2326 0.01% 70 2690 0.01% 71 2978 0.01% 72 3613 0.01% 73 4066 0.01% 74 4557 0.01% 75 4849 0.01% 76 5620 0.01% 77 6297 0.02% 78 6821 0.02% 79 7510 0.02% 80 8515 0.02% 81 9668 0.02% 82 11097 0.03% 83 12471 0.03% 84 13899 0.03% 85 14925 0.04% 86 16207 0.04% 87 17799 0.04% 88 19160 0.05% 89 20279 0.05% 90 22483 0.06% 91 24214 0.06% 92 26322 0.07% 93 28470 0.07% 94 30863 0.08% 95 33226 0.08% 96 34699 0.09% 97 36257 0.09% 98 38850 0.10% 99 40111 0.10% 100 42385 0.11% 101 44289 0.11% 102 47267 0.12% 103 50538 0.13% 104 52846 0.13% 105 54914 0.14% 106 57839 0.14% 107 60208 0.15% 108 61870 0.15% 109 64713 0.16% 110 66193 0.16% 111 68495 0.17% 112 72115 0.18% 113 74962 0.19% 114 78721 0.20% 115 80096 0.20% 116 83604 0.21% 117 85644 0.21% 118 87666 0.22% 119 88810 0.22% 120 90234 0.22% 121 94514 0.23% 122 96224 0.24% 123 98815 0.25% 124 103056 0.26% 125 104531 0.26% 126 108411 0.27% 127 108877 0.27% 128 112797 0.28% 129 112664 0.28% 130 115136 0.29% 131 116699 0.29% 132 119502 0.30% 133 121810 0.30% 134 124779 0.31% 135 128454 0.32% 136 130931 0.33% 137 133243 0.33% 138 133379 0.33% 139 133660 0.33% 140 134952 0.34% 141 137457 0.34% 142 140558 0.35% 143 140898 0.35% 144 143177 0.36% 145 145778 0.36% 146 145820 0.36% 147 147388 0.37% 148 148252 0.37% 149 148477 0.37% 150 149413 0.37% 151 34508785 85.77% 40234978 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.04 fanout-score-rank=25 prefix-density=0.34 prefix-fanout=3.8 sequence=TGCAGTTGTCGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=286.03 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=30.8 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=35 prefix-density=0.92 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=180.68 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=21.2 sequence=CGGCGGCGGCGGAG SRR12951286 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:30:34 Started mapping on | Dec 07 10:30:34 Finished on | Dec 07 10:34:17 Mapping speed, Million of reads per hour | 649.53 Number of input reads | 40234978 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 38716363 Uniquely mapped reads % | 96.23% Average mapped length | 293.93 Number of splices: Total | 38431011 Number of splices: Annotated (sjdb) | 35892588 Number of splices: GT/AG | 37898414 Number of splices: GC/AG | 449629 Number of splices: AT/AC | 24970 Number of splices: Non-canonical | 57998 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412959 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 46516 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1105656 1105656 1105656 N_multimapping 412959 412959 412959 N_noFeature 1325385 37698789 1663098 N_ambiguous 793388 5502 114528 UnstrandedReadsAssigned:36597590 PositiveStrandReadsAssigned:1012072 NegativeStrandReadsAssigned:36938737 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951286 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951286-trimmed-pair1.fastq SRR12951286-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,234,978 reads, 37,292,014 reads pseudoaligned [quant] estimated average fragment length: 256.067 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52973 SRR12951286.ke.tsv 35125 SRR12951286.se.tsv 88098 total ==> SRR12951286.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.546 0 0 PNS24247 1044 788.933 149.413 7.21462 PNS24249 1928 1672.93 493.685 11.2418 PNS24246 1044 788.933 149.413 7.21462 PNS24248 1044 788.933 149.413 7.21462 PNS24244 1471 1215.93 221.075 6.9262 PNS24243 293 104.379 0 0 KQK14069 1603 1347.93 81337.7 2298.73 KQK14071 474 244.255 374.332 58.382 ==> SRR12951286.se.tsv <== BRADI_1g14170v3 82726 BRADI_1g53295v3 384 BRADI_1g59795v3 890 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 1200 BRADI_1g74790v3 3534 BRADI_1g09890v3 0 BRADI_1g77505v3 517 BRADI_1g48960v3 0 SRR12951286 completed mapping pipeline successfully