Starting /dee2/code/volunteer_pipeline.sh SRR12951288 current disk space = 1543442259968 free memory = 1605922204 SRR12951288 SRAfilesize 1f70018c6cbf98c3d02afa9598bcc671 SRR12951288.sra SRR12951288.sra file validated SRR12951288 is paired end SRR12951288 is conventional basespace SRR12951288 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951288_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.55 37.0 37.0 37.0 37.0 37.0 2 36.09075 37.0 37.0 37.0 37.0 37.0 3 36.483 37.0 37.0 37.0 37.0 37.0 4 36.5785 37.0 37.0 37.0 37.0 37.0 5 36.61 37.0 37.0 37.0 37.0 37.0 6 36.6585 37.0 37.0 37.0 37.0 37.0 7 36.5695 37.0 37.0 37.0 37.0 37.0 8 36.533 37.0 37.0 37.0 37.0 37.0 9 36.581 37.0 37.0 37.0 37.0 37.0 10-14 36.5755 37.0 37.0 37.0 37.0 37.0 15-19 36.5424 37.0 37.0 37.0 37.0 37.0 20-24 36.5164 37.0 37.0 37.0 37.0 37.0 25-29 36.479499999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.51649999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.451 37.0 37.0 37.0 37.0 37.0 40-44 36.39 37.0 37.0 37.0 37.0 37.0 45-49 36.358999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3862 37.0 37.0 37.0 37.0 37.0 55-59 36.231700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2625 37.0 37.0 37.0 37.0 37.0 65-69 36.1837 37.0 37.0 37.0 37.0 37.0 70-74 36.2215 37.0 37.0 37.0 37.0 37.0 75-79 36.2947 37.0 37.0 37.0 37.0 37.0 80-84 36.2745 37.0 37.0 37.0 37.0 37.0 85-89 36.2541 37.0 37.0 37.0 37.0 37.0 90-94 36.2248 37.0 37.0 37.0 37.0 37.0 95-99 36.2297 37.0 37.0 37.0 37.0 37.0 100-104 36.262 37.0 37.0 37.0 37.0 37.0 105-109 36.178999999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.117000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1367 37.0 37.0 37.0 37.0 37.0 120-124 36.108900000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0142 37.0 37.0 37.0 37.0 37.0 130-134 36.019000000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.9637 37.0 37.0 37.0 37.0 37.0 140-144 35.8977 37.0 37.0 37.0 37.0 37.0 145-149 35.892199999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.76475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 1.0 24 1.0 25 5.0 26 6.0 27 7.0 28 12.0 29 14.0 30 27.0 31 42.0 32 51.0 33 65.0 34 138.0 35 263.0 36 2897.0 37 467.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.025 10.674999999999999 4.925 31.374999999999996 2 22.412490556534877 11.810627046084111 30.647192143037017 35.12969025434399 3 20.525 16.55 26.700000000000003 36.225 4 26.825 22.525000000000002 22.55 28.1 5 28.349999999999998 25.775 22.15 23.724999999999998 6 24.725 32.45 20.974999999999998 21.85 7 19.75 24.45 36.075 19.725 8 22.525000000000002 24.65 26.200000000000003 26.625 9 21.625 21.0 31.175000000000004 26.200000000000003 10-14 23.895 26.545 24.435000000000002 25.124999999999996 15-19 24.675 24.275 24.98 26.07 20-24 23.849999999999998 24.529999999999998 24.985 26.634999999999998 25-29 24.295 24.560000000000002 24.32 26.825 30-34 23.150000000000002 25.105 24.675 27.07 35-39 24.04 24.515 24.795 26.650000000000002 40-44 24.605 24.945 24.875 25.575 45-49 24.64 24.695 24.285 26.38 50-54 23.835 24.195 25.124999999999996 26.845000000000002 55-59 24.5 24.135 24.915000000000003 26.450000000000003 60-64 24.224999999999998 23.745 25.095 26.935 65-69 24.075 24.525 24.525 26.875 70-74 25.205 23.96 24.235 26.6 75-79 25.14 24.87 24.11 25.88 80-84 24.474999999999998 24.23 24.505 26.790000000000003 85-89 25.430000000000003 23.765 24.095 26.71 90-94 25.2 24.095 23.395 27.310000000000002 95-99 25.44 23.655 24.025 26.88 100-104 25.264999999999997 24.33 24.135 26.27 105-109 25.825 23.41 24.68 26.085 110-114 25.795 24.985 23.244999999999997 25.974999999999998 115-119 25.6 24.23 23.74 26.43 120-124 25.955000000000002 23.98 23.28 26.784999999999997 125-129 25.81 24.98 23.44 25.77 130-134 26.064999999999998 24.48 23.57 25.885 135-139 25.380000000000003 24.29 23.815 26.515 140-144 25.825 23.805 23.365 27.005000000000003 145-149 26.125 24.195 23.425 26.255 150-151 25.2375 23.825 24.224999999999998 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.0 28 0.5 29 1.0 30 3.0 31 6.5 32 9.5 33 12.5 34 18.0 35 28.5 36 37.0 37 54.0 38 72.5 39 88.0 40 106.5 41 135.5 42 161.0 43 159.0 44 169.5 45 182.5 46 176.5 47 175.0 48 180.0 49 168.5 50 163.5 51 158.5 52 132.0 53 130.0 54 115.0 55 83.0 56 83.0 57 80.0 58 73.0 59 73.5 60 73.5 61 71.0 62 65.5 63 69.5 64 78.5 65 72.0 66 71.0 67 82.0 68 68.0 69 50.5 70 45.5 71 37.5 72 31.5 73 27.0 74 25.0 75 24.5 76 19.5 77 14.5 78 10.5 79 7.0 80 5.0 81 4.0 82 2.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 81.04864181933038 64.14999999999999 2 14.276689829437778 22.6 3 3.0953885028427037 7.35 4 1.0739102969046115 3.4000000000000004 5 0.3474415666456096 1.375 6 0.09475679090334807 0.44999999999999996 7 0.03158559696778269 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.03158559696778269 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCTCCTTATCTCGTAT 20 0.5 TruSeq Adapter, Index 21 (97% over 38bp) GCACAGGGCATTTATCTTGAGCCATTTATCTACGCATTCTTTGTGGAAGA 7 0.17500000000000002 No Hit CGAGAGAGAACAATTTCCTTGTCATTTTAAGCTATCAAAGAGCTTCTCAG 6 0.15 No Hit CTACGGAGAACCACTCCCTCAGCACACACAACAGTATCATCTTGATGAAC 6 0.15 No Hit GTCTTTGTTACTATCAGCAGCCATAATTCCATTGAAATCTTCAGAACCTT 6 0.15 No Hit GCATAGTGTAAATAACAAAGATCCTTTGGTCCAAAGGCTTATATTGGCGA 5 0.125 No Hit GAGAGACATTAATGCAGAAAATACAGTTCAAGGCAGTATGCACTGAAGGC 5 0.125 No Hit GTCGTAGGGCTCGAACCAGTTGGACACCTGCGTGATCCCGATCTTGCCGC 5 0.125 No Hit GTGGCAGATCTGCTGCTACTTCACATCTCATCTACCAGAAAATTTTCGGC 5 0.125 No Hit GCTATCTTAGCCCTTTGCATGGCTGTGAGCCCCTCGTGACTTTCCTTCTG 5 0.125 No Hit AGGGTCAAAGCATGACTAAACTACGGCGCATTTCAGCTGTCACCAAGAAG 5 0.125 No Hit GCTCAATTTGTTGCTCATAAAGTTTTTTCCTTTTCAAAGCTTGGATAGCC 5 0.125 No Hit GGCTTCTTGTAACATTTGAAGATCCCTGAACAAGAAGTGCAAGGTCCTTC 5 0.125 No Hit GCCAGGACGATGAAAGGCACGAGCACGCAGAGGAAGAGGAGGAAAGCACC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCTCCTTATCGCGTAT 5 0.125 TruSeq Adapter, Index 21 (97% over 38bp) GCCTTCTTCACTGTATCTTGATTCAGAGGCAGCTGCCTGAATCCTGCCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.275 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.7249999999999996 0.0 0.0 0.0 0.0 114-115 3.025 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.2 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 6.887499999999999 0.0 0.0 0.0 0.0 134-135 7.3625 0.0 0.0 0.0 0.0 136-137 7.9125 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12951288 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951288_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0245 37.0 37.0 37.0 37.0 37.0 2 35.9985 37.0 37.0 37.0 37.0 37.0 3 35.8695 37.0 37.0 37.0 37.0 37.0 4 36.091 37.0 37.0 37.0 37.0 37.0 5 36.0805 37.0 37.0 37.0 37.0 37.0 6 36.0815 37.0 37.0 37.0 37.0 37.0 7 36.012 37.0 37.0 37.0 37.0 37.0 8 36.1045 37.0 37.0 37.0 37.0 37.0 9 36.0405 37.0 37.0 37.0 37.0 37.0 10-14 36.0475 37.0 37.0 37.0 37.0 37.0 15-19 36.0374 37.0 37.0 37.0 37.0 37.0 20-24 35.8649 37.0 37.0 37.0 37.0 37.0 25-29 35.7933 37.0 37.0 37.0 37.0 37.0 30-34 35.72339999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.665000000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.747 37.0 37.0 37.0 37.0 37.0 45-49 35.626999999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.611599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.6412 37.0 37.0 37.0 37.0 37.0 60-64 35.6222 37.0 37.0 37.0 37.0 37.0 65-69 35.6104 37.0 37.0 37.0 37.0 37.0 70-74 35.496399999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.5651 37.0 37.0 37.0 37.0 37.0 80-84 35.5404 37.0 37.0 37.0 37.0 37.0 85-89 35.524800000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.5958 37.0 37.0 37.0 37.0 37.0 95-99 35.5502 37.0 37.0 37.0 37.0 37.0 100-104 35.5142 37.0 37.0 37.0 37.0 37.0 105-109 35.4928 37.0 37.0 37.0 37.0 37.0 110-114 35.4396 37.0 37.0 37.0 37.0 37.0 115-119 35.488299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.4191 37.0 37.0 37.0 37.0 37.0 125-129 35.4108 37.0 37.0 37.0 37.0 37.0 130-134 35.280699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.297000000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.22579999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.0868 37.0 37.0 37.0 29.8 37.0 150-151 34.81275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 14.0 14 11.0 15 8.0 16 5.0 17 4.0 18 6.0 19 4.0 20 4.0 21 10.0 22 10.0 23 14.0 24 10.0 25 12.0 26 20.0 27 17.0 28 18.0 29 25.0 30 23.0 31 21.0 32 53.0 33 102.0 34 164.0 35 474.0 36 2658.0 37 312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.0 22.1 5.800000000000001 23.1 2 30.95 21.175 24.474999999999998 23.400000000000002 3 24.45 25.0 28.549999999999997 22.0 4 29.5 30.125 18.325 22.05 5 29.4 31.35 17.7 21.55 6 26.075 32.2 18.2 23.525 7 24.2 20.25 32.6 22.95 8 24.975 20.75 23.625 30.65 9 23.799999999999997 22.0 25.7 28.499999999999996 10-14 27.195000000000004 24.16 22.725 25.919999999999998 15-19 26.435 24.154999999999998 22.805 26.605 20-24 26.655 24.474999999999998 22.759999999999998 26.11 25-29 26.85 24.275 23.23 25.645 30-34 27.18 24.21 23.16 25.45 35-39 26.57 24.69 22.755 25.985000000000003 40-44 26.590000000000003 24.529999999999998 23.195 25.685000000000002 45-49 25.865 24.285 23.985 25.865 50-54 27.24 24.145 24.295 24.32 55-59 26.365 24.62 23.165 25.85 60-64 27.775 25.035 22.24 24.95 65-69 27.265 24.335 23.405 24.995 70-74 27.76 24.285 23.275000000000002 24.68 75-79 27.145000000000003 24.610000000000003 23.515 24.73 80-84 27.544999999999998 24.625 22.830000000000002 25.0 85-89 27.339999999999996 25.03 22.805 24.825 90-94 27.48 24.795 22.745 24.98 95-99 27.765 24.175 23.285 24.775 100-104 27.915 24.86 22.515 24.709999999999997 105-109 27.71 24.67 23.044999999999998 24.575 110-114 28.78 24.42 22.39 24.41 115-119 28.04 25.115 22.09 24.755 120-124 27.61 25.185000000000002 23.29 23.915 125-129 27.634999999999998 24.985 23.125 24.255 130-134 28.055000000000003 24.310000000000002 23.225 24.41 135-139 28.785 24.740000000000002 23.419999999999998 23.055 140-144 28.46 24.925 22.835 23.78 145-149 28.93 25.115 22.365 23.59 150-151 28.975 24.85 23.0 23.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.5 7 1.5 8 0.5 9 0.5 10 0.5 11 1.0 12 1.5 13 2.0 14 3.0 15 1.5 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 2.0 25 0.5 26 2.5 27 2.5 28 0.5 29 2.0 30 4.0 31 5.5 32 8.0 33 10.0 34 13.0 35 20.0 36 30.0 37 44.5 38 64.0 39 83.5 40 100.5 41 124.5 42 142.5 43 141.5 44 160.5 45 168.5 46 176.0 47 188.0 48 171.5 49 157.5 50 144.0 51 128.0 52 122.0 53 111.0 54 101.0 55 93.5 56 86.0 57 80.0 58 80.0 59 88.5 60 80.5 61 82.0 62 83.5 63 84.0 64 80.0 65 67.5 66 67.0 67 76.0 68 81.0 69 59.5 70 52.0 71 59.0 72 44.0 73 38.5 74 32.0 75 18.0 76 17.0 77 17.5 78 11.5 79 6.0 80 6.5 81 5.0 82 3.0 83 3.0 84 1.5 85 1.5 86 1.0 87 1.0 88 1.0 89 3.5 90 4.0 91 1.0 92 2.5 93 2.0 94 1.0 95 4.5 96 5.5 97 3.0 98 2.5 99 2.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.125 #Duplication Level Percentage of deduplicated Percentage of total 1 82.02808112324493 65.725 2 13.478939157566302 21.6 3 3.0265210608424336 7.2749999999999995 4 0.93603744149766 3.0 5 0.374414976599064 1.5 6 0.093603744149766 0.44999999999999996 7 0.031201248049921998 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.031201248049921998 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GGACATACAAGTTCAAATTGAAGAAGGCTCGTAATGGTGAGGGCAGTGAA 7 0.17500000000000002 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit CTGACCATGTTGTCTTCCAGCATGGAAAATACAAGTTACAAACAGCGGAG 6 0.15 No Hit CGGAGGAGGAGAATGTGTCTGGACCTGGAACAAGTGGGGGCAGTACAGAT 6 0.15 No Hit GCAATCGTCTCCTCCTCCGCTGTCCAGATCTGCTCTGTCGCACGGTCTGC 5 0.125 No Hit GTCATCACAATCGCGCATAGGATCACCTCGGTCCTCGACAGCGACGTGGT 5 0.125 No Hit CACCACCCCATCTCCTCTTCGTCTTCCTCCTTCCCCGCTCTTCCTTTGCA 5 0.125 No Hit GACGCAAAAGCTTCTTGAAAAGTGAATGATCAACTCCTTGAGAGACCCCA 5 0.125 No Hit AGAAGAATTGCATTAGGTTCTGCTAGGGGCCTGTCCTATTTACATGATCA 5 0.125 No Hit GGCAGCGTTTACGTGAGTATGCCCGGACGTTCAAAGTCCCCTTTGAATAT 5 0.125 No Hit CTCATTGATGACATGGTTGCCTATGCACTTAAGAGTGAAGGAGGTTATGT 5 0.125 No Hit CCCGGCCTCGCAGCAGAGCTACGACTGGAAGAAGGCCTCTCAGCCAGAGG 5 0.125 No Hit GATGAGACCGGACAGAAGCACTGTACTGGCCAATACTTTGATTACTGGAA 5 0.125 No Hit CTTGATATGCTGGAGAAGAAAGAGAAAGTGTTGGAGAAAAAAGCAGCTGC 5 0.125 No Hit CCACGCCCGCCTGTCGAGCCCAAATTGGCCATCGCAAGGAGTGCTGCAAT 5 0.125 No Hit CAATGATCTTCTGCTCGGGCGGCTACGCCACGGGCATCGCCGCCCCGGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.725 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.0625 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 6.075 0.0 0.0 0.0 0.0 130-131 6.425 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTCA 10 0.006830828 145.0 4 AATTGGG 10 0.006830828 145.0 5 >>END_MODULE Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164081 spots for SRR12951288.sra Written 2164081 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra Read 2164067 spots for SRR12951288.sra Written 2164067 spots for SRR12951288.sra SRR ids: ['SRR12951288.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tb1svj62 SRR12951288.sra spots: 43281354 blocks: [[1, 2164067], [2164068, 4328134], [4328135, 6492201], [6492202, 8656268], [8656269, 10820335], [10820336, 12984402], [12984403, 15148469], [15148470, 17312536], [17312537, 19476603], [19476604, 21640670], [21640671, 23804737], [23804738, 25968804], [25968805, 28132871], [28132872, 30296938], [30296939, 32461005], [32461006, 34625072], [34625073, 36789139], [36789140, 38953206], [38953207, 41117273], [41117274, 43281354]] SRR12951288 file size 14687197 SRR12951288 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951288 SRR12951288_1.fastq SRR12951288_2.fastq Input file: SRR12951288_1.fastq Paired file: SRR12951288_2.fastq trimmed: SRR12951288-trimmed-pair1.fastq, SRR12951288-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:38:54 2024 >> started Sat Dec 7 10:40:01 2024 >> done (66.965s) 43281354 read pairs processed; of these: 315 ( 0.00%) short read pairs filtered out after trimming by size control 232653 ( 0.54%) empty read pairs filtered out after trimming by size control 43048386 (99.46%) read pairs available; of these: 5453009 (12.67%) trimmed read pairs available after processing 37595377 (87.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 31 0.00% 19 26 0.00% 20 50 0.00% 21 51 0.00% 22 84 0.00% 23 99 0.00% 24 114 0.00% 25 161 0.00% 26 145 0.00% 27 178 0.00% 28 192 0.00% 29 210 0.00% 30 168 0.00% 31 157 0.00% 32 181 0.00% 33 201 0.00% 34 235 0.00% 35 191 0.00% 36 229 0.00% 37 211 0.00% 38 193 0.00% 39 245 0.00% 40 250 0.00% 41 260 0.00% 42 233 0.00% 43 223 0.00% 44 263 0.00% 45 256 0.00% 46 335 0.00% 47 332 0.00% 48 344 0.00% 49 444 0.00% 50 424 0.00% 51 494 0.00% 52 549 0.00% 53 550 0.00% 54 556 0.00% 55 611 0.00% 56 709 0.00% 57 728 0.00% 58 824 0.00% 59 963 0.00% 60 1034 0.00% 61 1205 0.00% 62 1326 0.00% 63 1486 0.00% 64 1515 0.00% 65 1706 0.00% 66 1795 0.00% 67 2101 0.00% 68 2305 0.01% 69 2613 0.01% 70 3071 0.01% 71 3388 0.01% 72 3781 0.01% 73 4203 0.01% 74 4750 0.01% 75 5222 0.01% 76 5585 0.01% 77 6200 0.01% 78 6816 0.02% 79 7826 0.02% 80 8654 0.02% 81 9797 0.02% 82 10838 0.03% 83 12242 0.03% 84 13422 0.03% 85 14614 0.03% 86 15352 0.04% 87 16678 0.04% 88 17886 0.04% 89 18727 0.04% 90 20683 0.05% 91 22963 0.05% 92 24981 0.06% 93 26960 0.06% 94 29137 0.07% 95 30487 0.07% 96 32535 0.08% 97 34463 0.08% 98 35164 0.08% 99 36828 0.09% 100 39341 0.09% 101 41288 0.10% 102 44228 0.10% 103 46561 0.11% 104 49222 0.11% 105 51337 0.12% 106 53792 0.12% 107 54629 0.13% 108 56896 0.13% 109 58936 0.14% 110 60301 0.14% 111 64150 0.15% 112 66832 0.16% 113 69047 0.16% 114 73083 0.17% 115 75372 0.18% 116 77339 0.18% 117 78662 0.18% 118 81036 0.19% 119 82852 0.19% 120 84234 0.20% 121 86994 0.20% 122 89744 0.21% 123 94144 0.22% 124 98024 0.23% 125 100390 0.23% 126 102316 0.24% 127 104030 0.24% 128 105202 0.24% 129 106832 0.25% 130 108590 0.25% 131 109627 0.25% 132 113414 0.26% 133 115776 0.27% 134 119228 0.28% 135 122526 0.28% 136 124523 0.29% 137 126152 0.29% 138 127665 0.30% 139 128625 0.30% 140 130792 0.30% 141 131858 0.31% 142 135257 0.31% 143 135640 0.32% 144 140591 0.33% 145 141981 0.33% 146 144400 0.34% 147 145490 0.34% 148 146731 0.34% 149 146835 0.34% 150 147455 0.34% 151 37595377 87.33% 43048386 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=34 prefix-density=0.22 prefix-fanout=2.9 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=321.64 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=25.9 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=38 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=276.77 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=21.5 sequence=CGCCGCCGCCGA SRR12951288 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:40:40 Started mapping on | Dec 07 10:40:41 Finished on | Dec 07 10:44:37 Mapping speed, Million of reads per hour | 656.67 Number of input reads | 43048386 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 40229684 Uniquely mapped reads % | 93.45% Average mapped length | 294.82 Number of splices: Total | 36295011 Number of splices: Annotated (sjdb) | 33672283 Number of splices: GT/AG | 35812521 Number of splices: GC/AG | 417242 Number of splices: AT/AC | 25550 Number of splices: Non-canonical | 39698 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407779 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 85449 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2410923 2410923 2410923 N_multimapping 407779 407779 407779 N_noFeature 1533243 39153684 1892167 N_ambiguous 845257 6026 127760 UnstrandedReadsAssigned:37851184 PositiveStrandReadsAssigned:1069974 NegativeStrandReadsAssigned:38209757 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951288 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951288-trimmed-pair1.fastq SRR12951288-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,048,386 reads, 39,093,975 reads pseudoaligned [quant] estimated average fragment length: 260.118 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52973 SRR12951288.ke.tsv 35125 SRR12951288.se.tsv 88098 total ==> SRR12951288.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.516 0 0 PNS24247 1044 784.882 206.937 9.98084 PNS24249 1928 1668.88 662.838 15.0354 PNS24246 1044 784.882 206.937 9.98084 PNS24248 1044 784.882 206.937 9.98084 PNS24244 1471 1211.88 244.351 7.63286 PNS24243 293 100.13 2 0.756133 KQK14069 1603 1343.88 49691.9 1399.77 KQK14071 474 238.935 105.054 16.6444 ==> SRR12951288.se.tsv <== BRADI_1g14170v3 49339 BRADI_1g53295v3 301 BRADI_1g59795v3 581 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1456 BRADI_1g74790v3 2616 BRADI_1g09890v3 0 BRADI_1g77505v3 372 BRADI_1g48960v3 0 SRR12951288 completed mapping pipeline successfully