Starting /dee2/code/volunteer_pipeline.sh SRR12951292 current disk space = 1543323332608 free memory = 1601563116 SRR12951292 SRAfilesize 25ccd62c768d0b97060d1e64a27d6220 SRR12951292.sra SRR12951292.sra file validated SRR12951292 is paired end SRR12951292 is conventional basespace SRR12951292 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951292_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5875 37.0 37.0 37.0 37.0 37.0 2 36.2015 37.0 37.0 37.0 37.0 37.0 3 36.6145 37.0 37.0 37.0 37.0 37.0 4 36.6185 37.0 37.0 37.0 37.0 37.0 5 36.6235 37.0 37.0 37.0 37.0 37.0 6 36.6355 37.0 37.0 37.0 37.0 37.0 7 36.5715 37.0 37.0 37.0 37.0 37.0 8 36.6015 37.0 37.0 37.0 37.0 37.0 9 36.6285 37.0 37.0 37.0 37.0 37.0 10-14 36.60959999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5875 37.0 37.0 37.0 37.0 37.0 20-24 36.57469999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5019 37.0 37.0 37.0 37.0 37.0 30-34 36.5105 37.0 37.0 37.0 37.0 37.0 35-39 36.4953 37.0 37.0 37.0 37.0 37.0 40-44 36.46040000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3923 37.0 37.0 37.0 37.0 37.0 50-54 36.422999999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3917 37.0 37.0 37.0 37.0 37.0 60-64 36.3609 37.0 37.0 37.0 37.0 37.0 65-69 36.334 37.0 37.0 37.0 37.0 37.0 70-74 36.2997 37.0 37.0 37.0 37.0 37.0 75-79 36.3572 37.0 37.0 37.0 37.0 37.0 80-84 36.3507 37.0 37.0 37.0 37.0 37.0 85-89 36.272499999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.264700000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.2745 37.0 37.0 37.0 37.0 37.0 100-104 36.2482 37.0 37.0 37.0 37.0 37.0 105-109 36.21319999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1939 37.0 37.0 37.0 37.0 37.0 115-119 36.1695 37.0 37.0 37.0 37.0 37.0 120-124 36.1197 37.0 37.0 37.0 37.0 37.0 125-129 36.0466 37.0 37.0 37.0 37.0 37.0 130-134 36.0338 37.0 37.0 37.0 37.0 37.0 135-139 36.0139 37.0 37.0 37.0 37.0 37.0 140-144 35.898 37.0 37.0 37.0 37.0 37.0 145-149 35.8881 37.0 37.0 37.0 37.0 37.0 150-151 35.727999999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 4.0 25 2.0 26 6.0 27 4.0 28 14.0 29 18.0 30 25.0 31 30.0 32 44.0 33 72.0 34 119.0 35 260.0 36 2889.0 37 511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.925 10.9 6.2 35.975 2 22.16624685138539 11.032745591939547 32.31738035264484 34.48362720403023 3 18.8 17.05 26.35 37.8 4 24.6 22.3 23.674999999999997 29.425 5 26.724999999999998 27.025 22.825 23.425 6 24.65 29.349999999999998 21.525 24.474999999999998 7 19.475 25.275 36.375 18.875 8 20.7 24.575 29.325000000000003 25.4 9 20.424999999999997 21.125 32.300000000000004 26.150000000000002 10-14 23.69 25.94 24.965 25.405 15-19 23.82 25.46 24.63 26.090000000000003 20-24 23.91 25.095 25.44 25.555 25-29 23.96 25.4 24.92 25.72 30-34 23.655 25.264999999999997 24.9 26.179999999999996 35-39 23.635 24.990000000000002 25.135 26.240000000000002 40-44 24.465 25.365 24.865000000000002 25.305 45-49 24.529999999999998 25.019999999999996 24.83 25.619999999999997 50-54 24.165 24.95 25.185000000000002 25.7 55-59 24.205 24.779999999999998 24.905 26.11 60-64 23.635 25.105 24.745 26.515 65-69 23.745 25.83 24.205 26.22 70-74 24.46 25.005 23.57 26.965 75-79 24.23 25.145 24.915000000000003 25.71 80-84 25.045 24.884999999999998 24.575 25.495 85-89 24.755 25.335 24.085 25.825 90-94 24.865000000000002 24.51 24.404999999999998 26.22 95-99 24.495 25.290000000000003 24.195 26.02 100-104 24.805 24.349999999999998 24.05 26.795 105-109 24.83 25.174999999999997 24.834999999999997 25.16 110-114 24.610000000000003 25.169999999999998 23.605 26.615 115-119 24.8 25.869999999999997 23.505000000000003 25.825 120-124 25.655 24.865000000000002 23.755000000000003 25.724999999999998 125-129 25.305 25.615 23.085 25.995 130-134 25.295 25.264999999999997 23.54 25.900000000000002 135-139 25.624999999999996 25.230000000000004 23.025000000000002 26.119999999999997 140-144 25.535000000000004 24.654999999999998 23.65 26.16 145-149 25.88 24.73 23.119999999999997 26.27 150-151 25.3125 25.525 21.7875 27.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 1.5 28 0.5 29 4.0 30 5.5 31 5.5 32 9.0 33 13.0 34 23.5 35 39.0 36 52.5 37 66.0 38 92.0 39 106.0 40 120.0 41 131.5 42 138.5 43 158.5 44 182.5 45 184.5 46 179.5 47 178.5 48 173.5 49 178.5 50 162.5 51 153.5 52 163.0 53 138.0 54 103.5 55 93.0 56 94.5 57 89.5 58 75.5 59 72.0 60 69.5 61 64.5 62 57.0 63 57.5 64 56.0 65 58.5 66 63.5 67 55.5 68 47.0 69 42.0 70 36.5 71 34.0 72 31.5 73 24.0 74 24.0 75 22.5 76 18.0 77 14.5 78 11.0 79 7.5 80 3.0 81 2.0 82 1.5 83 1.5 84 0.5 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 78.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 79.83460559796438 62.74999999999999 2 15.298982188295165 24.05 3 3.4033078880407124 8.025 4 1.1450381679389312 3.5999999999999996 5 0.1272264631043257 0.5 6 0.1272264631043257 0.6 7 0.031806615776081425 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.031806615776081425 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGAGCCTTATCTCGTAT 12 0.3 TruSeq Adapter, Index 5 (97% over 37bp) CGTAACTGAAACATCGAGTAAAAACAGCTCTGGGCTCGGGCTTGGCGAGA 7 0.17500000000000002 No Hit GTTCTCTTTGTCAGATGATGAACAGATATCAGTGCCATTGGCAATTCCGT 6 0.15 No Hit GTTCCTTCTAAAGTTGAACTATTTCCAAACGACTTACCTAGGTTGGAGCT 6 0.15 No Hit ACCGGATTCATCACTGGCATGCTAAAAGGTGGGAAGTACATTGGAGGCAT 6 0.15 No Hit TTTCTGTTGTTGGCAGAGCAGGGAAGTCCCCCGTGCTAAAGTTTGGTGCA 6 0.15 No Hit GCTGCTTGCCAGCGAAGATGAGCCTCTGCTGGTCCGGGGGGATGCCCTCC 5 0.125 No Hit CCATGAATAAAGTTACACAACACGCAAACCATTCGGAATCGACTGACAGG 5 0.125 No Hit ACAGGTTTTAACCGAACCGAAATAGGAATACAGTATTTAAACGACAGACA 5 0.125 No Hit CTCAGTGCCATATGAACTCTCACTGTCCATTGCAACATCTTCTTGGCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 2.1 0.0 0.0 0.0 0.0 100-101 2.3625 0.0 0.0 0.0 0.0 102-103 2.5625 0.0 0.0 0.0 0.0 104-105 2.825 0.0 0.0 0.0 0.0 106-107 3.1500000000000004 0.0 0.0 0.0 0.0 108-109 3.425 0.0 0.0 0.0 0.0 110-111 3.85 0.0 0.0 0.0 0.0 112-113 4.275 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.375 0.0 0.0 0.0 0.0 118-119 5.949999999999999 0.0 0.0 0.0 0.0 120-121 6.574999999999999 0.0 0.0 0.0 0.0 122-123 7.2125 0.0 0.0 0.0 0.0 124-125 7.75 0.0 0.0 0.0 0.0 126-127 8.25 0.0 0.0 0.0 0.0 128-129 8.899999999999999 0.0 0.0 0.0 0.0 130-131 9.5375 0.0 0.0 0.0 0.0 132-133 10.1875 0.0 0.0 0.0 0.0 134-135 10.95 0.0 0.0 0.0 0.0 136-137 11.7375 0.0 0.0 0.0 0.0 138-139 12.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAGCC 10 0.006830828 145.0 6 GTTATGA 10 0.006830828 145.0 1 TTTTTTT 20 0.00593511 29.0 125-129 >>END_MODULE SRR12951292 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951292_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.216 37.0 37.0 37.0 37.0 37.0 2 36.1835 37.0 37.0 37.0 37.0 37.0 3 36.212 37.0 37.0 37.0 37.0 37.0 4 36.202 37.0 37.0 37.0 37.0 37.0 5 36.2715 37.0 37.0 37.0 37.0 37.0 6 36.231 37.0 37.0 37.0 37.0 37.0 7 36.125 37.0 37.0 37.0 37.0 37.0 8 36.343 37.0 37.0 37.0 37.0 37.0 9 36.206 37.0 37.0 37.0 37.0 37.0 10-14 36.1652 37.0 37.0 37.0 37.0 37.0 15-19 36.1729 37.0 37.0 37.0 37.0 37.0 20-24 36.0929 37.0 37.0 37.0 37.0 37.0 25-29 36.062400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0311 37.0 37.0 37.0 37.0 37.0 35-39 35.97 37.0 37.0 37.0 37.0 37.0 40-44 35.9772 37.0 37.0 37.0 37.0 37.0 45-49 35.919399999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.943799999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.816199999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.8712 37.0 37.0 37.0 37.0 37.0 65-69 35.812799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.7667 37.0 37.0 37.0 37.0 37.0 75-79 35.8214 37.0 37.0 37.0 37.0 37.0 80-84 35.768600000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.7522 37.0 37.0 37.0 37.0 37.0 90-94 35.784800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7813 37.0 37.0 37.0 37.0 37.0 100-104 35.5973 37.0 37.0 37.0 37.0 37.0 105-109 35.620799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.576299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6456 37.0 37.0 37.0 37.0 37.0 120-124 35.524300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.465199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.317699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.292500000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.217699999999994 37.0 37.0 37.0 32.2 37.0 145-149 35.0566 37.0 37.0 37.0 25.0 37.0 150-151 34.78175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 10.0 14 4.0 15 5.0 16 5.0 17 6.0 18 6.0 19 3.0 20 2.0 21 5.0 22 8.0 23 11.0 24 13.0 25 8.0 26 13.0 27 12.0 28 11.0 29 16.0 30 19.0 31 34.0 32 51.0 33 94.0 34 186.0 35 480.0 36 2660.0 37 337.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.25 19.325 7.85 27.575 2 28.975 22.55 25.35 23.125 3 23.65 24.825 27.950000000000003 23.575 4 28.125 30.4 19.55 21.925 5 27.55 30.75 19.75 21.95 6 25.525 33.300000000000004 18.175 23.0 7 24.45 19.475 32.65 23.425 8 25.124999999999996 23.575 22.95 28.349999999999998 9 24.925 22.225 24.55 28.299999999999997 10-14 26.69 24.925 22.715 25.669999999999998 15-19 26.779999999999998 24.775 22.814999999999998 25.629999999999995 20-24 26.8 24.575 23.625 25.0 25-29 26.640000000000004 24.545 23.54 25.275 30-34 26.755000000000003 23.825 24.13 25.290000000000003 35-39 26.279999999999998 24.77 23.794999999999998 25.155 40-44 26.919999999999998 24.759999999999998 23.419999999999998 24.9 45-49 26.325 24.515 23.64 25.52 50-54 27.065 23.965 24.169999999999998 24.8 55-59 26.700000000000003 24.099999999999998 24.095 25.105 60-64 26.490000000000002 24.125 24.205 25.180000000000003 65-69 26.619999999999997 25.22 23.89 24.27 70-74 27.200000000000003 24.14 23.630000000000003 25.03 75-79 26.334999999999997 24.6 23.84 25.224999999999998 80-84 26.86 24.735 24.025 24.38 85-89 27.375 25.145 23.085 24.395 90-94 27.305 24.404999999999998 23.369999999999997 24.92 95-99 27.155 25.535000000000004 23.52 23.79 100-104 27.27 25.06 23.195 24.474999999999998 105-109 27.395000000000003 25.055 23.74 23.810000000000002 110-114 27.76 24.415 23.52 24.305 115-119 27.37 25.290000000000003 23.26 24.08 120-124 27.825 25.56 22.8 23.815 125-129 28.439999999999998 25.245 23.119999999999997 23.195 130-134 29.07 24.645 22.939999999999998 23.345 135-139 29.145 25.285000000000004 22.615 22.955000000000002 140-144 29.955 25.585 22.485 21.975 145-149 29.81 25.074999999999996 22.705000000000002 22.41 150-151 30.975 24.099999999999998 22.575 22.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 2.0 14 2.5 15 1.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 2.0 25 1.0 26 1.5 27 1.0 28 1.5 29 3.0 30 5.0 31 6.5 32 11.0 33 21.5 34 28.5 35 29.5 36 37.5 37 48.5 38 61.5 39 85.5 40 108.0 41 127.0 42 143.5 43 140.5 44 159.0 45 191.5 46 185.5 47 165.0 48 154.5 49 150.5 50 147.5 51 143.0 52 126.5 53 126.0 54 120.5 55 91.5 56 78.5 57 74.0 58 81.5 59 95.5 60 81.5 61 73.5 62 70.0 63 75.0 64 83.5 65 67.5 66 62.0 67 69.0 68 65.5 69 48.0 70 40.5 71 44.0 72 42.5 73 41.0 74 40.0 75 27.5 76 17.0 77 13.0 78 11.5 79 8.5 80 4.5 81 3.5 82 2.0 83 2.0 84 1.5 85 0.5 86 0.5 87 0.5 88 1.0 89 2.5 90 2.5 91 1.5 92 0.5 93 0.0 94 1.5 95 2.5 96 3.0 97 2.0 98 0.5 99 4.0 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 78.9 #Duplication Level Percentage of deduplicated Percentage of total 1 80.38656527249684 63.425 2 14.860583016476554 23.45 3 3.2953105196451205 7.8 4 1.0773130544993663 3.4000000000000004 5 0.19011406844106463 0.75 6 0.12674271229404308 0.6 7 0.03168567807351077 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.03168567807351077 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit CAGACATTCATCCTTGCAGATTTCTGCTACTACTATGTGAAGAGTCTGGT 7 0.17500000000000002 No Hit ATCAAACTGTTGATGATGCTCCTGGTCGCCTTGTCTCTGCTGATCCCCAA 6 0.15 No Hit CAGCTGTTTGTTGAAACCATTGGCTGGCTGGTGGCTCGGAGTGGTGACTC 6 0.15 No Hit AACTTGTGCATTCAGACACTGAAGAAGATAAAAACTATACGAGAATCACA 6 0.15 No Hit TTCACATGCAGCCTTCTCAACTATGGGTTCAAGCAACTGGGAGCAAAATT 6 0.15 No Hit GTCAGGTCTTCTCTAGTCACCACTAAATCAACACAGCAATCAGCTCCCTT 5 0.125 No Hit GTCATCGACAGGATTGAACAGTCTCTGGGAGCCGGGTCGCTGAGCTTCCG 5 0.125 No Hit CATGAACCACCCTGGTCAGATTGGCAACGGCTACGCCCCAGTGCTGGACT 5 0.125 No Hit AGATCTAAGTGGCCTACATGGAAGAAATGGGTTGCAAATCTATGAAATTT 5 0.125 No Hit GTCGAGTCCTCTGACACAATCGACAACGTGAAGGCCAAGATCCAGGACAA 5 0.125 No Hit CTTGTCTACAAACCTTATACAGGGCCTTGCCCTCCAGCAGGAAGCTTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 1.0125 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.1749999999999998 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.7375 0.0 0.0 0.0 0.0 98-99 2.125 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.5999999999999996 0.0 0.0 0.0 0.0 104-105 2.85 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.4875 0.0 0.0 0.0 0.0 110-111 3.925 0.0 0.0 0.0 0.0 112-113 4.3625 0.0 0.0 0.0 0.0 114-115 4.725 0.0 0.0 0.0 0.0 116-117 5.475 0.0 0.0 0.0 0.0 118-119 6.050000000000001 0.0 0.0 0.0 0.0 120-121 6.6875 0.0 0.0 0.0 0.0 122-123 7.3375 0.0 0.0 0.0 0.0 124-125 7.875 0.0 0.0 0.0 0.0 126-127 8.375 0.0 0.0 0.0 0.0 128-129 9.024999999999999 0.0 0.0 0.0 0.0 130-131 9.6875 0.0 0.0 0.0 0.0 132-133 10.3125 0.0 0.0 0.0 0.0 134-135 11.075 0.0 0.0 0.0 0.0 136-137 11.8625 0.0 0.0 0.0 0.0 138-139 12.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTGT 10 0.006830828 145.0 1 >>END_MODULE Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra Read 2070701 spots for SRR12951292.sra Written 2070701 spots for SRR12951292.sra Read 2070685 spots for SRR12951292.sra Written 2070685 spots for SRR12951292.sra SRR ids: ['SRR12951292.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q73z_zx2 SRR12951292.sra spots: 41413716 blocks: [[1, 2070685], [2070686, 4141370], [4141371, 6212055], [6212056, 8282740], [8282741, 10353425], [10353426, 12424110], [12424111, 14494795], [14494796, 16565480], [16565481, 18636165], [18636166, 20706850], [20706851, 22777535], [22777536, 24848220], [24848221, 26918905], [26918906, 28989590], [28989591, 31060275], [31060276, 33130960], [33130961, 35201645], [35201646, 37272330], [37272331, 39343015], [39343016, 41413716]] SRR12951292 file size 14052492 SRR12951292 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951292 SRR12951292_1.fastq SRR12951292_2.fastq Input file: SRR12951292_1.fastq Paired file: SRR12951292_2.fastq trimmed: SRR12951292-trimmed-pair1.fastq, SRR12951292-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:48:46 2024 >> started Sat Dec 7 10:49:45 2024 >> done (59.309s) 41413716 read pairs processed; of these: 249 ( 0.00%) short read pairs filtered out after trimming by size control 78929 ( 0.19%) empty read pairs filtered out after trimming by size control 41334538 (99.81%) read pairs available; of these: 6645783 (16.08%) trimmed read pairs available after processing 34688755 (83.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 18 0.00% 20 18 0.00% 21 36 0.00% 22 47 0.00% 23 68 0.00% 24 53 0.00% 25 75 0.00% 26 85 0.00% 27 108 0.00% 28 96 0.00% 29 93 0.00% 30 116 0.00% 31 100 0.00% 32 111 0.00% 33 118 0.00% 34 90 0.00% 35 123 0.00% 36 121 0.00% 37 139 0.00% 38 139 0.00% 39 149 0.00% 40 150 0.00% 41 163 0.00% 42 192 0.00% 43 178 0.00% 44 198 0.00% 45 226 0.00% 46 205 0.00% 47 272 0.00% 48 265 0.00% 49 320 0.00% 50 374 0.00% 51 436 0.00% 52 478 0.00% 53 506 0.00% 54 540 0.00% 55 609 0.00% 56 684 0.00% 57 769 0.00% 58 968 0.00% 59 1019 0.00% 60 1223 0.00% 61 1439 0.00% 62 1535 0.00% 63 1703 0.00% 64 1985 0.00% 65 2018 0.00% 66 2248 0.01% 67 2609 0.01% 68 2878 0.01% 69 3403 0.01% 70 4034 0.01% 71 4471 0.01% 72 5165 0.01% 73 5853 0.01% 74 6492 0.02% 75 7238 0.02% 76 8080 0.02% 77 8656 0.02% 78 9860 0.02% 79 11097 0.03% 80 12491 0.03% 81 13953 0.03% 82 15658 0.04% 83 17260 0.04% 84 19388 0.05% 85 20819 0.05% 86 22666 0.05% 87 24165 0.06% 88 26279 0.06% 89 28068 0.07% 90 30584 0.07% 91 33248 0.08% 92 36186 0.09% 93 39088 0.09% 94 42087 0.10% 95 44207 0.11% 96 46618 0.11% 97 49106 0.12% 98 50584 0.12% 99 53735 0.13% 100 55871 0.14% 101 58698 0.14% 102 63015 0.15% 103 66008 0.16% 104 69267 0.17% 105 72170 0.17% 106 74013 0.18% 107 76315 0.18% 108 77783 0.19% 109 80494 0.19% 110 82870 0.20% 111 85807 0.21% 112 89398 0.22% 113 93537 0.23% 114 96318 0.23% 115 99170 0.24% 116 100729 0.24% 117 103901 0.25% 118 104845 0.25% 119 105524 0.26% 120 106678 0.26% 121 110731 0.27% 122 113192 0.27% 123 117147 0.28% 124 119864 0.29% 125 122190 0.30% 126 124863 0.30% 127 125745 0.30% 128 126338 0.31% 129 128477 0.31% 130 129091 0.31% 131 129865 0.31% 132 134018 0.32% 133 136861 0.33% 134 137811 0.33% 135 141378 0.34% 136 143527 0.35% 137 144121 0.35% 138 145258 0.35% 139 145736 0.35% 140 145620 0.35% 141 147073 0.36% 142 147793 0.36% 143 151225 0.37% 144 152647 0.37% 145 154577 0.37% 146 154373 0.37% 147 155970 0.38% 148 156149 0.38% 149 156690 0.38% 150 156388 0.38% 151 34688755 83.92% 41334538 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=29 prefix-density=0.26 prefix-fanout=3.1 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=426.09 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=21.0 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGATTGATCTGTGTGTTTTGATCGGATGGCTGGTGGCGCTCCGGCTCTCTGCTGCTGCTCCAACGTGGGTTGCTGG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=33 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=198.92 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=23.4 sequence=CGCCGCCGCCGC SRR12951292 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:50:32 Started mapping on | Dec 07 10:50:32 Finished on | Dec 07 10:56:00 Mapping speed, Million of reads per hour | 453.67 Number of input reads | 41334538 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 38573799 Uniquely mapped reads % | 93.32% Average mapped length | 292.19 Number of splices: Total | 35622708 Number of splices: Annotated (sjdb) | 33049480 Number of splices: GT/AG | 35112586 Number of splices: GC/AG | 424028 Number of splices: AT/AC | 21099 Number of splices: Non-canonical | 64995 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391312 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 45056 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2369427 2369427 2369427 N_multimapping 391312 391312 391312 N_noFeature 1527383 37571458 1847810 N_ambiguous 812810 4922 130630 UnstrandedReadsAssigned:36233606 PositiveStrandReadsAssigned:997419 NegativeStrandReadsAssigned:36595359 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951292 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951292-trimmed-pair1.fastq SRR12951292-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,334,538 reads, 37,316,733 reads pseudoaligned [quant] estimated average fragment length: 247.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR12951292.ke.tsv 35125 SRR12951292.se.tsv 88098 total ==> SRR12951292.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.858 0 0 PNS24247 1044 797.351 201.496 10.0324 PNS24249 1928 1681.35 662.696 15.6474 PNS24246 1044 797.351 201.496 10.0324 PNS24248 1044 797.351 201.496 10.0324 PNS24244 1471 1224.35 210.815 6.8357 PNS24243 293 106.802 0 0 KQK14069 1603 1356.35 30681.5 898.031 KQK14071 474 248.249 995.857 159.256 ==> SRR12951292.se.tsv <== BRADI_1g14170v3 34892 BRADI_1g53295v3 190 BRADI_1g59795v3 997 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 1040 BRADI_1g74790v3 3257 BRADI_1g09890v3 0 BRADI_1g77505v3 279 BRADI_1g48960v3 0 SRR12951292 completed mapping pipeline successfully