Starting /dee2/code/volunteer_pipeline.sh SRR12951293 current disk space = 1543373246464 free memory = 1600912628 SRR12951293 SRAfilesize 04f6d65e80f6fdb2a25812b3c800badf SRR12951293.sra SRR12951293.sra file validated SRR12951293 is paired end SRR12951293 is conventional basespace SRR12951293 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951293_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.471 37.0 37.0 37.0 37.0 37.0 2 36.03375 37.0 37.0 37.0 37.0 37.0 3 36.4035 37.0 37.0 37.0 37.0 37.0 4 36.5725 37.0 37.0 37.0 37.0 37.0 5 36.541 37.0 37.0 37.0 37.0 37.0 6 36.6145 37.0 37.0 37.0 37.0 37.0 7 36.5505 37.0 37.0 37.0 37.0 37.0 8 36.4745 37.0 37.0 37.0 37.0 37.0 9 36.556 37.0 37.0 37.0 37.0 37.0 10-14 36.5467 37.0 37.0 37.0 37.0 37.0 15-19 36.52610000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4906 37.0 37.0 37.0 37.0 37.0 25-29 36.4715 37.0 37.0 37.0 37.0 37.0 30-34 36.4439 37.0 37.0 37.0 37.0 37.0 35-39 36.438599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.313399999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9131 37.0 37.0 37.0 37.0 37.0 50-54 36.2153 37.0 37.0 37.0 37.0 37.0 55-59 35.679500000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.698 37.0 37.0 37.0 37.0 37.0 65-69 35.460499999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.6618 37.0 37.0 37.0 37.0 37.0 75-79 36.232000000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.2913 37.0 37.0 37.0 37.0 37.0 85-89 36.1835 37.0 37.0 37.0 37.0 37.0 90-94 36.2231 37.0 37.0 37.0 37.0 37.0 95-99 36.1362 37.0 37.0 37.0 37.0 37.0 100-104 36.1391 37.0 37.0 37.0 37.0 37.0 105-109 36.2065 37.0 37.0 37.0 37.0 37.0 110-114 36.109500000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1704 37.0 37.0 37.0 37.0 37.0 120-124 36.0898 37.0 37.0 37.0 37.0 37.0 125-129 36.0297 37.0 37.0 37.0 37.0 37.0 130-134 35.9799 37.0 37.0 37.0 37.0 37.0 135-139 35.8772 37.0 37.0 37.0 37.0 37.0 140-144 35.827099999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.755100000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.464749999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 3.0 25 3.0 26 5.0 27 11.0 28 12.0 29 16.0 30 30.0 31 32.0 32 63.0 33 108.0 34 252.0 35 309.0 36 2740.0 37 413.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 51.300000000000004 11.1 4.05 33.550000000000004 2 20.463126101182986 14.095142209916938 33.97936068462119 31.462371004278882 3 18.05 15.975 29.099999999999998 36.875 4 23.474999999999998 20.5 21.65 34.375 5 29.25 26.75 21.625 22.375 6 26.35 31.275 21.3 21.075 7 17.424999999999997 27.85 35.65 19.075 8 18.975 27.075 27.750000000000004 26.200000000000003 9 24.525 20.825 30.675 23.974999999999998 10-14 23.775 26.314999999999998 23.585 26.325 15-19 23.95 24.435000000000002 24.685000000000002 26.93 20-24 23.165 26.61 24.685000000000002 25.540000000000003 25-29 23.515 25.069999999999997 24.98 26.435 30-34 22.785 25.485000000000003 25.365 26.365 35-39 21.945 24.295 26.705000000000002 27.055 40-44 22.475 24.255 25.174999999999997 28.095 45-49 23.745 24.07 26.125 26.06 50-54 24.965 23.86 24.779999999999998 26.395000000000003 55-59 23.555 23.465 25.525 27.455000000000002 60-64 23.78 24.305 25.900000000000002 26.015 65-69 24.33 26.705000000000002 23.53 25.435000000000002 70-74 27.245 23.98 22.900000000000002 25.874999999999996 75-79 28.03 23.49 23.7 24.779999999999998 80-84 28.410000000000004 23.369999999999997 24.015 24.205 85-89 27.765 23.75 23.275000000000002 25.21 90-94 28.349999999999998 22.955000000000002 23.515 25.180000000000003 95-99 28.1 23.605 23.79 24.505 100-104 28.095 24.044999999999998 22.735 25.124999999999996 105-109 27.794999999999998 24.14 22.994999999999997 25.069999999999997 110-114 28.044999999999998 24.025 22.685 25.245 115-119 27.275 24.22 22.81 25.695 120-124 27.99 23.895 22.465 25.650000000000002 125-129 27.750000000000004 22.994999999999997 23.465 25.790000000000003 130-134 27.694999999999997 24.055 22.54 25.71 135-139 27.310000000000002 23.87 22.775000000000002 26.045 140-144 27.24 23.35 23.625 25.785000000000004 145-149 26.91 23.24 22.939999999999998 26.91 150-151 27.462500000000002 22.8 22.3625 27.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 0.5 30 4.5 31 10.5 32 10.0 33 13.0 34 20.5 35 29.0 36 45.5 37 62.5 38 74.0 39 85.0 40 104.5 41 136.5 42 151.0 43 155.5 44 169.5 45 177.5 46 191.0 47 188.5 48 166.0 49 151.5 50 144.0 51 134.0 52 145.5 53 138.0 54 105.0 55 101.0 56 93.0 57 83.0 58 83.0 59 71.0 60 66.0 61 69.5 62 61.5 63 66.0 64 76.0 65 99.0 66 104.5 67 83.0 68 70.5 69 50.0 70 37.0 71 37.0 72 32.0 73 22.5 74 17.5 75 14.0 76 10.5 77 7.5 78 5.5 79 6.5 80 6.5 81 5.5 82 3.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.875 #Duplication Level Percentage of deduplicated Percentage of total 1 84.13145539906102 67.2 2 12.488262910798122 19.950000000000003 3 2.6917057902973394 6.45 4 0.3442879499217527 1.0999999999999999 5 0.1564945226917058 0.625 6 0.12519561815336464 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.03129890453834116 1.275 >100 0.03129890453834116 2.8000000000000003 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCTTCCATCTCGTAT 112 2.8000000000000003 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCTTCCATCGCGTAT 51 1.275 TruSeq Adapter, Index 8 (97% over 36bp) CTCGAATCGAATCGAATCCAATCGATCGATCATGGCCTCCGCCTCCCCCT 6 0.15 No Hit GCCTTTATGGCCAACAAAGTCCCACCATAGAGGCATAGACAGGACTTTGT 6 0.15 No Hit CCTGGTCCAGTGTCTCAATCAATGCTTTGAGGGACTTGATCTCAATGACT 6 0.15 No Hit CTCCCAGTCAATCGGTTTGGGTTCCTGCGAGAACTTGGTCTGGAGCTGGT 6 0.15 No Hit ATGCACTCCGTCGTCGCGGTGCCTGGTGGTGATCGTCCAGTCAGGAGCAG 5 0.125 No Hit GGCTCGTTGATGATACGCATGACATTAAGACCAGCAATAACACCAGCATC 5 0.125 No Hit GAACCATCCAGTAGCACAACCAAGGTCGATTGGCATCGAGCACATGGAAG 5 0.125 No Hit GGAAGATTAACTTCAGTTCACACCCACACAAATAAGGTTCCTGAGATACA 5 0.125 No Hit CTGCCGTCGAGCTCCTTGCCGTTCATCCCCTCGATGGCCGCCTGCATCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.7625 0.0 0.0 0.0 0.0 96-97 2.05 0.0 0.0 0.0 0.0 98-99 2.2375 0.0 0.0 0.0 0.0 100-101 2.45 0.0 0.0 0.0 0.0 102-103 3.0125 0.0 0.0 0.0 0.0 104-105 3.6500000000000004 0.0 0.0 0.0 0.0 106-107 4.2125 0.0 0.0 0.0 0.0 108-109 4.8 0.0 0.0 0.0 0.0 110-111 5.6375 0.0 0.0 0.0 0.0 112-113 6.175 0.0 0.0 0.0 0.0 114-115 6.9 0.0 0.0 0.0 0.0 116-117 7.762499999999999 0.0 0.0 0.0 0.0 118-119 8.2375 0.0 0.0 0.0 0.0 120-121 8.6 0.0 0.0 0.0 0.0 122-123 9.2 0.0 0.0 0.0 0.0 124-125 10.075 0.0 0.0 0.0 0.0 126-127 10.7875 0.0 0.0 0.0 0.0 128-129 11.475 0.0 0.0 0.0 0.0 130-131 12.225 0.0 0.0 0.0 0.0 132-133 13.05 0.0 0.0 0.0 0.0 134-135 13.8375 0.0 0.0 0.0 0.0 136-137 14.7 0.0 0.0 0.0 0.0 138-139 15.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 75 2.1205773E-5 48.333336 9 AGAGCAC 75 2.1205773E-5 48.333336 8 GATCGGA 80 3.1063704E-5 45.3125 1 TCGGAAG 80 3.1063704E-5 45.3125 3 ATCGGAA 80 3.1063704E-5 45.3125 2 AAGAGCA 85 4.444814E-5 42.64706 7 GAAGAGC 85 4.444814E-5 42.64706 6 CGGAAGA 85 4.444814E-5 42.64706 4 GGAAGAG 90 6.229055E-5 40.27778 5 AGGGGGG 20 0.00593511 29.0 65-69 GCTTGAA 20 0.00593511 29.0 60-64 TGCCGTC 35 0.0035366106 20.714287 50-54 GTATGCC 40 0.0076550315 18.125 45-49 TATGCCG 40 0.0076550315 18.125 45-49 ATGCCGT 40 0.0076550315 18.125 45-49 CGTATGC 40 0.0076550315 18.125 45-49 >>END_MODULE SRR12951293 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951293_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.125 37.0 37.0 37.0 37.0 37.0 2 36.1695 37.0 37.0 37.0 37.0 37.0 3 36.064 37.0 37.0 37.0 37.0 37.0 4 36.1815 37.0 37.0 37.0 37.0 37.0 5 36.1395 37.0 37.0 37.0 37.0 37.0 6 36.287 37.0 37.0 37.0 37.0 37.0 7 35.9015 37.0 37.0 37.0 37.0 37.0 8 35.8835 37.0 37.0 37.0 37.0 37.0 9 35.835 37.0 37.0 37.0 37.0 37.0 10-14 35.7288 37.0 37.0 37.0 37.0 37.0 15-19 35.751999999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.50940000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.25750000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.1803 37.0 37.0 37.0 37.0 37.0 35-39 35.076800000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.1793 37.0 37.0 37.0 37.0 37.0 45-49 35.059 37.0 37.0 37.0 37.0 37.0 50-54 35.0452 37.0 37.0 37.0 37.0 37.0 55-59 35.0923 37.0 37.0 37.0 37.0 37.0 60-64 35.17620000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.1386 37.0 37.0 37.0 37.0 37.0 70-74 34.998599999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.0128 37.0 37.0 37.0 32.2 37.0 80-84 35.033699999999996 37.0 37.0 37.0 32.2 37.0 85-89 35.3957 37.0 37.0 37.0 37.0 37.0 90-94 35.6189 37.0 37.0 37.0 37.0 37.0 95-99 35.7087 37.0 37.0 37.0 37.0 37.0 100-104 35.7341 37.0 37.0 37.0 37.0 37.0 105-109 35.71640000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.7312 37.0 37.0 37.0 37.0 37.0 115-119 35.822199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7104 37.0 37.0 37.0 37.0 37.0 125-129 35.6851 37.0 37.0 37.0 37.0 37.0 130-134 35.553900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.4358 37.0 37.0 37.0 37.0 37.0 140-144 35.3615 37.0 37.0 37.0 37.0 37.0 145-149 35.128 37.0 37.0 37.0 29.8 37.0 150-151 34.745999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 3.0 15 5.0 16 4.0 17 3.0 18 9.0 19 7.0 20 8.0 21 13.0 22 19.0 23 10.0 24 40.0 25 49.0 26 45.0 27 22.0 28 17.0 29 18.0 30 27.0 31 24.0 32 44.0 33 71.0 34 182.0 35 440.0 36 2583.0 37 351.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.075 20.4 6.4750000000000005 27.05 2 32.324999999999996 22.475 25.15 20.05 3 26.150000000000002 24.15 26.8 22.900000000000002 4 30.3 28.475 19.775000000000002 21.45 5 29.599999999999998 31.7 17.45 21.25 6 26.424999999999997 32.25 19.625 21.7 7 27.150000000000002 19.2 31.65 22.0 8 26.474999999999998 21.475 22.725 29.325000000000003 9 28.425 19.675 25.6 26.3 10-14 29.744999999999997 24.18 21.78 24.295 15-19 29.75 23.400000000000002 22.12 24.73 20-24 29.630000000000003 23.375 23.04 23.955000000000002 25-29 29.880000000000003 23.23 22.43 24.46 30-34 28.335 23.885 24.005000000000003 23.775 35-39 28.42 24.19 23.31 24.08 40-44 29.134999999999998 24.315 23.215 23.335 45-49 27.495000000000005 23.82 24.41 24.275 50-54 28.835 24.03 23.625 23.51 55-59 29.110000000000003 24.215 22.985 23.69 60-64 29.630000000000003 23.585 22.965 23.82 65-69 28.165000000000003 24.22 23.36 24.255 70-74 28.915000000000003 24.815 23.505000000000003 22.765 75-79 28.18 24.709999999999997 23.435 23.674999999999997 80-84 28.725 23.745 23.62 23.91 85-89 30.259999999999998 23.39 23.29 23.06 90-94 29.885 22.865 23.61 23.64 95-99 30.375000000000004 24.075 22.645 22.905 100-104 30.84 23.91 22.355 22.895 105-109 30.785 24.240000000000002 22.405 22.57 110-114 31.1 23.880000000000003 22.325 22.695 115-119 31.255 24.0 22.09 22.655 120-124 31.235000000000003 24.05 22.64 22.075 125-129 31.745 23.29 22.665 22.3 130-134 31.900000000000002 24.29 22.54 21.27 135-139 31.879999999999995 24.055 22.425 21.64 140-144 31.285 24.310000000000002 22.725 21.68 145-149 31.865 23.435 23.119999999999997 21.58 150-151 31.937500000000004 22.375 22.8625 22.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 0.5 25 1.0 26 1.0 27 3.5 28 6.5 29 6.0 30 4.0 31 6.5 32 13.5 33 13.0 34 16.0 35 26.5 36 35.5 37 44.0 38 60.0 39 84.0 40 110.5 41 132.5 42 136.0 43 132.5 44 146.5 45 173.5 46 174.5 47 173.0 48 169.0 49 151.0 50 138.5 51 127.5 52 127.0 53 118.5 54 98.5 55 85.0 56 86.5 57 87.5 58 93.5 59 88.5 60 86.5 61 91.0 62 77.5 63 68.5 64 62.0 65 66.0 66 67.0 67 65.0 68 60.5 69 52.0 70 44.0 71 41.0 72 38.0 73 34.0 74 31.5 75 24.5 76 21.5 77 17.0 78 9.5 79 9.5 80 8.0 81 2.5 82 3.5 83 3.5 84 3.5 85 4.5 86 4.5 87 5.0 88 7.0 89 9.0 90 8.0 91 8.0 92 8.0 93 8.0 94 13.5 95 17.5 96 14.0 97 9.0 98 5.0 99 2.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.5 #Duplication Level Percentage of deduplicated Percentage of total 1 84.76047904191617 70.775 2 11.88622754491018 19.85 3 2.7245508982035926 6.825 4 0.29940119760479045 1.0 5 0.20958083832335328 0.8750000000000001 6 0.08982035928143713 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.029940119760479042 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit TTCGTTTGTGCGGTCGGAGCGCGGCGCCGGCGAAAGCGAGGTGAGAGATC 6 0.15 No Hit TGAGATCAAGGTTGAGGAAACCTTGCAAGATTCAGGTAAAAAAGACTTCA 6 0.15 No Hit GGTGATTGGGTCTTGTTGGGTGAGAGGAGGGGTGGAGAAGACCTCCTCCT 6 0.15 No Hit CTCACTTGGTGGAGCGTCTGAAATCGCTGCAGCAGAAGCATGAAATCATT 5 0.125 No Hit ATGGTTCGCGTTTCCCTGAGATCCGCGAGGCGGCACAGAGACAGAGCTCG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTG 5 0.125 No Hit GTCTGCTTCTTGCAAACCAGCCTGAGTTCTTAGCTCAAGAATGGCCTATT 5 0.125 No Hit GGCCGTATAAGGTTATTTCTGGCCCAGCAGACAAGCCTATGATTGTAGTG 5 0.125 No Hit CAGACCTTCATCATGATCAAGCCCGACGGCGTCCAGAGGGGCCTCATCGG 5 0.125 No Hit CCGCCTTCAGCAACTTCGGCGAGATCCTCGACGCCAAGATCATCCAGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.7625 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.2625 0.0 0.0 0.0 0.0 100-101 2.4749999999999996 0.0 0.0 0.0 0.0 102-103 3.0374999999999996 0.0 0.0 0.0 0.0 104-105 3.675 0.0 0.0 0.0 0.0 106-107 4.2375 0.0 0.0 0.0 0.0 108-109 4.775 0.0 0.0 0.0 0.0 110-111 5.575 0.0 0.0 0.0 0.0 112-113 6.1125 0.0 0.0 0.0 0.0 114-115 6.85 0.0 0.0 0.0 0.0 116-117 7.7125 0.0 0.0 0.0 0.0 118-119 8.1875 0.0 0.0 0.0 0.0 120-121 8.55 0.0 0.0 0.0 0.0 122-123 9.1375 0.0 0.0 0.0 0.0 124-125 10.0 0.0 0.0 0.0 0.0 126-127 10.7125 0.0 0.0 0.0 0.0 128-129 11.375 0.0 0.0 0.0 0.0 130-131 12.1 0.0 0.0 0.0 0.0 132-133 12.9125 0.0 0.0 0.0 0.0 134-135 13.675 0.0 0.0 0.0 0.0 136-137 14.524999999999999 0.0 0.0 0.0 0.0 138-139 15.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGGCT 10 0.006830828 145.0 1 >>END_MODULE Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363772 spots for SRR12951293.sra Written 1363772 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra Read 1363756 spots for SRR12951293.sra Written 1363756 spots for SRR12951293.sra SRR ids: ['SRR12951293.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tn9wf0kz SRR12951293.sra spots: 27275136 blocks: [[1, 1363756], [1363757, 2727512], [2727513, 4091268], [4091269, 5455024], [5455025, 6818780], [6818781, 8182536], [8182537, 9546292], [9546293, 10910048], [10910049, 12273804], [12273805, 13637560], [13637561, 15001316], [15001317, 16365072], [16365073, 17728828], [17728829, 19092584], [19092585, 20456340], [20456341, 21820096], [21820097, 23183852], [23183853, 24547608], [24547609, 25911364], [25911365, 27275136]] SRR12951293 file size 9247584 SRR12951293 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951293 SRR12951293_1.fastq SRR12951293_2.fastq Input file: SRR12951293_1.fastq Paired file: SRR12951293_2.fastq trimmed: SRR12951293-trimmed-pair1.fastq, SRR12951293-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:47:42 2024 >> started Sat Dec 7 10:48:11 2024 >> done (29.266s) 27275136 read pairs processed; of these: 243 ( 0.00%) short read pairs filtered out after trimming by size control 885542 ( 3.25%) empty read pairs filtered out after trimming by size control 26389351 (96.75%) read pairs available; of these: 5041293 (19.10%) trimmed read pairs available after processing 21348058 (80.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 16 0.00% 20 23 0.00% 21 34 0.00% 22 42 0.00% 23 59 0.00% 24 63 0.00% 25 78 0.00% 26 94 0.00% 27 72 0.00% 28 105 0.00% 29 124 0.00% 30 104 0.00% 31 120 0.00% 32 148 0.00% 33 135 0.00% 34 145 0.00% 35 133 0.00% 36 150 0.00% 37 165 0.00% 38 316 0.00% 39 181 0.00% 40 180 0.00% 41 171 0.00% 42 155 0.00% 43 232 0.00% 44 249 0.00% 45 267 0.00% 46 249 0.00% 47 325 0.00% 48 360 0.00% 49 397 0.00% 50 428 0.00% 51 530 0.00% 52 582 0.00% 53 595 0.00% 54 640 0.00% 55 654 0.00% 56 852 0.00% 57 866 0.00% 58 1054 0.00% 59 1259 0.00% 60 1335 0.01% 61 1561 0.01% 62 1706 0.01% 63 2043 0.01% 64 2278 0.01% 65 2382 0.01% 66 2678 0.01% 67 2884 0.01% 68 3327 0.01% 69 3838 0.01% 70 4488 0.02% 71 5214 0.02% 72 5818 0.02% 73 6593 0.02% 74 7226 0.03% 75 7914 0.03% 76 8884 0.03% 77 9455 0.04% 78 10465 0.04% 79 11591 0.04% 80 12846 0.05% 81 14316 0.05% 82 16208 0.06% 83 18166 0.07% 84 19786 0.07% 85 21549 0.08% 86 22662 0.09% 87 24054 0.09% 88 25346 0.10% 89 27042 0.10% 90 29123 0.11% 91 31477 0.12% 92 34055 0.13% 93 36204 0.14% 94 38825 0.15% 95 40974 0.16% 96 42407 0.16% 97 44227 0.17% 98 45713 0.17% 99 47208 0.18% 100 49337 0.19% 101 50987 0.19% 102 53344 0.20% 103 56371 0.21% 104 57975 0.22% 105 60992 0.23% 106 62607 0.24% 107 63211 0.24% 108 64296 0.24% 109 65280 0.25% 110 67029 0.25% 111 69006 0.26% 112 72054 0.27% 113 73159 0.28% 114 76088 0.29% 115 77016 0.29% 116 79069 0.30% 117 80323 0.30% 118 81582 0.31% 119 81308 0.31% 120 81862 0.31% 121 83521 0.32% 122 84707 0.32% 123 86299 0.33% 124 89614 0.34% 125 90151 0.34% 126 90461 0.34% 127 92159 0.35% 128 92337 0.35% 129 93280 0.35% 130 92732 0.35% 131 94191 0.36% 132 94723 0.36% 133 96361 0.37% 134 98539 0.37% 135 99485 0.38% 136 100229 0.38% 137 100253 0.38% 138 100118 0.38% 139 100703 0.38% 140 100692 0.38% 141 100825 0.38% 142 101500 0.38% 143 101737 0.39% 144 102920 0.39% 145 104319 0.40% 146 104239 0.40% 147 104294 0.40% 148 104345 0.40% 149 103348 0.39% 150 104084 0.39% 151 21348058 80.90% 26389351 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=28 prefix-density=0.27 prefix-fanout=3.0 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=463.78 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=20.8 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGATTGATCTGTGTGTTTTGATCGGATGGCTGGTGGCGCTCCGGCTCTCTGCTGCTGCTCCAACGTGGGTTGCTG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=31 prefix-density=0.74 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=211.75 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=19.6 sequence=CCGCCGCCGCCA SRR12951293 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:48:58 Started mapping on | Dec 07 10:48:58 Finished on | Dec 07 10:51:06 Mapping speed, Million of reads per hour | 742.20 Number of input reads | 26389351 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 25049918 Uniquely mapped reads % | 94.92% Average mapped length | 289.79 Number of splices: Total | 22896110 Number of splices: Annotated (sjdb) | 21283668 Number of splices: GT/AG | 22584037 Number of splices: GC/AG | 257256 Number of splices: AT/AC | 14166 Number of splices: Non-canonical | 40651 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266239 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 45888 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.05% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1073194 1073194 1073194 N_multimapping 266239 266239 266239 N_noFeature 987892 24377001 1204520 N_ambiguous 537083 3413 81051 UnstrandedReadsAssigned:23524943 PositiveStrandReadsAssigned:669504 NegativeStrandReadsAssigned:23764347 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951293 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951293-trimmed-pair1.fastq SRR12951293-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,389,351 reads, 24,055,454 reads pseudoaligned [quant] estimated average fragment length: 246.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,389 rounds 52973 SRR12951293.ke.tsv 35125 SRR12951293.se.tsv 88098 total ==> SRR12951293.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.315 0 0 PNS24247 1044 798.587 113.435 8.70876 PNS24249 1928 1682.59 317.597 11.5726 PNS24246 1044 798.587 113.435 8.70876 PNS24248 1044 798.587 113.435 8.70876 PNS24244 1471 1225.59 204.097 10.21 PNS24243 293 112.343 0 0 KQK14069 1603 1357.59 22389.5 1011.13 KQK14071 474 252.839 640.745 155.372 ==> SRR12951293.se.tsv <== BRADI_1g14170v3 25667 BRADI_1g53295v3 194 BRADI_1g59795v3 618 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 857 BRADI_1g74790v3 2568 BRADI_1g09890v3 0 BRADI_1g77505v3 218 BRADI_1g48960v3 0 SRR12951293 completed mapping pipeline successfully