Starting /dee2/code/volunteer_pipeline.sh SRR12951295 current disk space = 1543300603904 free memory = 1601884748 SRR12951295 SRAfilesize ca982e8d07dafc47fc51afd167341159 SRR12951295.sra SRR12951295.sra file validated SRR12951295 is paired end SRR12951295 is conventional basespace SRR12951295 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951295_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.534 37.0 37.0 37.0 37.0 37.0 2 36.2135 37.0 37.0 37.0 37.0 37.0 3 36.485 37.0 37.0 37.0 37.0 37.0 4 36.656 37.0 37.0 37.0 37.0 37.0 5 36.552 37.0 37.0 37.0 37.0 37.0 6 36.672 37.0 37.0 37.0 37.0 37.0 7 36.5265 37.0 37.0 37.0 37.0 37.0 8 36.5615 37.0 37.0 37.0 37.0 37.0 9 36.512 37.0 37.0 37.0 37.0 37.0 10-14 36.58220000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.534000000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.495599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4411 37.0 37.0 37.0 37.0 37.0 30-34 36.4435 37.0 37.0 37.0 37.0 37.0 35-39 36.4548 37.0 37.0 37.0 37.0 37.0 40-44 36.4058 37.0 37.0 37.0 37.0 37.0 45-49 36.338699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.26 37.0 37.0 37.0 37.0 37.0 55-59 36.2528 37.0 37.0 37.0 37.0 37.0 60-64 36.2066 37.0 37.0 37.0 37.0 37.0 65-69 36.222300000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.200700000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.274 37.0 37.0 37.0 37.0 37.0 80-84 36.3084 37.0 37.0 37.0 37.0 37.0 85-89 36.25449999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2372 37.0 37.0 37.0 37.0 37.0 95-99 36.1921 37.0 37.0 37.0 37.0 37.0 100-104 36.2214 37.0 37.0 37.0 37.0 37.0 105-109 36.193200000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1388 37.0 37.0 37.0 37.0 37.0 115-119 36.1656 37.0 37.0 37.0 37.0 37.0 120-124 36.0387 37.0 37.0 37.0 37.0 37.0 125-129 36.0125 37.0 37.0 37.0 37.0 37.0 130-134 35.935500000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.8728 37.0 37.0 37.0 37.0 37.0 140-144 35.665200000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.5318 37.0 37.0 37.0 37.0 37.0 150-151 35.42375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 1.0 25 5.0 26 7.0 27 4.0 28 15.0 29 26.0 30 24.0 31 38.0 32 65.0 33 97.0 34 99.0 35 315.0 36 2813.0 37 486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.95 10.375 4.2 35.475 2 21.543489190548016 11.689291101055806 33.30819507290095 33.45902463549522 3 21.075 15.45 26.325 37.15 4 25.7 20.0 22.15 32.15 5 28.549999999999997 24.425 22.475 24.55 6 24.95 29.5 21.75 23.799999999999997 7 20.125 24.925 36.675000000000004 18.275 8 21.975 24.25 27.575 26.200000000000003 9 22.2 20.575 30.65 26.575 10-14 23.89 25.635 25.2 25.275 15-19 23.77 24.169999999999998 24.83 27.229999999999997 20-24 24.465 25.025 24.495 26.015 25-29 24.15 25.205 24.26 26.384999999999998 30-34 24.8 23.84 24.615000000000002 26.745 35-39 23.96 24.68 24.83 26.529999999999998 40-44 23.865 24.740000000000002 24.315 27.08 45-49 24.825 24.68 23.75 26.745 50-54 24.22 24.365000000000002 24.86 26.555 55-59 25.230000000000004 24.295 24.205 26.27 60-64 24.865000000000002 24.085 24.445 26.605 65-69 24.985 24.32 24.455 26.240000000000002 70-74 25.03 24.255 24.18 26.534999999999997 75-79 25.1 23.27 24.42 27.21 80-84 25.145 24.445 23.95 26.46 85-89 24.834999999999997 24.27 24.48 26.415 90-94 24.8 23.54 25.03 26.63 95-99 25.52 24.195 24.075 26.21 100-104 25.419999999999998 24.29 24.295 25.995 105-109 25.814999999999998 25.319999999999997 23.22 25.645 110-114 26.290000000000003 24.32 23.835 25.555 115-119 26.195 25.515 22.575 25.715 120-124 25.115 25.105 23.31 26.47 125-129 25.974999999999998 25.21 22.74 26.075 130-134 25.53 24.805 23.055 26.61 135-139 25.445 24.785 22.775000000000002 26.995 140-144 25.955000000000002 24.905 22.63 26.51 145-149 26.279999999999998 24.82 22.685 26.215 150-151 26.450000000000003 26.0625 22.0 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.5 27 2.5 28 2.0 29 3.5 30 6.0 31 6.5 32 6.0 33 9.5 34 19.5 35 26.0 36 36.5 37 53.5 38 64.5 39 78.0 40 95.0 41 129.5 42 159.5 43 158.0 44 164.5 45 184.0 46 167.5 47 157.5 48 171.5 49 179.5 50 170.5 51 153.0 52 132.5 53 116.0 54 114.5 55 103.0 56 82.0 57 89.5 58 95.0 59 89.0 60 91.5 61 85.5 62 81.5 63 68.0 64 58.5 65 61.0 66 73.0 67 76.0 68 61.0 69 53.0 70 49.5 71 44.0 72 41.0 73 35.5 74 30.5 75 22.0 76 13.0 77 8.0 78 7.0 79 4.5 80 2.0 81 1.0 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.6 #Duplication Level Percentage of deduplicated Percentage of total 1 83.74697336561744 69.175 2 12.651331719128327 20.9 3 2.663438256658596 6.6000000000000005 4 0.6961259079903147 2.3 5 0.211864406779661 0.8750000000000001 6 0.03026634382566586 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTAGGCGTTGATCCAGAAGGGGGCGTTGGTCTCGGCGAGGAAGCGGAGG 6 0.15 No Hit GCCGAACCATTAAGCGGTTAAGGATAAATGTTGCTACGACAAGTCATCAA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCAAGCAATCTCGTTT 5 0.125 TruSeq Adapter, Index 1 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCAAGCAATCTCGTAT 5 0.125 TruSeq Adapter, Index 1 (97% over 37bp) CGTGTATCGGAACTGCGTCGACCCCGACGGCATCCTCGCTCGTCTCGCCG 5 0.125 No Hit GAGACCGATCTCTTCCTTCTTTTCTTTTTCTTCTTGAGACAATCGACGAT 5 0.125 No Hit GATGGCCTTTCCCCATGCTCCCACCATAGGGTGAGGCAGAACCCAAATGA 5 0.125 No Hit GCCATTGCTGTAAATGTGCGGATGCATAGGCGCCGGGTTGAGGAAAATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.6125 0.0 0.0 0.0 0.0 96-97 1.9375 0.0 0.0 0.0 0.0 98-99 2.425 0.0 0.0 0.0 0.0 100-101 3.025 0.0 0.0 0.0 0.0 102-103 3.5125 0.0 0.0 0.0 0.0 104-105 4.1 0.0 0.0 0.0 0.0 106-107 4.575 0.0 0.0 0.0 0.0 108-109 5.387499999999999 0.0 0.0 0.0 0.0 110-111 5.9 0.0 0.0 0.0 0.0 112-113 6.550000000000001 0.0 0.0 0.0 0.0 114-115 7.125 0.0 0.0 0.0 0.0 116-117 7.9 0.0 0.0 0.0 0.0 118-119 8.600000000000001 0.0 0.0 0.0 0.0 120-121 9.3625 0.0 0.0 0.0 0.0 122-123 10.2625 0.0 0.0 0.0 0.0 124-125 11.087499999999999 0.0 0.0 0.0 0.0 126-127 11.7125 0.0 0.0 0.0 0.0 128-129 12.837499999999999 0.0 0.0 0.0 0.0 130-131 13.649999999999999 0.0 0.0 0.0 0.0 132-133 14.575 0.0 0.0 0.0 0.0 134-135 15.3875 0.0 0.0 0.0 0.0 136-137 16.137500000000003 0.0 0.0 0.0 0.0 138-139 17.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12951295 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951295_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3205 37.0 37.0 37.0 37.0 37.0 2 36.1865 37.0 37.0 37.0 37.0 37.0 3 36.2065 37.0 37.0 37.0 37.0 37.0 4 36.187 37.0 37.0 37.0 37.0 37.0 5 36.2435 37.0 37.0 37.0 37.0 37.0 6 36.261 37.0 37.0 37.0 37.0 37.0 7 36.2595 37.0 37.0 37.0 37.0 37.0 8 36.3055 37.0 37.0 37.0 37.0 37.0 9 36.224 37.0 37.0 37.0 37.0 37.0 10-14 36.2337 37.0 37.0 37.0 37.0 37.0 15-19 36.2016 37.0 37.0 37.0 37.0 37.0 20-24 36.0958 37.0 37.0 37.0 37.0 37.0 25-29 36.0117 37.0 37.0 37.0 37.0 37.0 30-34 35.967999999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9317 37.0 37.0 37.0 37.0 37.0 40-44 35.9645 37.0 37.0 37.0 37.0 37.0 45-49 35.911199999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.904700000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9191 37.0 37.0 37.0 37.0 37.0 60-64 35.8609 37.0 37.0 37.0 37.0 37.0 65-69 35.8726 37.0 37.0 37.0 37.0 37.0 70-74 35.8122 37.0 37.0 37.0 37.0 37.0 75-79 35.746500000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.7489 37.0 37.0 37.0 37.0 37.0 85-89 35.7515 37.0 37.0 37.0 37.0 37.0 90-94 35.8319 37.0 37.0 37.0 37.0 37.0 95-99 35.8233 37.0 37.0 37.0 37.0 37.0 100-104 35.7879 37.0 37.0 37.0 37.0 37.0 105-109 35.7493 37.0 37.0 37.0 37.0 37.0 110-114 35.7097 37.0 37.0 37.0 37.0 37.0 115-119 35.7763 37.0 37.0 37.0 37.0 37.0 120-124 35.610400000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.4914 37.0 37.0 37.0 37.0 37.0 130-134 35.4503 37.0 37.0 37.0 34.6 37.0 135-139 35.3516 37.0 37.0 37.0 37.0 37.0 140-144 35.226299999999995 37.0 37.0 37.0 34.6 37.0 145-149 34.901399999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.471000000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 8.0 14 8.0 15 6.0 16 6.0 17 2.0 18 2.0 19 0.0 20 4.0 21 2.0 22 8.0 23 8.0 24 10.0 25 10.0 26 8.0 27 10.0 28 20.0 29 16.0 30 20.0 31 35.0 32 52.0 33 79.0 34 174.0 35 532.0 36 2643.0 37 334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.325 21.224999999999998 7.3 28.15 2 30.675 22.525000000000002 25.15 21.65 3 24.6 23.925 28.050000000000004 23.425 4 27.025 29.75 18.4 24.825 5 30.3 30.5 17.375 21.825 6 25.1 34.175 19.325 21.4 7 25.0 20.825 31.3 22.875 8 25.05 22.1 23.025000000000002 29.825000000000003 9 26.974999999999998 20.474999999999998 26.375 26.174999999999997 10-14 27.43 25.52 21.529999999999998 25.52 15-19 27.705000000000002 24.044999999999998 22.595000000000002 25.655 20-24 27.565 23.755000000000003 22.965 25.715 25-29 27.33 24.26 23.085 25.324999999999996 30-34 26.619999999999997 24.075 22.915 26.39 35-39 27.139999999999997 24.085 23.01 25.765 40-44 28.03 23.515 22.965 25.490000000000002 45-49 26.495 23.745 23.580000000000002 26.179999999999996 50-54 27.155 23.9 23.885 25.06 55-59 27.29 24.065 23.39 25.255 60-64 27.05 23.849999999999998 23.525 25.575 65-69 27.21 24.025 23.330000000000002 25.435000000000002 70-74 28.105000000000004 24.005000000000003 22.665 25.224999999999998 75-79 27.58 24.154999999999998 23.635 24.63 80-84 27.965 24.45 23.21 24.375 85-89 27.229999999999997 24.54 22.605 25.624999999999996 90-94 28.075 24.235 23.145 24.545 95-99 28.22 24.395 23.015 24.37 100-104 27.860000000000003 25.15 22.25 24.740000000000002 105-109 28.299999999999997 24.94 22.835 23.925 110-114 28.665000000000003 25.019999999999996 22.155 24.16 115-119 29.270000000000003 24.490000000000002 22.689999999999998 23.549999999999997 120-124 28.939999999999998 24.515 23.005 23.54 125-129 29.32 25.124999999999996 22.11 23.445 130-134 29.695 25.45 22.189999999999998 22.665 135-139 30.185000000000002 25.77 22.38 21.665 140-144 30.735 25.36 21.91 21.995 145-149 30.635 25.195 21.990000000000002 22.18 150-151 32.375 24.45 21.375 21.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 0.0 24 0.0 25 0.0 26 2.5 27 2.5 28 0.5 29 2.5 30 4.0 31 5.0 32 5.0 33 8.0 34 13.5 35 24.0 36 33.0 37 42.0 38 62.0 39 79.0 40 89.0 41 103.0 42 139.0 43 161.0 44 158.5 45 164.0 46 161.5 47 153.5 48 161.0 49 154.5 50 149.0 51 155.0 52 126.5 53 107.0 54 109.5 55 101.5 56 93.0 57 98.0 58 106.0 59 99.5 60 87.0 61 79.0 62 86.0 63 92.0 64 79.5 65 74.5 66 76.5 67 68.5 68 62.5 69 62.0 70 62.5 71 52.0 72 40.5 73 35.5 74 32.5 75 23.0 76 15.5 77 18.0 78 10.5 79 4.5 80 4.0 81 5.5 82 5.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.5 91 2.0 92 3.0 93 3.5 94 3.5 95 2.5 96 1.0 97 2.0 98 4.0 99 5.0 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.075 #Duplication Level Percentage of deduplicated Percentage of total 1 84.53204935299429 70.22500000000001 2 12.127595546193199 20.150000000000002 3 2.407463135720734 6.0 4 0.6921456515197111 2.3 5 0.18055973517905505 0.75 6 0.03009328919650918 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.03009328919650918 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GGCGCAGCTCGGCATGGACGGCTACGTGCACGTCTCCACGGCCAGTTCCC 6 0.15 No Hit CCTAACCCTAGGCAGCACATCCTCAATCGCACCGCGCGCGGCCGCCGGCG 5 0.125 No Hit GTGAGGATGTGGGAGGACTTCGACAAGGGCCACGTCGCCGGCGCCCGCAA 5 0.125 No Hit TTTGTTGGAGGCTTCCTCTCACAATTGGTTCAAGGGAAGAGCATTGAGGA 5 0.125 No Hit CTCTCTTCGCCTCCTTCCTTCCCTTCCGCAAGAACCCAAGCGCACCATGA 5 0.125 No Hit GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 5 0.125 No Hit GCTTGATGAAGTTTCTGCAGCTGTTTCTGTCTTGCTTGGTTTTGCACCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.3624999999999998 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 1.95 0.0 0.0 0.0 0.0 98-99 2.4125 0.0 0.0 0.0 0.0 100-101 3.0250000000000004 0.0 0.0 0.0 0.0 102-103 3.5875 0.0 0.0 0.0 0.0 104-105 4.125 0.0 0.0 0.0 0.0 106-107 4.6 0.0 0.0 0.0 0.0 108-109 5.3875 0.0 0.0 0.0 0.0 110-111 5.887499999999999 0.0 0.0 0.0 0.0 112-113 6.550000000000001 0.0 0.0 0.0 0.0 114-115 7.125 0.0 0.0 0.0 0.0 116-117 7.9375 0.0 0.0 0.0 0.0 118-119 8.6375 0.0 0.0 0.0 0.0 120-121 9.375 0.0 0.0 0.0 0.0 122-123 10.25 0.0 0.0 0.0 0.0 124-125 11.075 0.0 0.0 0.0 0.0 126-127 11.7625 0.0 0.0 0.0 0.0 128-129 12.925 0.0 0.0 0.0 0.0 130-131 13.75 0.0 0.0 0.0 0.0 132-133 14.662500000000001 0.0 0.0 0.0 0.0 134-135 15.462499999999999 0.0 0.0 0.0 0.0 136-137 16.237499999999997 0.0 0.0 0.0 0.0 138-139 17.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAATT 10 0.006830828 145.0 4 >>END_MODULE Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480084 spots for SRR12951295.sra Written 1480084 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra Read 1480072 spots for SRR12951295.sra Written 1480072 spots for SRR12951295.sra SRR ids: ['SRR12951295.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zpeyg9y6 SRR12951295.sra spots: 29601452 blocks: [[1, 1480072], [1480073, 2960144], [2960145, 4440216], [4440217, 5920288], [5920289, 7400360], [7400361, 8880432], [8880433, 10360504], [10360505, 11840576], [11840577, 13320648], [13320649, 14800720], [14800721, 16280792], [16280793, 17760864], [17760865, 19240936], [19240937, 20721008], [20721009, 22201080], [22201081, 23681152], [23681153, 25161224], [25161225, 26641296], [26641297, 28121368], [28121369, 29601452]] SRR12951295 file size 10038168 SRR12951295 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951295 SRR12951295_1.fastq SRR12951295_2.fastq Input file: SRR12951295_1.fastq Paired file: SRR12951295_2.fastq trimmed: SRR12951295-trimmed-pair1.fastq, SRR12951295-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:54:03 2024 >> started Sat Dec 7 10:54:35 2024 >> done (31.966s) 29601452 read pairs processed; of these: 362 ( 0.00%) short read pairs filtered out after trimming by size control 166612 ( 0.56%) empty read pairs filtered out after trimming by size control 29434478 (99.44%) read pairs available; of these: 6504043 (22.10%) trimmed read pairs available after processing 22930435 (77.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 36 0.00% 20 37 0.00% 21 60 0.00% 22 63 0.00% 23 83 0.00% 24 111 0.00% 25 118 0.00% 26 143 0.00% 27 146 0.00% 28 148 0.00% 29 184 0.00% 30 170 0.00% 31 184 0.00% 32 181 0.00% 33 175 0.00% 34 216 0.00% 35 244 0.00% 36 231 0.00% 37 239 0.00% 38 226 0.00% 39 250 0.00% 40 289 0.00% 41 246 0.00% 42 298 0.00% 43 334 0.00% 44 306 0.00% 45 370 0.00% 46 367 0.00% 47 397 0.00% 48 428 0.00% 49 513 0.00% 50 557 0.00% 51 590 0.00% 52 693 0.00% 53 706 0.00% 54 761 0.00% 55 865 0.00% 56 954 0.00% 57 1032 0.00% 58 1231 0.00% 59 1386 0.00% 60 1467 0.00% 61 1790 0.01% 62 1991 0.01% 63 2170 0.01% 64 2495 0.01% 65 2599 0.01% 66 2855 0.01% 67 3191 0.01% 68 3603 0.01% 69 4059 0.01% 70 4965 0.02% 71 5369 0.02% 72 6029 0.02% 73 7259 0.02% 74 8002 0.03% 75 8784 0.03% 76 9576 0.03% 77 10307 0.04% 78 11567 0.04% 79 12803 0.04% 80 14270 0.05% 81 15809 0.05% 82 17929 0.06% 83 19964 0.07% 84 21909 0.07% 85 24483 0.08% 86 26414 0.09% 87 27972 0.10% 88 29914 0.10% 89 32032 0.11% 90 34496 0.12% 91 37493 0.13% 92 40903 0.14% 93 44215 0.15% 94 46996 0.16% 95 49551 0.17% 96 53122 0.18% 97 54805 0.19% 98 57064 0.19% 99 60012 0.20% 100 62272 0.21% 101 65111 0.22% 102 67833 0.23% 103 71250 0.24% 104 74443 0.25% 105 77714 0.26% 106 80837 0.27% 107 81644 0.28% 108 82789 0.28% 109 86996 0.30% 110 87394 0.30% 111 89503 0.30% 112 92989 0.32% 113 95119 0.32% 114 97375 0.33% 115 101093 0.34% 116 103110 0.35% 117 104520 0.36% 118 106612 0.36% 119 107405 0.36% 120 108479 0.37% 121 109629 0.37% 122 110701 0.38% 123 113256 0.38% 124 115841 0.39% 125 119190 0.40% 126 119531 0.41% 127 120865 0.41% 128 120703 0.41% 129 122793 0.42% 130 123875 0.42% 131 123431 0.42% 132 125134 0.43% 133 127267 0.43% 134 126855 0.43% 135 129750 0.44% 136 131335 0.45% 137 130517 0.44% 138 133240 0.45% 139 131794 0.45% 140 132216 0.45% 141 133002 0.45% 142 134910 0.46% 143 133816 0.45% 144 135683 0.46% 145 136951 0.47% 146 135817 0.46% 147 135668 0.46% 148 136628 0.46% 149 136099 0.46% 150 137231 0.47% 151 22930435 77.90% 29434478 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.74 fanout-score-rank=23 prefix-density=0.46 prefix-fanout=3.2 sequence=CGCTGCTGGTCCGGGGGGATGCCCTCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=415.68 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=26.0 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=18 prefix-density=0.60 prefix-fanout=3.1 sequence=AAGATCCAGGACAAGGAGGGCATCCCCCCGGACCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=183.52 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=22.6 sequence=CCGCCGCCGCCG SRR12951295 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:55:21 Started mapping on | Dec 07 10:55:21 Finished on | Dec 07 10:57:56 Mapping speed, Million of reads per hour | 683.64 Number of input reads | 29434478 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 27746980 Uniquely mapped reads % | 94.27% Average mapped length | 288.63 Number of splices: Total | 24121501 Number of splices: Annotated (sjdb) | 22287601 Number of splices: GT/AG | 23806577 Number of splices: GC/AG | 273218 Number of splices: AT/AC | 15488 Number of splices: Non-canonical | 26218 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228734 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 84813 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 1.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1458764 1458764 1458764 N_multimapping 228734 228734 228734 N_noFeature 1055032 27017754 1290675 N_ambiguous 571008 3541 76809 UnstrandedReadsAssigned:26120940 PositiveStrandReadsAssigned:725685 NegativeStrandReadsAssigned:26379496 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR12951295 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951295-trimmed-pair1.fastq SRR12951295-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,434,478 reads, 26,818,832 reads pseudoaligned [quant] estimated average fragment length: 227.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR12951295.ke.tsv 35125 SRR12951295.se.tsv 88098 total ==> SRR12951295.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.897 0 0 PNS24247 1044 817.454 267.631 18.3603 PNS24249 1928 1701.45 697.402 22.9863 PNS24246 1044 817.454 267.631 18.3603 PNS24248 1044 817.454 267.631 18.3603 PNS24244 1471 1244.45 262.706 11.8385 PNS24243 293 115.273 1 0.486495 KQK14069 1603 1376.45 18679.2 761.031 KQK14071 474 264.484 508.953 107.916 ==> SRR12951295.se.tsv <== BRADI_1g14170v3 20763 BRADI_1g53295v3 185 BRADI_1g59795v3 603 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 806 BRADI_1g74790v3 1782 BRADI_1g09890v3 0 BRADI_1g77505v3 208 BRADI_1g48960v3 0 SRR12951295 completed mapping pipeline successfully