Starting /dee2/code/volunteer_pipeline.sh SRR12951299 current disk space = 1543385133056 free memory = 1601940300 SRR12951299 SRAfilesize 51f0f44de19d428ddb550511a406d890 SRR12951299.sra SRR12951299.sra file validated SRR12951299 is paired end SRR12951299 is conventional basespace SRR12951299 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951299_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5195 37.0 37.0 37.0 37.0 37.0 2 36.33075 37.0 37.0 37.0 37.0 37.0 3 36.4415 37.0 37.0 37.0 37.0 37.0 4 36.625 37.0 37.0 37.0 37.0 37.0 5 36.6265 37.0 37.0 37.0 37.0 37.0 6 36.5875 37.0 37.0 37.0 37.0 37.0 7 36.5485 37.0 37.0 37.0 37.0 37.0 8 36.616 37.0 37.0 37.0 37.0 37.0 9 36.51 37.0 37.0 37.0 37.0 37.0 10-14 36.580400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.57180000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.537299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.472500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.452799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.461299999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.456100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3755 37.0 37.0 37.0 37.0 37.0 50-54 36.352599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3822 37.0 37.0 37.0 37.0 37.0 60-64 36.3489 37.0 37.0 37.0 37.0 37.0 65-69 36.3817 37.0 37.0 37.0 37.0 37.0 70-74 36.3 37.0 37.0 37.0 37.0 37.0 75-79 36.261300000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.318200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.275800000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.23270000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.2359 37.0 37.0 37.0 37.0 37.0 100-104 36.294200000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.2401 37.0 37.0 37.0 37.0 37.0 110-114 36.1388 37.0 37.0 37.0 37.0 37.0 115-119 36.175599999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0752 37.0 37.0 37.0 37.0 37.0 125-129 36.003499999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.0008 37.0 37.0 37.0 37.0 37.0 135-139 35.9763 37.0 37.0 37.0 37.0 37.0 140-144 35.7131 37.0 37.0 37.0 37.0 37.0 145-149 35.7358 37.0 37.0 37.0 37.0 37.0 150-151 35.51625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 3.0 26 4.0 27 5.0 28 14.0 29 18.0 30 32.0 31 31.0 32 61.0 33 70.0 34 125.0 35 309.0 36 2856.0 37 472.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.525 12.075 4.575 38.824999999999996 2 22.255714644561667 11.27857322280834 36.071338859583015 30.39437327304697 3 19.375 15.075 26.0 39.550000000000004 4 25.45 21.9 21.5 31.15 5 27.175 28.249999999999996 23.25 21.325 6 24.825 29.475 21.8 23.9 7 20.349999999999998 24.8 37.275000000000006 17.575 8 19.725 23.674999999999997 28.475 28.125 9 20.575 21.525 32.7 25.2 10-14 23.98 25.865 25.685000000000002 24.47 15-19 24.145 25.014999999999997 24.095 26.745 20-24 23.064999999999998 25.34 25.36 26.235000000000003 25-29 24.59 23.595 25.069999999999997 26.745 30-34 23.919999999999998 25.115 24.85 26.115 35-39 24.38 25.06 24.525 26.035000000000004 40-44 24.115000000000002 25.25 24.095 26.540000000000003 45-49 23.474999999999998 25.045 24.735 26.745 50-54 24.44 25.055 24.32 26.185000000000002 55-59 23.9 25.135 24.63 26.334999999999997 60-64 24.935 24.04 24.349999999999998 26.674999999999997 65-69 24.18 24.815 24.44 26.565 70-74 24.86 24.8 24.295 26.045 75-79 24.63 24.665 24.525 26.179999999999996 80-84 25.0 25.259999999999998 24.474999999999998 25.264999999999997 85-89 24.779999999999998 24.86 24.04 26.32 90-94 25.155 25.52 23.765 25.56 95-99 24.735 25.495 24.19 25.580000000000002 100-104 24.755 24.610000000000003 24.425 26.21 105-109 24.765 25.169999999999998 23.505000000000003 26.56 110-114 24.435000000000002 25.46 24.375 25.729999999999997 115-119 24.525 25.650000000000002 23.815 26.009999999999998 120-124 24.295 25.31 23.235 27.16 125-129 25.06 24.985 23.330000000000002 26.625 130-134 25.169999999999998 25.074999999999996 23.405 26.35 135-139 24.285 25.064999999999998 23.615 27.034999999999997 140-144 24.645 25.080000000000002 24.185000000000002 26.090000000000003 145-149 24.515 24.845 23.325000000000003 27.315 150-151 25.7625 24.2875 24.075 25.874999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 2.5 27 3.0 28 1.5 29 4.5 30 7.5 31 10.0 32 16.0 33 22.5 34 25.5 35 33.5 36 33.5 37 49.5 38 80.5 39 92.5 40 112.5 41 136.0 42 147.5 43 170.5 44 184.5 45 177.0 46 166.5 47 173.0 48 189.0 49 184.0 50 159.5 51 142.0 52 142.5 53 121.0 54 99.5 55 87.0 56 94.0 57 96.0 58 70.0 59 64.0 60 77.0 61 79.5 62 69.0 63 74.0 64 78.5 65 74.0 66 59.0 67 49.5 68 46.5 69 46.0 70 51.0 71 39.5 72 33.0 73 30.5 74 23.5 75 18.5 76 15.5 77 11.5 78 7.0 79 8.0 80 5.5 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.65 #Duplication Level Percentage of deduplicated Percentage of total 1 82.85364360073484 67.65 2 12.951622780159216 21.15 3 3.3680342927127986 8.25 4 0.5817513778322106 1.9 5 0.21432945499081446 0.8750000000000001 6 0.0 0.0 7 0.03061849357011635 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCCTTGGAACTGGAACACCAAAGTAGGAGCCAGCTGATCTTGGTCGCC 7 0.17500000000000002 No Hit GGAAGAAATCCTGGATCCTGGCGACGTACTCCTTCTGGAAGCGGATCCTC 5 0.125 No Hit AAGCAGTTCTTTTGCCTGGCATGAACCGAAATCCGGATCCGCCTCATGGT 5 0.125 No Hit GATGCATCACGTACTACACATCATGCGTCTGCAGATCACTTCTCGTCGCC 5 0.125 No Hit GTAATGAGGCTGCTGGAAACTGCAAGAATGTTATTATTGTCAAGTGCGAG 5 0.125 No Hit CCGTAGGACAATAACAGCAACCTGCATTTGCAAGTACAACTTATCCAGCA 5 0.125 No Hit AGCCCTGACTGCATCCTCCTCTTCCTGAGTCTCTCGGCGATGATGAAGGC 5 0.125 No Hit GTCCAACAGGATAGTCATTCCCCTTCTTGACAGTGGTTTCAGGCACCGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3375 0.0 0.0 0.0 0.0 72-73 0.425 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.7375 0.0 0.0 0.0 0.0 78-79 0.8875 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.175 0.0 0.0 0.0 0.0 84-85 1.3875 0.0 0.0 0.0 0.0 86-87 1.7125 0.0 0.0 0.0 0.0 88-89 1.95 0.0 0.0 0.0 0.0 90-91 2.2125 0.0 0.0 0.0 0.0 92-93 2.6125 0.0 0.0 0.0 0.0 94-95 3.0125 0.0 0.0 0.0 0.0 96-97 3.3625 0.0 0.0 0.0 0.0 98-99 3.7625 0.0 0.0 0.0 0.0 100-101 4.525 0.0 0.0 0.0 0.0 102-103 5.199999999999999 0.0 0.0 0.0 0.0 104-105 5.85 0.0 0.0 0.0 0.0 106-107 6.362500000000001 0.0 0.0 0.0 0.0 108-109 7.0625 0.0 0.0 0.0 0.0 110-111 7.975 0.0 0.0 0.0 0.0 112-113 8.899999999999999 0.0 0.0 0.0 0.0 114-115 9.75 0.0 0.0 0.0 0.0 116-117 10.649999999999999 0.0 0.0 0.0 0.0 118-119 11.3375 0.0 0.0 0.0 0.0 120-121 12.375 0.0 0.0 0.0 0.0 122-123 13.337499999999999 0.0 0.0 0.0 0.0 124-125 14.524999999999999 0.0 0.0 0.0 0.0 126-127 15.1375 0.0 0.0 0.0 0.0 128-129 15.8375 0.0 0.0 0.0 0.0 130-131 16.875 0.0 0.0 0.0 0.0 132-133 17.825000000000003 0.0 0.0 0.0 0.0 134-135 18.7375 0.0 0.0 0.0 0.0 136-137 19.4 0.0 0.0 0.0 0.0 138-139 20.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCTTG 10 0.006830828 145.0 9 >>END_MODULE SRR12951299 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951299_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3265 37.0 37.0 37.0 37.0 37.0 2 36.17 37.0 37.0 37.0 37.0 37.0 3 36.17 37.0 37.0 37.0 37.0 37.0 4 36.2755 37.0 37.0 37.0 37.0 37.0 5 36.332 37.0 37.0 37.0 37.0 37.0 6 36.3885 37.0 37.0 37.0 37.0 37.0 7 36.334 37.0 37.0 37.0 37.0 37.0 8 36.4235 37.0 37.0 37.0 37.0 37.0 9 36.356 37.0 37.0 37.0 37.0 37.0 10-14 36.3451 37.0 37.0 37.0 37.0 37.0 15-19 36.3469 37.0 37.0 37.0 37.0 37.0 20-24 36.303 37.0 37.0 37.0 37.0 37.0 25-29 36.2941 37.0 37.0 37.0 37.0 37.0 30-34 36.2684 37.0 37.0 37.0 37.0 37.0 35-39 36.2322 37.0 37.0 37.0 37.0 37.0 40-44 36.2724 37.0 37.0 37.0 37.0 37.0 45-49 36.231399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.1476 37.0 37.0 37.0 37.0 37.0 55-59 36.1345 37.0 37.0 37.0 37.0 37.0 60-64 36.1629 37.0 37.0 37.0 37.0 37.0 65-69 36.13870000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.088 37.0 37.0 37.0 37.0 37.0 75-79 36.0585 37.0 37.0 37.0 37.0 37.0 80-84 36.055400000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.023 37.0 37.0 37.0 37.0 37.0 90-94 36.04 37.0 37.0 37.0 37.0 37.0 95-99 35.9308 37.0 37.0 37.0 37.0 37.0 100-104 35.8889 37.0 37.0 37.0 37.0 37.0 105-109 35.871399999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7433 37.0 37.0 37.0 37.0 37.0 115-119 35.7965 37.0 37.0 37.0 37.0 37.0 120-124 35.596199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.503 37.0 37.0 37.0 37.0 37.0 130-134 35.22 37.0 37.0 37.0 34.6 37.0 135-139 35.1631 37.0 37.0 37.0 34.6 37.0 140-144 34.8247 37.0 37.0 37.0 25.0 37.0 145-149 34.4852 37.0 37.0 37.0 25.0 37.0 150-151 34.079750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 4.0 23 4.0 24 5.0 25 9.0 26 6.0 27 8.0 28 16.0 29 12.0 30 32.0 31 44.0 32 54.0 33 139.0 34 230.0 35 543.0 36 2519.0 37 362.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.275 22.5 6.0 31.225 2 29.225 23.1 27.775 19.900000000000002 3 22.0 24.075 29.725 24.2 4 25.724999999999998 32.475 19.675 22.125 5 28.499999999999996 32.675 19.0 19.825 6 24.575 35.225 18.275 21.925 7 24.55 20.150000000000002 31.275 24.025 8 22.15 23.150000000000002 25.275 29.425 9 23.875 22.35 27.3 26.474999999999998 10-14 26.090000000000003 24.709999999999997 23.580000000000002 25.619999999999997 15-19 26.715 24.765 23.13 25.39 20-24 26.290000000000003 24.895 23.76 25.055 25-29 26.25 24.975 23.35 25.424999999999997 30-34 27.169999999999998 24.315 23.555 24.959999999999997 35-39 26.474999999999998 24.255 24.14 25.130000000000003 40-44 26.1 23.96 23.825 26.115 45-49 26.889999999999997 24.14 24.099999999999998 24.87 50-54 26.775 23.705000000000002 24.33 25.19 55-59 26.91 24.05 24.345 24.695 60-64 26.86 24.215 24.32 24.605 65-69 25.855 24.7 24.2 25.245 70-74 25.95 25.369999999999997 23.74 24.94 75-79 27.229999999999997 24.65 23.974999999999998 24.145 80-84 26.229999999999997 24.855 23.765 25.15 85-89 26.619999999999997 24.07 24.23 25.080000000000002 90-94 27.715 24.73 23.65 23.905 95-99 27.1 25.080000000000002 23.380000000000003 24.44 100-104 28.075 24.455 23.645 23.825 105-109 27.935 24.625 23.355 24.085 110-114 28.110000000000003 25.09 23.49 23.31 115-119 29.01 24.779999999999998 23.044999999999998 23.165 120-124 28.87 24.990000000000002 22.765 23.375 125-129 30.285 24.75 22.23 22.735 130-134 30.035 24.645 23.075000000000003 22.245 135-139 30.714999999999996 24.795 22.689999999999998 21.8 140-144 31.455 24.099999999999998 22.805 21.64 145-149 32.824999999999996 23.885 22.365 20.925 150-151 34.2 23.2625 21.587500000000002 20.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 2.0 28 3.5 29 2.0 30 4.5 31 7.5 32 11.0 33 17.0 34 20.0 35 28.5 36 35.5 37 43.5 38 69.5 39 93.5 40 106.0 41 115.5 42 135.5 43 157.0 44 175.5 45 188.5 46 194.0 47 191.0 48 170.0 49 149.0 50 132.5 51 123.0 52 119.0 53 116.5 54 109.0 55 92.5 56 90.5 57 89.5 58 86.5 59 99.0 60 94.0 61 86.0 62 95.0 63 87.0 64 70.0 65 69.5 66 66.0 67 60.5 68 64.0 69 57.5 70 45.5 71 46.0 72 42.0 73 29.5 74 24.0 75 23.0 76 19.0 77 12.0 78 6.5 79 2.0 80 1.0 81 1.5 82 1.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 1.0 98 1.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.925 #Duplication Level Percentage of deduplicated Percentage of total 1 83.00274641440342 68.0 2 13.121757705218187 21.5 3 3.021055843759536 7.425 4 0.6103143118706134 2.0 5 0.183094293561184 0.75 6 0.030515715593530668 0.15 7 0.030515715593530668 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCATCGTCATCACGCGGGGCCGGCGTCCGGGTCGGCGTCGGCGTCGAG 7 0.17500000000000002 No Hit CGTATACTGCTATAACAGACCTTGTGCTCTGTATGCTGCTCCTGATCCTT 6 0.15 No Hit GTGTCCTTTTGTCTGCTCATCTCATCGATCCGACTACCTGGAACACGACC 5 0.125 No Hit AAGACTCGTCCATTTGATTCCATTATGAATGAGGTGCGTGCGTTCTTCGA 5 0.125 No Hit GTCGCATGCGTGTCCAGGAAGATGGCCATGTACGGCCTCCGCAAGTTCCT 5 0.125 No Hit AGTTGGGCAGCTGTGCATTTGGGATCAAATCAAGTATGCATCTGAGCTTG 5 0.125 No Hit GTGGAGCAAGGCAAGATGAAGCGCATGACCGGGGTGCGCAGCAAGCAGAT 5 0.125 No Hit CTCCCCTCCCTCATCCAGCTCCCCTACGTCCCCGGCCGCCGACGAGCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3625 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.6625000000000001 0.0 0.0 0.0 0.0 76-77 0.7875000000000001 0.0 0.0 0.0 0.0 78-79 0.9375 0.0 0.0 0.0 0.0 80-81 1.0875 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.4375 0.0 0.0 0.0 0.0 86-87 1.775 0.0 0.0 0.0 0.0 88-89 2.025 0.0 0.0 0.0 0.0 90-91 2.2875 0.0 0.0 0.0 0.0 92-93 2.6875 0.0 0.0 0.0 0.0 94-95 3.1 0.0 0.0 0.0 0.0 96-97 3.4625000000000004 0.0 0.0 0.0 0.0 98-99 3.8625 0.0 0.0 0.0 0.0 100-101 4.625 0.0 0.0 0.0 0.0 102-103 5.300000000000001 0.0 0.0 0.0 0.0 104-105 5.95 0.0 0.0 0.0 0.0 106-107 6.4625 0.0 0.0 0.0 0.0 108-109 7.1625 0.0 0.0 0.0 0.0 110-111 8.075 0.0 0.0 0.0 0.0 112-113 8.9875 0.0 0.0 0.0 0.0 114-115 9.8125 0.0 0.0 0.0 0.0 116-117 10.675 0.0 0.0 0.0 0.0 118-119 11.3625 0.0 0.0 0.0 0.0 120-121 12.399999999999999 0.0 0.0 0.0 0.0 122-123 13.412500000000001 0.0 0.0 0.0 0.0 124-125 14.575 0.0 0.0 0.0 0.0 126-127 15.1875 0.0 0.0 0.0 0.0 128-129 15.8875 0.0 0.0 0.0 0.0 130-131 16.875 0.0 0.0 0.0 0.0 132-133 17.8125 0.0 0.0 0.0 0.0 134-135 18.7375 0.0 0.0 0.0 0.0 136-137 19.4 0.0 0.0 0.0 0.0 138-139 20.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGAG 10 0.006830828 145.0 3 CATAAAC 10 0.006830828 145.0 2 >>END_MODULE Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657550 spots for SRR12951299.sra Written 1657550 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra Read 1657546 spots for SRR12951299.sra Written 1657546 spots for SRR12951299.sra SRR ids: ['SRR12951299.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l8sdsxpr SRR12951299.sra spots: 33150924 blocks: [[1, 1657546], [1657547, 3315092], [3315093, 4972638], [4972639, 6630184], [6630185, 8287730], [8287731, 9945276], [9945277, 11602822], [11602823, 13260368], [13260369, 14917914], [14917915, 16575460], [16575461, 18233006], [18233007, 19890552], [19890553, 21548098], [21548099, 23205644], [23205645, 24863190], [24863191, 26520736], [26520737, 28178282], [28178283, 29835828], [29835829, 31493374], [31493375, 33150924]] SRR12951299 file size 11244433 SRR12951299 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951299 SRR12951299_1.fastq SRR12951299_2.fastq Input file: SRR12951299_1.fastq Paired file: SRR12951299_2.fastq trimmed: SRR12951299-trimmed-pair1.fastq, SRR12951299-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:03:19 2024 >> started Sat Dec 7 11:04:00 2024 >> done (40.095s) 33150924 read pairs processed; of these: 665 ( 0.00%) short read pairs filtered out after trimming by size control 31617 ( 0.10%) empty read pairs filtered out after trimming by size control 33118642 (99.90%) read pairs available; of these: 8200748 (24.76%) trimmed read pairs available after processing 24917894 (75.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 39 0.00% 19 55 0.00% 20 62 0.00% 21 87 0.00% 22 149 0.00% 23 178 0.00% 24 268 0.00% 25 255 0.00% 26 313 0.00% 27 345 0.00% 28 326 0.00% 29 352 0.00% 30 392 0.00% 31 366 0.00% 32 361 0.00% 33 379 0.00% 34 409 0.00% 35 369 0.00% 36 379 0.00% 37 416 0.00% 38 487 0.00% 39 445 0.00% 40 440 0.00% 41 596 0.00% 42 543 0.00% 43 532 0.00% 44 544 0.00% 45 610 0.00% 46 640 0.00% 47 777 0.00% 48 835 0.00% 49 1014 0.00% 50 1012 0.00% 51 1172 0.00% 52 1329 0.00% 53 1451 0.00% 54 1423 0.00% 55 1549 0.00% 56 1772 0.01% 57 1936 0.01% 58 2363 0.01% 59 2559 0.01% 60 3069 0.01% 61 3525 0.01% 62 3819 0.01% 63 4277 0.01% 64 4652 0.01% 65 4853 0.01% 66 5588 0.02% 67 6130 0.02% 68 6796 0.02% 69 7799 0.02% 70 9176 0.03% 71 10276 0.03% 72 11340 0.03% 73 13269 0.04% 74 14279 0.04% 75 15708 0.05% 76 16872 0.05% 77 18886 0.06% 78 20641 0.06% 79 22628 0.07% 80 24866 0.08% 81 27896 0.08% 82 31774 0.10% 83 34281 0.10% 84 37349 0.11% 85 40497 0.12% 86 43495 0.13% 87 45468 0.14% 88 48148 0.15% 89 51336 0.16% 90 54283 0.16% 91 58411 0.18% 92 62017 0.19% 93 67131 0.20% 94 71624 0.22% 95 75210 0.23% 96 77192 0.23% 97 80532 0.24% 98 81820 0.25% 99 85605 0.26% 100 87977 0.27% 101 90128 0.27% 102 94249 0.28% 103 98682 0.30% 104 101419 0.31% 105 105625 0.32% 106 107373 0.32% 107 110282 0.33% 108 110473 0.33% 109 113452 0.34% 110 114016 0.34% 111 117539 0.35% 112 119907 0.36% 113 122483 0.37% 114 126578 0.38% 115 129601 0.39% 116 130507 0.39% 117 131936 0.40% 118 132065 0.40% 119 131608 0.40% 120 133596 0.40% 121 135567 0.41% 122 136444 0.41% 123 139028 0.42% 124 142749 0.43% 125 143588 0.43% 126 143641 0.43% 127 145197 0.44% 128 144214 0.44% 129 146274 0.44% 130 147538 0.45% 131 145928 0.44% 132 147600 0.45% 133 149414 0.45% 134 150178 0.45% 135 151171 0.46% 136 152493 0.46% 137 152572 0.46% 138 152510 0.46% 139 151379 0.46% 140 150449 0.45% 141 151403 0.46% 142 152246 0.46% 143 152546 0.46% 144 154118 0.47% 145 153150 0.46% 146 154172 0.47% 147 153967 0.46% 148 154249 0.47% 149 152881 0.46% 150 152539 0.46% 151 24917894 75.24% 33118642 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=26 prefix-density=0.31 prefix-fanout=2.9 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=199.10 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=13.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=189.90 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=22.1 sequence=CGCCGCCGCCGC SRR12951299 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:04:40 Started mapping on | Dec 07 11:04:40 Finished on | Dec 07 11:07:59 Mapping speed, Million of reads per hour | 599.13 Number of input reads | 33118642 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 31848013 Uniquely mapped reads % | 96.16% Average mapped length | 285.90 Number of splices: Total | 27985922 Number of splices: Annotated (sjdb) | 26067269 Number of splices: GT/AG | 27604636 Number of splices: GC/AG | 313826 Number of splices: AT/AC | 16633 Number of splices: Non-canonical | 50827 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352470 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 43947 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 918159 918159 918159 N_multimapping 352470 352470 352470 N_noFeature 1270342 30987312 1563941 N_ambiguous 664517 3972 97943 UnstrandedReadsAssigned:29913154 PositiveStrandReadsAssigned:856729 NegativeStrandReadsAssigned:30186129 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=139 echo kmer=135 SRR12951299 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951299-trimmed-pair1.fastq SRR12951299-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,118,642 reads, 30,494,112 reads pseudoaligned [quant] estimated average fragment length: 228.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR12951299.ke.tsv 35125 SRR12951299.se.tsv 88098 total ==> SRR12951299.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 708.525 0 0 PNS24247 1044 816.046 210.423 12.4546 PNS24249 1928 1700.05 452.532 12.8571 PNS24246 1044 816.046 210.423 12.4546 PNS24248 1044 816.046 210.423 12.4546 PNS24244 1471 1243.05 253.2 9.83851 PNS24243 293 120.334 0 0 KQK14069 1603 1375.05 31767.9 1115.9 KQK14071 474 267.893 705.913 127.275 ==> SRR12951299.se.tsv <== BRADI_1g14170v3 35393 BRADI_1g53295v3 245 BRADI_1g59795v3 724 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 1462 BRADI_1g74790v3 3315 BRADI_1g09890v3 0 BRADI_1g77505v3 283 BRADI_1g48960v3 0 SRR12951299 completed mapping pipeline successfully