Starting /dee2/code/volunteer_pipeline.sh SRR12951300 current disk space = 1543263731712 free memory = 1605987428 SRR12951300 SRAfilesize 8d33062d64d4c58180390365c0700851 SRR12951300.sra SRR12951300.sra file validated SRR12951300 is paired end SRR12951300 is conventional basespace SRR12951300 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951300_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.614 37.0 37.0 37.0 37.0 37.0 2 36.3925 37.0 37.0 37.0 37.0 37.0 3 36.5095 37.0 37.0 37.0 37.0 37.0 4 36.587 37.0 37.0 37.0 37.0 37.0 5 36.5695 37.0 37.0 37.0 37.0 37.0 6 36.5845 37.0 37.0 37.0 37.0 37.0 7 36.5215 37.0 37.0 37.0 37.0 37.0 8 36.442 37.0 37.0 37.0 37.0 37.0 9 36.5645 37.0 37.0 37.0 37.0 37.0 10-14 36.5811 37.0 37.0 37.0 37.0 37.0 15-19 36.5766 37.0 37.0 37.0 37.0 37.0 20-24 36.4303 37.0 37.0 37.0 37.0 37.0 25-29 36.4745 37.0 37.0 37.0 37.0 37.0 30-34 36.4508 37.0 37.0 37.0 37.0 37.0 35-39 36.4435 37.0 37.0 37.0 37.0 37.0 40-44 36.4307 37.0 37.0 37.0 37.0 37.0 45-49 36.3811 37.0 37.0 37.0 37.0 37.0 50-54 36.3924 37.0 37.0 37.0 37.0 37.0 55-59 36.288700000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.279999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.250099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2389 37.0 37.0 37.0 37.0 37.0 75-79 36.2296 37.0 37.0 37.0 37.0 37.0 80-84 36.2098 37.0 37.0 37.0 37.0 37.0 85-89 36.1991 37.0 37.0 37.0 37.0 37.0 90-94 36.233599999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1942 37.0 37.0 37.0 37.0 37.0 100-104 36.2149 37.0 37.0 37.0 37.0 37.0 105-109 36.260000000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.2336 37.0 37.0 37.0 37.0 37.0 115-119 36.18900000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.112 37.0 37.0 37.0 37.0 37.0 125-129 36.0311 37.0 37.0 37.0 37.0 37.0 130-134 36.0595 37.0 37.0 37.0 37.0 37.0 135-139 35.9952 37.0 37.0 37.0 37.0 37.0 140-144 35.8601 37.0 37.0 37.0 37.0 37.0 145-149 35.8052 37.0 37.0 37.0 37.0 37.0 150-151 35.60925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 6.0 26 6.0 27 11.0 28 14.0 29 23.0 30 19.0 31 31.0 32 46.0 33 64.0 34 132.0 35 292.0 36 2909.0 37 443.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.4 11.575000000000001 5.050000000000001 40.975 2 20.816633266533067 10.846693386773547 36.24749498997996 32.089178356713425 3 20.349999999999998 13.975000000000001 26.85 38.824999999999996 4 25.55 19.375 21.224999999999998 33.85 5 26.724999999999998 25.575 22.55 25.15 6 25.650000000000002 29.049999999999997 21.45 23.849999999999998 7 21.125 24.375 36.65 17.849999999999998 8 21.0 24.125 30.025000000000002 24.85 9 21.175 20.65 30.425 27.750000000000004 10-14 23.095 26.52 24.765 25.619999999999997 15-19 23.244999999999997 24.77 24.64 27.345000000000002 20-24 24.15 24.64 25.385 25.825 25-29 24.11 24.68 24.995 26.215 30-34 23.565 25.215 24.57 26.650000000000002 35-39 23.98 23.990000000000002 26.119999999999997 25.91 40-44 24.29 24.884999999999998 24.92 25.905 45-49 24.21 25.21 25.055 25.525 50-54 24.884999999999998 24.759999999999998 23.71 26.645000000000003 55-59 24.42 25.005 24.445 26.13 60-64 24.88 25.335 24.255 25.53 65-69 24.34 24.755 24.645 26.26 70-74 24.925 24.715 23.990000000000002 26.369999999999997 75-79 24.575 24.985 24.3 26.14 80-84 24.79 24.855 24.175 26.179999999999996 85-89 24.345 24.775 24.445 26.435 90-94 24.474999999999998 24.310000000000002 24.425 26.790000000000003 95-99 24.635 24.765 24.34 26.26 100-104 24.759999999999998 24.565 25.224999999999998 25.45 105-109 25.290000000000003 24.325 24.224999999999998 26.16 110-114 24.795 25.2 23.305 26.700000000000003 115-119 24.705 25.230000000000004 24.32 25.745 120-124 24.565 24.89 24.279999999999998 26.265 125-129 24.765 24.43 24.310000000000002 26.495 130-134 25.105 24.645 23.785 26.465 135-139 25.485000000000003 24.015 24.32 26.179999999999996 140-144 24.365000000000002 24.915000000000003 23.845 26.875 145-149 25.074999999999996 24.58 23.799999999999997 26.545 150-151 24.8625 24.2375 23.599999999999998 27.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 2.0 30 5.0 31 6.5 32 10.0 33 14.0 34 22.0 35 30.5 36 44.5 37 59.0 38 71.5 39 95.5 40 110.0 41 128.0 42 145.0 43 154.0 44 179.5 45 202.5 46 195.0 47 185.5 48 184.0 49 172.5 50 147.5 51 132.0 52 136.0 53 139.5 54 128.0 55 106.0 56 103.0 57 90.0 58 81.5 59 84.5 60 62.5 61 53.0 62 70.0 63 70.0 64 59.0 65 62.5 66 61.0 67 60.0 68 54.0 69 45.0 70 41.0 71 39.5 72 35.5 73 30.0 74 27.5 75 21.5 76 17.0 77 11.5 78 6.0 79 2.0 80 2.5 81 2.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.175 #Duplication Level Percentage of deduplicated Percentage of total 1 84.70093177036368 70.45 2 11.722272317403066 19.5 3 2.6450255485422303 6.6000000000000005 4 0.7514277126540427 2.5 5 0.06011421701232341 0.25 6 0.0 0.0 7 0.12022843402464682 0.7000000000000001 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCAAACTTCCGTCGCCTAAACGGCGATAGTCCCTCTAAGAAGCTAGCT 7 0.17500000000000002 No Hit GTCGCAGATGATCCACGGAAAGCTCCAGAACTGCTTCTTCTCCGGCCGGC 7 0.17500000000000002 No Hit CTCCTTGGCCAGCTCCTCCTCATCCCCTCTGCCTCCGGCGGGGAGCGCCA 7 0.17500000000000002 No Hit GCACGTAGTCGTCAGCGCACATCTCCACGAAGGCCTCCCTGGCGGCGTTG 7 0.17500000000000002 No Hit AGGACTGTAGCATAAGCTGCTGCTGTGGTTGCAAGCTGGAAAATGATGAG 5 0.125 No Hit CCACCGATCAACCCACGTACACGCATATGCACGGAGGAAGTGTTCTTCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 2.0125 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.3125 0.0 0.0 0.0 0.0 108-109 3.5375 0.0 0.0 0.0 0.0 110-111 3.9875 0.0 0.0 0.0 0.0 112-113 4.362500000000001 0.0 0.0 0.0 0.0 114-115 4.775 0.0 0.0 0.0 0.0 116-117 5.25 0.0 0.0 0.0 0.0 118-119 5.85 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.275 0.0 0.0 0.0 0.0 124-125 8.025 0.0 0.0 0.0 0.0 126-127 8.3875 0.0 0.0 0.0 0.0 128-129 8.925 0.0 0.0 0.0 0.0 130-131 9.575 0.0 0.0 0.0 0.0 132-133 10.375 0.0 0.0 0.0 0.0 134-135 11.0375 0.0 0.0 0.0 0.0 136-137 11.7 0.0 0.0 0.0 0.0 138-139 12.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCGGAG 10 0.006830828 145.0 1 TTCTTCG 10 0.006830828 145.0 3 TCTTCGA 10 0.006830828 145.0 4 >>END_MODULE SRR12951300 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951300_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.265 37.0 37.0 37.0 37.0 37.0 2 36.226 37.0 37.0 37.0 37.0 37.0 3 36.2025 37.0 37.0 37.0 37.0 37.0 4 36.205 37.0 37.0 37.0 37.0 37.0 5 36.375 37.0 37.0 37.0 37.0 37.0 6 36.3385 37.0 37.0 37.0 37.0 37.0 7 36.31 37.0 37.0 37.0 37.0 37.0 8 36.2875 37.0 37.0 37.0 37.0 37.0 9 36.3245 37.0 37.0 37.0 37.0 37.0 10-14 36.3107 37.0 37.0 37.0 37.0 37.0 15-19 36.2731 37.0 37.0 37.0 37.0 37.0 20-24 36.2391 37.0 37.0 37.0 37.0 37.0 25-29 36.20269999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.160000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.143899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.134699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1594 37.0 37.0 37.0 37.0 37.0 50-54 36.0616 37.0 37.0 37.0 37.0 37.0 55-59 36.04600000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.029 37.0 37.0 37.0 37.0 37.0 65-69 36.0038 37.0 37.0 37.0 37.0 37.0 70-74 35.935900000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.946299999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.824 37.0 37.0 37.0 37.0 37.0 85-89 35.88440000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.883900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8878 37.0 37.0 37.0 37.0 37.0 100-104 35.7967 37.0 37.0 37.0 37.0 37.0 105-109 35.855399999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7651 37.0 37.0 37.0 37.0 37.0 115-119 35.845800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7421 37.0 37.0 37.0 37.0 37.0 125-129 35.714 37.0 37.0 37.0 37.0 37.0 130-134 35.563900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.532900000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.5246 37.0 37.0 37.0 37.0 37.0 145-149 35.230000000000004 37.0 37.0 37.0 34.6 37.0 150-151 35.0965 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 3.0 16 2.0 17 0.0 18 2.0 19 0.0 20 6.0 21 4.0 22 8.0 23 4.0 24 6.0 25 14.0 26 8.0 27 10.0 28 14.0 29 19.0 30 19.0 31 40.0 32 41.0 33 77.0 34 180.0 35 498.0 36 2687.0 37 352.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 21.2 7.5 32.475 2 28.1 23.7 26.450000000000003 21.75 3 22.55 24.9 27.825 24.725 4 26.224999999999998 31.25 20.3 22.225 5 27.825 29.95 19.55 22.675 6 24.45 33.7 18.85 23.0 7 24.099999999999998 20.25 32.074999999999996 23.575 8 23.35 22.45 23.65 30.55 9 24.5 22.975 27.3 25.224999999999998 10-14 26.41 25.0 22.775000000000002 25.814999999999998 15-19 25.96 24.89 23.09 26.06 20-24 25.735000000000003 25.275 23.345 25.645 25-29 25.840000000000003 24.310000000000002 23.405 26.445 30-34 25.915 24.44 23.655 25.990000000000002 35-39 26.44 24.404999999999998 22.835 26.32 40-44 26.784999999999997 23.885 23.215 26.115 45-49 26.27 24.435000000000002 22.895 26.400000000000002 50-54 25.945 24.310000000000002 24.38 25.365 55-59 27.115000000000002 24.36 23.455000000000002 25.069999999999997 60-64 26.35 24.02 24.23 25.4 65-69 26.215 24.610000000000003 23.455000000000002 25.72 70-74 26.939999999999998 24.535 23.53 24.995 75-79 26.38 24.959999999999997 23.5 25.16 80-84 26.33 24.240000000000002 23.855 25.575 85-89 27.175 24.709999999999997 23.635 24.48 90-94 26.834999999999997 25.240000000000002 23.76 24.165 95-99 27.57 24.990000000000002 23.189999999999998 24.25 100-104 27.12 24.610000000000003 23.215 25.055 105-109 27.74 25.035 23.474999999999998 23.75 110-114 27.815 24.615000000000002 23.54 24.03 115-119 27.825 24.9 23.26 24.015 120-124 27.925 24.834999999999997 24.115000000000002 23.125 125-129 28.17 25.36 22.765 23.705000000000002 130-134 28.499999999999996 24.495 23.285 23.72 135-139 28.42 24.72 23.87 22.99 140-144 28.975 25.069999999999997 22.939999999999998 23.015 145-149 29.14 25.05 23.21 22.6 150-151 30.0 24.825 22.787499999999998 22.3875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 1.0 28 3.0 29 5.0 30 8.0 31 8.0 32 6.0 33 10.0 34 17.0 35 27.0 36 39.5 37 46.0 38 55.0 39 86.0 40 104.0 41 117.0 42 143.0 43 145.0 44 155.5 45 181.0 46 177.0 47 160.0 48 177.5 49 185.0 50 159.5 51 152.0 52 135.5 53 113.5 54 112.5 55 96.0 56 83.0 57 94.0 58 93.5 59 79.5 60 71.5 61 78.5 62 79.5 63 70.5 64 68.5 65 60.5 66 63.5 67 74.0 68 68.5 69 63.0 70 61.5 71 57.0 72 50.0 73 40.0 74 28.5 75 22.0 76 18.5 77 12.0 78 6.5 79 6.5 80 3.5 81 1.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 1.0 91 2.0 92 1.5 93 0.5 94 1.0 95 1.5 96 0.5 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.575 #Duplication Level Percentage of deduplicated Percentage of total 1 85.0732874663476 71.1 2 11.486688603051151 19.2 3 2.572539635058331 6.45 4 0.6880047861202512 2.3 5 0.05982650314089141 0.25 6 0.029913251570445706 0.15 7 0.05982650314089141 0.35000000000000003 8 0.029913251570445706 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTGTCGGGGCGGGTGACGCTGGTGGGGGACGCGGCGGGGTACGTGACG 8 0.2 No Hit GGAAGGACAGGAAGAGGTACTCTGACATGAAGGACCGGATCTTCGACTCG 7 0.17500000000000002 No Hit GTGGCCGCCGACGGCACGCTCAAGTTCGAGGAGAAGGACGGGATCGACTA 7 0.17500000000000002 No Hit AACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTC 6 0.15 No Hit GGCGTCTTCGAGAGCGTGCAGCCGTCCGACACCGACCTCGGCGCCAAGGC 5 0.125 No Hit AGAAGCAAAAGTTGTACATGATCAGCTTTGTTCAATGGTGGAGAGGTCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.7125 0.0 0.0 0.0 0.0 100-101 2.025 0.0 0.0 0.0 0.0 102-103 2.4125 0.0 0.0 0.0 0.0 104-105 2.8375000000000004 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 3.45 0.0 0.0 0.0 0.0 110-111 3.8875 0.0 0.0 0.0 0.0 112-113 4.25 0.0 0.0 0.0 0.0 114-115 4.675 0.0 0.0 0.0 0.0 116-117 5.15 0.0 0.0 0.0 0.0 118-119 5.725 0.0 0.0 0.0 0.0 120-121 6.4 0.0 0.0 0.0 0.0 122-123 7.2 0.0 0.0 0.0 0.0 124-125 8.0 0.0 0.0 0.0 0.0 126-127 8.3625 0.0 0.0 0.0 0.0 128-129 8.85 0.0 0.0 0.0 0.0 130-131 9.4875 0.0 0.0 0.0 0.0 132-133 10.2875 0.0 0.0 0.0 0.0 134-135 10.975 0.0 0.0 0.0 0.0 136-137 11.65 0.0 0.0 0.0 0.0 138-139 12.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGCG 10 0.006830828 145.0 7 ATAGTGT 10 0.006830828 145.0 4 GGGGGGG 30 4.189703E-5 29.000002 140-144 >>END_MODULE Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218635 spots for SRR12951300.sra Written 1218635 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra Read 1218624 spots for SRR12951300.sra Written 1218624 spots for SRR12951300.sra SRR ids: ['SRR12951300.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhlu2fsr SRR12951300.sra spots: 24372491 blocks: [[1, 1218624], [1218625, 2437248], [2437249, 3655872], [3655873, 4874496], [4874497, 6093120], [6093121, 7311744], [7311745, 8530368], [8530369, 9748992], [9748993, 10967616], [10967617, 12186240], [12186241, 13404864], [13404865, 14623488], [14623489, 15842112], [15842113, 17060736], [17060737, 18279360], [18279361, 19497984], [19497985, 20716608], [20716609, 21935232], [21935233, 23153856], [23153857, 24372491]] SRR12951300 file size 8261138 SRR12951300 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951300 SRR12951300_1.fastq SRR12951300_2.fastq Input file: SRR12951300_1.fastq Paired file: SRR12951300_2.fastq trimmed: SRR12951300-trimmed-pair1.fastq, SRR12951300-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:02:19 2024 >> started Sat Dec 7 11:03:02 2024 >> done (42.506s) 24372491 read pairs processed; of these: 221 ( 0.00%) short read pairs filtered out after trimming by size control 26724 ( 0.11%) empty read pairs filtered out after trimming by size control 24345546 (99.89%) read pairs available; of these: 4159784 (17.09%) trimmed read pairs available after processing 20185762 (82.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 22 0.00% 20 10 0.00% 21 26 0.00% 22 19 0.00% 23 21 0.00% 24 36 0.00% 25 35 0.00% 26 54 0.00% 27 47 0.00% 28 50 0.00% 29 58 0.00% 30 61 0.00% 31 71 0.00% 32 73 0.00% 33 79 0.00% 34 63 0.00% 35 75 0.00% 36 81 0.00% 37 86 0.00% 38 88 0.00% 39 96 0.00% 40 102 0.00% 41 97 0.00% 42 122 0.00% 43 98 0.00% 44 104 0.00% 45 144 0.00% 46 152 0.00% 47 142 0.00% 48 183 0.00% 49 200 0.00% 50 258 0.00% 51 235 0.00% 52 285 0.00% 53 338 0.00% 54 346 0.00% 55 407 0.00% 56 403 0.00% 57 495 0.00% 58 571 0.00% 59 697 0.00% 60 747 0.00% 61 973 0.00% 62 1063 0.00% 63 1105 0.00% 64 1334 0.01% 65 1507 0.01% 66 1540 0.01% 67 1781 0.01% 68 2040 0.01% 69 2391 0.01% 70 2733 0.01% 71 3155 0.01% 72 3513 0.01% 73 4148 0.02% 74 4691 0.02% 75 5153 0.02% 76 5658 0.02% 77 6515 0.03% 78 6966 0.03% 79 7594 0.03% 80 8433 0.03% 81 9622 0.04% 82 10813 0.04% 83 11752 0.05% 84 13058 0.05% 85 14269 0.06% 86 15638 0.06% 87 16591 0.07% 88 17950 0.07% 89 18737 0.08% 90 20295 0.08% 91 21871 0.09% 92 23085 0.09% 93 24620 0.10% 94 26732 0.11% 95 28343 0.12% 96 29970 0.12% 97 31969 0.13% 98 33155 0.14% 99 34237 0.14% 100 36114 0.15% 101 37005 0.15% 102 38442 0.16% 103 40593 0.17% 104 42470 0.17% 105 44051 0.18% 106 45952 0.19% 107 47803 0.20% 108 48666 0.20% 109 50552 0.21% 110 51973 0.21% 111 52416 0.22% 112 55287 0.23% 113 56691 0.23% 114 57976 0.24% 115 60415 0.25% 116 62401 0.26% 117 63730 0.26% 118 65181 0.27% 119 66328 0.27% 120 67918 0.28% 121 69016 0.28% 122 70177 0.29% 123 71610 0.29% 124 73020 0.30% 125 74755 0.31% 126 75500 0.31% 127 78025 0.32% 128 78833 0.32% 129 80412 0.33% 130 81531 0.33% 131 81885 0.34% 132 83650 0.34% 133 84886 0.35% 134 85967 0.35% 135 86687 0.36% 136 88593 0.36% 137 88669 0.36% 138 89352 0.37% 139 91165 0.37% 140 92023 0.38% 141 92205 0.38% 142 94111 0.39% 143 94101 0.39% 144 94818 0.39% 145 96995 0.40% 146 96017 0.39% 147 96204 0.40% 148 97919 0.40% 149 98327 0.40% 150 99084 0.41% 151 20185762 82.91% 24345546 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.30 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=138.28 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=19.4 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=1212.93 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=19.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGA SRR12951300 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:03:41 Started mapping on | Dec 07 11:03:41 Finished on | Dec 07 11:06:12 Mapping speed, Million of reads per hour | 580.42 Number of input reads | 24345546 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 23386290 Uniquely mapped reads % | 96.06% Average mapped length | 292.02 Number of splices: Total | 24319877 Number of splices: Annotated (sjdb) | 22783426 Number of splices: GT/AG | 23995812 Number of splices: GC/AG | 274463 Number of splices: AT/AC | 15500 Number of splices: Non-canonical | 34102 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.76 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240307 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 20947 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718949 718949 718949 N_multimapping 240307 240307 240307 N_noFeature 707142 22810071 880212 N_ambiguous 472111 3541 69630 UnstrandedReadsAssigned:22207037 PositiveStrandReadsAssigned:572678 NegativeStrandReadsAssigned:22436448 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951300 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951300-trimmed-pair1.fastq SRR12951300-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,345,546 reads, 22,645,221 reads pseudoaligned [quant] estimated average fragment length: 247.701 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR12951300.ke.tsv 35125 SRR12951300.se.tsv 88098 total ==> SRR12951300.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.742 0 0 PNS24247 1044 797.299 83.6407 6.94161 PNS24249 1928 1681.3 203.137 7.99481 PNS24246 1044 797.299 83.6407 6.94161 PNS24248 1044 797.299 83.6407 6.94161 PNS24244 1471 1224.3 90.9408 4.91513 PNS24243 293 107.827 0 0 KQK14069 1603 1356.3 1358.75 66.2899 KQK14071 474 249.812 11.3425 3.00441 ==> SRR12951300.se.tsv <== BRADI_1g14170v3 1410 BRADI_1g53295v3 64 BRADI_1g59795v3 357 BRADI_1g07683v3 0 BRADI_1g00485v3 95 BRADI_1g20270v3 2925 BRADI_1g74790v3 227 BRADI_1g09890v3 13 BRADI_1g77505v3 359 BRADI_1g48960v3 1 SRR12951300 completed mapping pipeline successfully