Starting /dee2/code/volunteer_pipeline.sh SRR12951301 current disk space = 1543303319552 free memory = 1599885664 SRR12951301 SRAfilesize 93f5bcc10a4d8d12c2f2fea4f43d7508 SRR12951301.sra SRR12951301.sra file validated SRR12951301 is paired end SRR12951301 is conventional basespace SRR12951301 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951301_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.619 37.0 37.0 37.0 37.0 37.0 2 36.2265 37.0 37.0 37.0 37.0 37.0 3 36.4445 37.0 37.0 37.0 37.0 37.0 4 36.574 37.0 37.0 37.0 37.0 37.0 5 36.6385 37.0 37.0 37.0 37.0 37.0 6 36.6765 37.0 37.0 37.0 37.0 37.0 7 36.57 37.0 37.0 37.0 37.0 37.0 8 36.6425 37.0 37.0 37.0 37.0 37.0 9 36.646 37.0 37.0 37.0 37.0 37.0 10-14 36.5984 37.0 37.0 37.0 37.0 37.0 15-19 36.5806 37.0 37.0 37.0 37.0 37.0 20-24 36.5483 37.0 37.0 37.0 37.0 37.0 25-29 36.5788 37.0 37.0 37.0 37.0 37.0 30-34 36.5638 37.0 37.0 37.0 37.0 37.0 35-39 36.5055 37.0 37.0 37.0 37.0 37.0 40-44 36.4557 37.0 37.0 37.0 37.0 37.0 45-49 36.4107 37.0 37.0 37.0 37.0 37.0 50-54 36.4546 37.0 37.0 37.0 37.0 37.0 55-59 36.375299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.392100000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.326100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3144 37.0 37.0 37.0 37.0 37.0 75-79 36.29260000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2999 37.0 37.0 37.0 37.0 37.0 85-89 36.266099999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2855 37.0 37.0 37.0 37.0 37.0 95-99 36.26859999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2567 37.0 37.0 37.0 37.0 37.0 105-109 36.23290000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1434 37.0 37.0 37.0 37.0 37.0 115-119 36.1657 37.0 37.0 37.0 37.0 37.0 120-124 36.1058 37.0 37.0 37.0 37.0 37.0 125-129 36.0484 37.0 37.0 37.0 37.0 37.0 130-134 36.1248 37.0 37.0 37.0 37.0 37.0 135-139 36.0049 37.0 37.0 37.0 37.0 37.0 140-144 35.8989 37.0 37.0 37.0 37.0 37.0 145-149 35.903499999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.7315 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 2.0 25 5.0 26 3.0 27 6.0 28 7.0 29 10.0 30 25.0 31 29.0 32 54.0 33 68.0 34 118.0 35 274.0 36 2909.0 37 485.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.475 10.975 5.35 32.2 2 20.9442491210447 11.426418884982422 33.52586639879458 34.1034655951783 3 18.975 16.725 27.474999999999998 36.825 4 25.825 23.375 22.775000000000002 28.025 5 25.374999999999996 28.849999999999998 22.25 23.525 6 24.025 29.575000000000003 22.975 23.425 7 18.2 23.35 37.75 20.7 8 21.349999999999998 22.6 29.2 26.85 9 20.474999999999998 20.825 32.65 26.05 10-14 24.15 25.945 24.445 25.46 15-19 23.275000000000002 24.62 25.575 26.529999999999998 20-24 24.0 25.064999999999998 25.130000000000003 25.805 25-29 24.175 25.319999999999997 24.765 25.740000000000002 30-34 24.4 24.65 24.375 26.575 35-39 24.55 24.41 24.740000000000002 26.3 40-44 24.4 25.345000000000002 24.165 26.090000000000003 45-49 23.805 24.959999999999997 24.315 26.919999999999998 50-54 24.45 24.505 24.695 26.35 55-59 24.595 24.735 24.39 26.279999999999998 60-64 24.46 24.73 24.435000000000002 26.375 65-69 24.435000000000002 25.195 24.165 26.205000000000002 70-74 24.815 24.325 24.65 26.21 75-79 24.779999999999998 24.62 24.57 26.029999999999998 80-84 24.775 24.185000000000002 24.975 26.064999999999998 85-89 25.15 24.77 24.41 25.669999999999998 90-94 25.145 24.0 24.375 26.479999999999997 95-99 24.529999999999998 25.385 23.835 26.25 100-104 25.319999999999997 24.675 23.845 26.16 105-109 24.965 23.515 24.375 27.145000000000003 110-114 25.035 24.51 24.474999999999998 25.979999999999997 115-119 25.82 24.745 23.815 25.619999999999997 120-124 25.61 24.9 23.36 26.13 125-129 24.745 25.019999999999996 24.135 26.1 130-134 24.995 25.555 23.605 25.845000000000002 135-139 25.580000000000002 24.09 24.01 26.32 140-144 24.795 24.685000000000002 23.97 26.55 145-149 25.624999999999996 24.72 23.285 26.369999999999997 150-151 26.025 24.837500000000002 22.9375 26.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 1.0 27 1.5 28 4.5 29 5.5 30 5.5 31 9.0 32 10.5 33 12.5 34 23.0 35 34.0 36 40.5 37 46.5 38 62.0 39 91.5 40 113.0 41 128.0 42 163.5 43 177.5 44 168.5 45 178.0 46 194.5 47 177.5 48 170.0 49 176.5 50 145.5 51 138.0 52 141.0 53 119.5 54 109.5 55 107.5 56 100.0 57 90.5 58 82.5 59 79.5 60 79.5 61 77.0 62 68.0 63 68.0 64 66.5 65 61.5 66 68.5 67 61.0 68 51.5 69 53.0 70 49.0 71 39.5 72 33.5 73 32.5 74 28.0 75 18.0 76 13.5 77 11.0 78 3.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 82.62073208243618 67.15 2 13.195939710858198 21.45 3 3.014457090126115 7.35 4 0.8920332205475239 2.9000000000000004 5 0.2460781298062135 1.0 6 0.030759766225776686 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGATGCTGATCATGCCAGGCCTGAAATCAAAGTTCTCCTTGACAAGCCT 6 0.15 No Hit GCTGCCCTTCTCCTTGAAAAGCTGGGAGAAATGGTGCTTGCAGTAGAGGA 5 0.125 No Hit CCATGTTACCTCCACTGTTTGCAACAGAATGGGGGAGTTGATCTTGAATA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGAGTGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 37bp) GCCCATCTCGCCCCACGGCAGGTTGGACGGGTTCCGGTCAGAAACCACCT 5 0.125 No Hit AGCTCTAGTTCCTCTTTGTGTGATTGTGCATCAGAGAGAAGCGATCTTGT 5 0.125 No Hit GTACATGGAAACACCTTGCCTAGGTCCATACCCTGGTGCACTTGCTCATC 5 0.125 No Hit CCTTGGGTGGCATCAGGAAGGCGGCCTTCTGGAGGAGGCTCAGGCTTGTC 5 0.125 No Hit GTGATTCAGATTCCTTTGCTTTCGCTGCAGCTTTTATTGCCTCCTTTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.11249999999999999 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.6749999999999998 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.025 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.1625 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 5.975 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 7.0125 0.0 0.0 0.0 0.0 130-131 7.6375 0.0 0.0 0.0 0.0 132-133 8.0125 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.3375 0.0 0.0 0.0 0.0 138-139 9.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTCAA 10 0.006830828 145.0 5 GTACATG 10 0.006830828 145.0 2 >>END_MODULE SRR12951301 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951301_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2415 37.0 37.0 37.0 37.0 37.0 2 36.1935 37.0 37.0 37.0 37.0 37.0 3 36.243 37.0 37.0 37.0 37.0 37.0 4 36.323 37.0 37.0 37.0 37.0 37.0 5 36.25 37.0 37.0 37.0 37.0 37.0 6 36.183 37.0 37.0 37.0 37.0 37.0 7 36.2125 37.0 37.0 37.0 37.0 37.0 8 36.28 37.0 37.0 37.0 37.0 37.0 9 36.2655 37.0 37.0 37.0 37.0 37.0 10-14 36.244299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1876 37.0 37.0 37.0 37.0 37.0 20-24 36.168099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.1596 37.0 37.0 37.0 37.0 37.0 30-34 36.0663 37.0 37.0 37.0 37.0 37.0 35-39 36.0226 37.0 37.0 37.0 37.0 37.0 40-44 35.9833 37.0 37.0 37.0 37.0 37.0 45-49 36.0287 37.0 37.0 37.0 37.0 37.0 50-54 35.9268 37.0 37.0 37.0 37.0 37.0 55-59 35.94840000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.90069999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.931799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8611 37.0 37.0 37.0 37.0 37.0 75-79 35.9012 37.0 37.0 37.0 37.0 37.0 80-84 35.8188 37.0 37.0 37.0 37.0 37.0 85-89 35.821000000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.834 37.0 37.0 37.0 37.0 37.0 95-99 35.7673 37.0 37.0 37.0 37.0 37.0 100-104 35.730399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.68579999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.6419 37.0 37.0 37.0 37.0 37.0 115-119 35.6913 37.0 37.0 37.0 37.0 37.0 120-124 35.6457 37.0 37.0 37.0 37.0 37.0 125-129 35.5129 37.0 37.0 37.0 37.0 37.0 130-134 35.4032 37.0 37.0 37.0 37.0 37.0 135-139 35.3806 37.0 37.0 37.0 37.0 37.0 140-144 35.2784 37.0 37.0 37.0 37.0 37.0 145-149 35.202999999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.810500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 10.0 15 9.0 16 5.0 17 6.0 18 3.0 19 0.0 20 6.0 21 5.0 22 5.0 23 11.0 24 15.0 25 6.0 26 6.0 27 11.0 28 11.0 29 16.0 30 18.0 31 25.0 32 47.0 33 94.0 34 144.0 35 442.0 36 2744.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.05 20.325 6.1 24.525 2 28.625 24.15 23.5 23.724999999999998 3 24.725 24.224999999999998 28.050000000000004 23.0 4 28.575 28.925 18.7 23.799999999999997 5 27.825 33.25 18.525 20.4 6 26.924999999999997 33.75 18.05 21.275 7 23.549999999999997 19.1 32.4 24.95 8 25.7 21.525 22.175 30.599999999999998 9 24.7 23.425 24.975 26.900000000000002 10-14 27.24 25.285000000000004 21.98 25.495 15-19 26.93 24.740000000000002 23.36 24.97 20-24 26.855 24.12 24.14 24.884999999999998 25-29 26.135 25.025 22.830000000000002 26.009999999999998 30-34 26.790000000000003 25.074999999999996 23.43 24.705 35-39 26.565 23.84 23.96 25.635 40-44 26.47 25.105 23.51 24.915000000000003 45-49 26.33 24.95 23.974999999999998 24.745 50-54 26.135 24.575 23.585 25.705 55-59 26.575 24.72 23.44 25.264999999999997 60-64 26.505000000000003 24.67 23.435 25.39 65-69 26.825 24.115000000000002 24.055 25.005 70-74 26.715 24.495 23.685000000000002 25.105 75-79 26.479999999999997 24.58 23.815 25.124999999999996 80-84 26.905 25.25 23.150000000000002 24.695 85-89 27.0 25.035 23.380000000000003 24.585 90-94 26.955000000000002 24.3 23.990000000000002 24.755 95-99 26.919999999999998 24.92 23.3 24.86 100-104 27.584999999999997 24.485 23.635 24.295 105-109 26.575 25.019999999999996 23.785 24.62 110-114 27.02 24.740000000000002 24.375 23.865 115-119 27.725 25.34 22.875 24.060000000000002 120-124 27.950000000000003 24.560000000000002 23.485 24.005000000000003 125-129 27.465 25.455 23.56 23.52 130-134 27.805000000000003 24.875 23.275000000000002 24.044999999999998 135-139 28.68 25.509999999999998 23.015 22.795 140-144 28.884999999999998 25.445 22.705000000000002 22.965 145-149 29.475 25.27 22.605 22.650000000000002 150-151 30.275000000000002 24.1875 23.7375 21.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.5 8 2.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 2.0 19 1.5 20 1.0 21 1.0 22 0.5 23 0.0 24 1.5 25 3.0 26 2.0 27 1.0 28 3.5 29 6.5 30 7.0 31 7.0 32 10.0 33 15.0 34 17.5 35 25.0 36 35.0 37 45.5 38 52.5 39 71.0 40 104.5 41 122.0 42 143.5 43 169.5 44 179.0 45 177.5 46 170.5 47 178.0 48 177.0 49 147.5 50 129.5 51 124.0 52 120.5 53 110.0 54 102.5 55 103.0 56 96.5 57 88.0 58 90.0 59 92.5 60 85.5 61 94.5 62 91.5 63 80.5 64 75.5 65 70.0 66 67.0 67 57.5 68 57.0 69 59.5 70 58.5 71 55.0 72 42.0 73 33.0 74 32.0 75 23.5 76 15.5 77 10.5 78 4.0 79 4.5 80 5.0 81 3.0 82 2.0 83 1.0 84 1.0 85 1.5 86 2.0 87 1.5 88 1.0 89 0.5 90 1.0 91 2.0 92 1.5 93 1.5 94 1.5 95 1.0 96 2.0 97 2.5 98 1.5 99 1.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.01597051597052 67.575 2 12.837837837837837 20.9 3 2.886977886977887 7.049999999999999 4 0.9520884520884522 3.1 5 0.2457002457002457 1.0 6 0.030712530712530713 0.15 7 0.0 0.0 8 0.0 0.0 9 0.030712530712530713 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GGTTGACCGTAGTGGTGCTTACATTGCTAGACAGGCCGCCAAGAGCATCA 6 0.15 No Hit AGTGAATGGTGACCTTGAGATGGAGGATGTAGCCCCATCATCTGAAGCTG 5 0.125 No Hit TATGAAGAAAACTTCAAGAACACTTGAAGGAAAGGATTTTGTTTGAAGAG 5 0.125 No Hit AAGAGAGGGACTTAAAACGTCAGCAGAAGAAGATTGAGAGTTTAGCTTTT 5 0.125 No Hit GTTGAAGAGAAGTCTTACCACAAGTCCTGCTTCAAATGCTCTCACGGAGG 5 0.125 No Hit CCTCGCGTGGCACTCGGCGGGGACCTTCGACGTCGCCACCAAGACCGGCG 5 0.125 No Hit TGCACACATTCAGAATGAACACGCGCAAAGGATTGCTATAGCTGCTAGAC 5 0.125 No Hit GGTTGTTGCTGCCAAATTCACAGATGATGCGTTTTTCAACAATGCATTCT 5 0.125 No Hit CTTCGATCACAGTCTTCTCCAAATTCTTTCCTAATGGGCGCCTCAAAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.11249999999999999 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.95 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.7750000000000004 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.4625 0.0 0.0 0.0 0.0 114-115 3.7750000000000004 0.0 0.0 0.0 0.0 116-117 4.175000000000001 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.1 0.0 0.0 0.0 0.0 122-123 5.449999999999999 0.0 0.0 0.0 0.0 124-125 5.9 0.0 0.0 0.0 0.0 126-127 6.4375 0.0 0.0 0.0 0.0 128-129 7.0 0.0 0.0 0.0 0.0 130-131 7.6375 0.0 0.0 0.0 0.0 132-133 8.0375 0.0 0.0 0.0 0.0 134-135 8.475000000000001 0.0 0.0 0.0 0.0 136-137 9.375 0.0 0.0 0.0 0.0 138-139 9.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAAT 10 0.006830828 145.0 4 >>END_MODULE Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731781 spots for SRR12951301.sra Written 1731781 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra Read 1731779 spots for SRR12951301.sra Written 1731779 spots for SRR12951301.sra SRR ids: ['SRR12951301.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2u85z07k SRR12951301.sra spots: 34635582 blocks: [[1, 1731779], [1731780, 3463558], [3463559, 5195337], [5195338, 6927116], [6927117, 8658895], [8658896, 10390674], [10390675, 12122453], [12122454, 13854232], [13854233, 15586011], [15586012, 17317790], [17317791, 19049569], [19049570, 20781348], [20781349, 22513127], [22513128, 24244906], [24244907, 25976685], [25976686, 27708464], [27708465, 29440243], [29440244, 31172022], [31172023, 32903801], [32903802, 34635582]] SRR12951301 file size 11748985 SRR12951301 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951301 SRR12951301_1.fastq SRR12951301_2.fastq Input file: SRR12951301_1.fastq Paired file: SRR12951301_2.fastq trimmed: SRR12951301-trimmed-pair1.fastq, SRR12951301-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:06:21 2024 >> started Sat Dec 7 11:06:58 2024 >> done (36.545s) 34635582 read pairs processed; of these: 209 ( 0.00%) short read pairs filtered out after trimming by size control 37930 ( 0.11%) empty read pairs filtered out after trimming by size control 34597443 (99.89%) read pairs available; of these: 4591049 (13.27%) trimmed read pairs available after processing 30006394 (86.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 26 0.00% 20 25 0.00% 21 33 0.00% 22 48 0.00% 23 56 0.00% 24 67 0.00% 25 55 0.00% 26 55 0.00% 27 73 0.00% 28 84 0.00% 29 88 0.00% 30 90 0.00% 31 90 0.00% 32 89 0.00% 33 78 0.00% 34 103 0.00% 35 99 0.00% 36 88 0.00% 37 126 0.00% 38 99 0.00% 39 115 0.00% 40 146 0.00% 41 154 0.00% 42 158 0.00% 43 176 0.00% 44 155 0.00% 45 214 0.00% 46 173 0.00% 47 209 0.00% 48 263 0.00% 49 288 0.00% 50 360 0.00% 51 333 0.00% 52 462 0.00% 53 483 0.00% 54 477 0.00% 55 584 0.00% 56 624 0.00% 57 651 0.00% 58 834 0.00% 59 975 0.00% 60 1139 0.00% 61 1310 0.00% 62 1413 0.00% 63 1710 0.00% 64 1812 0.01% 65 1994 0.01% 66 2207 0.01% 67 2514 0.01% 68 2702 0.01% 69 3173 0.01% 70 3612 0.01% 71 4249 0.01% 72 4972 0.01% 73 5532 0.02% 74 6013 0.02% 75 6442 0.02% 76 7132 0.02% 77 7600 0.02% 78 8215 0.02% 79 9191 0.03% 80 9946 0.03% 81 10905 0.03% 82 12518 0.04% 83 13171 0.04% 84 14403 0.04% 85 15376 0.04% 86 16309 0.05% 87 16957 0.05% 88 17596 0.05% 89 18600 0.05% 90 20096 0.06% 91 21586 0.06% 92 23019 0.07% 93 24919 0.07% 94 26934 0.08% 95 27957 0.08% 96 28934 0.08% 97 30092 0.09% 98 30973 0.09% 99 31998 0.09% 100 33401 0.10% 101 35480 0.10% 102 37549 0.11% 103 39973 0.12% 104 41092 0.12% 105 43168 0.12% 106 44406 0.13% 107 45330 0.13% 108 46400 0.13% 109 48074 0.14% 110 48785 0.14% 111 51995 0.15% 112 54517 0.16% 113 56756 0.16% 114 59896 0.17% 115 61596 0.18% 116 63157 0.18% 117 64165 0.19% 118 65325 0.19% 119 66543 0.19% 120 68623 0.20% 121 70826 0.20% 122 73126 0.21% 123 75913 0.22% 124 79153 0.23% 125 81470 0.24% 126 84746 0.24% 127 84411 0.24% 128 85387 0.25% 129 87207 0.25% 130 88095 0.25% 131 89013 0.26% 132 93808 0.27% 133 96406 0.28% 134 98383 0.28% 135 102238 0.30% 136 103013 0.30% 137 103246 0.30% 138 105228 0.30% 139 106731 0.31% 140 107346 0.31% 141 108627 0.31% 142 112990 0.33% 143 113720 0.33% 144 117743 0.34% 145 120864 0.35% 146 123162 0.36% 147 125002 0.36% 148 123383 0.36% 149 123384 0.36% 150 125658 0.36% 151 30006394 86.73% 34597443 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=86.64 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.2 sequence=CAACAACATTCAGACACATATATTAAAACGTACAGCCTTGATCGAGCGAGGCATGAGGAAGGACATGGATCGTGTCGGATGAACAATACGGTCGTGATCGAGTTGGTGACTTGACAGAAGATTTTATTTTATTTAGCAGCTAACTGGCTAGTAAGCTAGCTAGCTGGGCGGCGATGGTGGGTGCATGCTTGCAGTGCAGTTGTCCTAGATCCTGGATCGATCCTCATTCCTCATGGTCGCTGGTGTGTGGCTCTAGTTGCAGGTGC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=23 prefix-density=0.39 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=199.62 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=23.3 sequence=CGCCGCCGCCGTC SRR12951301 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:07:38 Started mapping on | Dec 07 11:07:39 Finished on | Dec 07 11:10:42 Mapping speed, Million of reads per hour | 680.61 Number of input reads | 34597443 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 32239635 Uniquely mapped reads % | 93.19% Average mapped length | 293.88 Number of splices: Total | 32498520 Number of splices: Annotated (sjdb) | 30445631 Number of splices: GT/AG | 32057288 Number of splices: GC/AG | 366863 Number of splices: AT/AC | 19275 Number of splices: Non-canonical | 55094 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335986 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 32905 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.28% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2021822 2021822 2021822 N_multimapping 335986 335986 335986 N_noFeature 1111435 31418770 1376985 N_ambiguous 658274 4735 104919 UnstrandedReadsAssigned:30469926 PositiveStrandReadsAssigned:816130 NegativeStrandReadsAssigned:30757731 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951301 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951301-trimmed-pair1.fastq SRR12951301-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,597,443 reads, 31,300,620 reads pseudoaligned [quant] estimated average fragment length: 250.507 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,312 rounds 52973 SRR12951301.ke.tsv 35125 SRR12951301.se.tsv 88098 total ==> SRR12951301.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.833 0 0 PNS24247 1044 794.493 76.9346 4.59574 PNS24249 1928 1678.49 179.789 5.08356 PNS24246 1044 794.493 76.9346 4.59574 PNS24248 1044 794.493 76.9346 4.59574 PNS24244 1471 1221.49 244.407 9.49613 PNS24243 293 101.985 0 0 KQK14069 1603 1353.49 2102.19 73.7122 KQK14071 474 244.97 37.4459 7.25463 ==> SRR12951301.se.tsv <== BRADI_1g14170v3 2198 BRADI_1g53295v3 56 BRADI_1g59795v3 577 BRADI_1g07683v3 0 BRADI_1g00485v3 91 BRADI_1g20270v3 3796 BRADI_1g74790v3 359 BRADI_1g09890v3 46 BRADI_1g77505v3 518 BRADI_1g48960v3 0 SRR12951301 completed mapping pipeline successfully