Starting /dee2/code/volunteer_pipeline.sh SRR12951304 current disk space = 1543261499392 free memory = 1602179552 SRR12951304 SRAfilesize 967dcd00c5991eb37869add93a445e2a SRR12951304.sra SRR12951304.sra file validated SRR12951304 is paired end SRR12951304 is conventional basespace SRR12951304 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951304_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.502 37.0 37.0 37.0 37.0 37.0 2 36.2805 37.0 37.0 37.0 37.0 37.0 3 36.5665 37.0 37.0 37.0 37.0 37.0 4 36.5405 37.0 37.0 37.0 37.0 37.0 5 36.5585 37.0 37.0 37.0 37.0 37.0 6 36.6225 37.0 37.0 37.0 37.0 37.0 7 36.542 37.0 37.0 37.0 37.0 37.0 8 36.5525 37.0 37.0 37.0 37.0 37.0 9 36.607 37.0 37.0 37.0 37.0 37.0 10-14 36.5718 37.0 37.0 37.0 37.0 37.0 15-19 36.561600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5247 37.0 37.0 37.0 37.0 37.0 25-29 36.483 37.0 37.0 37.0 37.0 37.0 30-34 36.512800000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4351 37.0 37.0 37.0 37.0 37.0 40-44 36.387299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3833 37.0 37.0 37.0 37.0 37.0 50-54 36.408300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3428 37.0 37.0 37.0 37.0 37.0 60-64 36.287400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.286699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2556 37.0 37.0 37.0 37.0 37.0 75-79 36.254000000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.268600000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.1685 37.0 37.0 37.0 37.0 37.0 90-94 36.2395 37.0 37.0 37.0 37.0 37.0 95-99 36.1272 37.0 37.0 37.0 37.0 37.0 100-104 36.1927 37.0 37.0 37.0 37.0 37.0 105-109 36.1094 37.0 37.0 37.0 37.0 37.0 110-114 36.0775 37.0 37.0 37.0 37.0 37.0 115-119 36.1045 37.0 37.0 37.0 37.0 37.0 120-124 36.0645 37.0 37.0 37.0 37.0 37.0 125-129 35.9827 37.0 37.0 37.0 37.0 37.0 130-134 36.0159 37.0 37.0 37.0 37.0 37.0 135-139 35.8893 37.0 37.0 37.0 37.0 37.0 140-144 35.813599999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.854600000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.56575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 2.0 23 1.0 24 4.0 25 2.0 26 6.0 27 15.0 28 10.0 29 15.0 30 24.0 31 38.0 32 39.0 33 63.0 34 134.0 35 318.0 36 2872.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.599999999999994 10.45 6.0 35.949999999999996 2 22.389558232931726 11.470883534136545 32.1285140562249 34.011044176706825 3 21.2 17.150000000000002 25.624999999999996 36.025 4 26.8 22.6 21.175 29.425 5 27.250000000000004 27.950000000000003 21.349999999999998 23.45 6 25.35 29.95 21.675 23.025000000000002 7 18.725 26.25 35.075 19.950000000000003 8 21.425 25.074999999999996 27.675 25.825 9 22.325 20.674999999999997 30.8 26.200000000000003 10-14 24.97 25.115 25.025 24.89 15-19 23.875 24.915000000000003 24.39 26.82 20-24 24.13 25.855 24.325 25.69 25-29 24.875 24.884999999999998 24.895 25.345000000000002 30-34 24.955 24.610000000000003 23.95 26.484999999999996 35-39 24.46 24.709999999999997 24.625 26.205000000000002 40-44 25.040000000000003 24.610000000000003 24.325 26.025 45-49 24.245 24.82 24.11 26.825 50-54 24.32 25.005 24.305 26.369999999999997 55-59 24.73 24.485 24.38 26.405 60-64 24.43 24.91 24.385 26.275 65-69 24.455 24.785 23.855 26.905 70-74 24.935 24.87 24.060000000000002 26.135 75-79 24.38 24.445 24.095 27.08 80-84 24.855 24.12 24.685000000000002 26.340000000000003 85-89 24.654999999999998 24.86 24.240000000000002 26.245 90-94 25.480000000000004 24.955 23.48 26.085 95-99 24.955 23.974999999999998 23.835 27.235 100-104 25.374999999999996 24.705 23.705000000000002 26.215 105-109 25.025 24.72 23.555 26.700000000000003 110-114 25.3 24.3 23.955000000000002 26.445 115-119 25.869999999999997 25.040000000000003 23.32 25.77 120-124 25.765 24.23 23.345 26.66 125-129 25.069999999999997 24.685000000000002 23.369999999999997 26.875 130-134 25.785000000000004 24.555 22.905 26.755000000000003 135-139 25.290000000000003 23.56 24.085 27.065 140-144 25.06 24.125 23.39 27.425 145-149 25.009999999999998 24.154999999999998 22.96 27.875 150-151 25.324999999999996 23.1 23.3125 28.262500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 2.5 29 2.0 30 6.0 31 13.0 32 14.5 33 18.0 34 21.5 35 25.5 36 38.0 37 54.0 38 82.0 39 102.0 40 128.5 41 140.5 42 154.5 43 169.5 44 149.5 45 152.0 46 169.0 47 166.5 48 166.0 49 173.0 50 161.5 51 138.0 52 113.5 53 116.5 54 124.5 55 105.0 56 90.0 57 81.5 58 68.5 59 73.5 60 77.0 61 69.0 62 64.0 63 63.5 64 70.5 65 77.5 66 68.0 67 60.5 68 61.5 69 59.0 70 58.0 71 54.5 72 47.5 73 32.0 74 19.5 75 16.5 76 20.0 77 19.0 78 10.0 79 5.0 80 4.5 81 3.0 82 2.0 83 3.0 84 3.5 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 78.57499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 80.08272351256761 62.925 2 14.603881641743557 22.95 3 3.754374801145403 8.85 4 1.1772192173083043 3.6999999999999997 5 0.3181673560292714 1.25 6 0.03181673560292714 0.15 7 0.03181673560292714 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGATGTATTACTGACGACGACATACAACTGTCGGTTGATCGTCTTGTGAC 7 0.17500000000000002 No Hit GGTGGTTGCCATCGCTGGCGGCGTCGCCGTGGCTGGAGTTATTGCTTCCG 6 0.15 No Hit CTACCGAGGAGGTTCTTAGTCAAGCTTAACTCTTTCACGGGGGCGGCTGC 5 0.125 No Hit ACTTATCATGAGAGGAAATCCGTTGAATAAATCCACAAATGGAAAGCTCT 5 0.125 No Hit CCAAATACTTGAGGCGCCCGCCCGGTTAAGGCTAGCTAGCAGCCCACTCG 5 0.125 No Hit CACCTTGCAAACCTGAGACCTGAGCTAAGAAATCCCAACGCCGTTCCCCC 5 0.125 No Hit CACAACTTCAGGAGATAATGGATTTTCAGTGAATACAACAGCTGCCATTG 5 0.125 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 5 0.125 No Hit CCCAGATCTCCGAGCCCCAGGATGCGCTCGCCGTCGGTGACGACGATGAC 5 0.125 No Hit GTACCTCATTATTCGTATTAGCAAGGTAATGTTCCGAGCTTACAAAAGGA 5 0.125 No Hit GCTCAAGTTGAGTTTCACTTGCAGGTGCACGGGTTGCAGGTGCAGTTGTC 5 0.125 No Hit CAAGAGGAAGTAAAATGTTACACAGTTTGCTGTTTACACCAGTCGATCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.4875 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.5999999999999996 0.0 0.0 0.0 0.0 102-103 2.875 0.0 0.0 0.0 0.0 104-105 3.2 0.0 0.0 0.0 0.0 106-107 3.5250000000000004 0.0 0.0 0.0 0.0 108-109 3.8375 0.0 0.0 0.0 0.0 110-111 4.362500000000001 0.0 0.0 0.0 0.0 112-113 5.125 0.0 0.0 0.0 0.0 114-115 5.5875 0.0 0.0 0.0 0.0 116-117 6.237500000000001 0.0 0.0 0.0 0.0 118-119 6.9125 0.0 0.0 0.0 0.0 120-121 7.5375 0.0 0.0 0.0 0.0 122-123 8.15 0.0 0.0 0.0 0.0 124-125 8.9875 0.0 0.0 0.0 0.0 126-127 9.850000000000001 0.0 0.0 0.0 0.0 128-129 10.55 0.0 0.0 0.0 0.0 130-131 11.2625 0.0 0.0 0.0 0.0 132-133 12.225000000000001 0.0 0.0 0.0 0.0 134-135 13.2 0.0 0.0 0.0 0.0 136-137 13.975000000000001 0.0 0.0 0.0 0.0 138-139 14.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12951304 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951304_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1465 37.0 37.0 37.0 37.0 37.0 2 36.152 37.0 37.0 37.0 37.0 37.0 3 36.1775 37.0 37.0 37.0 37.0 37.0 4 36.1435 37.0 37.0 37.0 37.0 37.0 5 36.2145 37.0 37.0 37.0 37.0 37.0 6 36.258 37.0 37.0 37.0 37.0 37.0 7 36.2165 37.0 37.0 37.0 37.0 37.0 8 36.2765 37.0 37.0 37.0 37.0 37.0 9 36.229 37.0 37.0 37.0 37.0 37.0 10-14 36.2134 37.0 37.0 37.0 37.0 37.0 15-19 36.215700000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.126200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0868 37.0 37.0 37.0 37.0 37.0 30-34 36.0133 37.0 37.0 37.0 37.0 37.0 35-39 36.016000000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.983700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.0694 37.0 37.0 37.0 37.0 37.0 50-54 35.972500000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.932 37.0 37.0 37.0 37.0 37.0 60-64 35.9892 37.0 37.0 37.0 37.0 37.0 65-69 35.933499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.8728 37.0 37.0 37.0 37.0 37.0 75-79 35.88340000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.90259999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8497 37.0 37.0 37.0 37.0 37.0 90-94 35.8545 37.0 37.0 37.0 37.0 37.0 95-99 35.8858 37.0 37.0 37.0 37.0 37.0 100-104 35.7688 37.0 37.0 37.0 37.0 37.0 105-109 35.814499999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.717 37.0 37.0 37.0 37.0 37.0 115-119 35.806200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6627 37.0 37.0 37.0 37.0 37.0 125-129 35.63680000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.483599999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.4137 37.0 37.0 37.0 37.0 37.0 140-144 35.2213 37.0 37.0 37.0 37.0 37.0 145-149 34.9546 37.0 37.0 37.0 25.0 37.0 150-151 34.7345 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 4.0 16 2.0 17 4.0 18 2.0 19 3.0 20 2.0 21 10.0 22 8.0 23 8.0 24 9.0 25 6.0 26 13.0 27 13.0 28 17.0 29 21.0 30 20.0 31 42.0 32 50.0 33 80.0 34 166.0 35 479.0 36 2682.0 37 350.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.9 18.9 9.525 27.675 2 28.4 22.925 23.474999999999998 25.2 3 25.974999999999998 24.275 25.75 24.0 4 27.875 28.775000000000002 18.775 24.575 5 28.000000000000004 31.15 18.325 22.525000000000002 6 25.85 31.525 20.849999999999998 21.775 7 24.05 20.474999999999998 31.225 24.25 8 24.325 20.525 23.375 31.775 9 24.25 22.925 24.95 27.875 10-14 27.595 24.215 21.91 26.279999999999998 15-19 27.16 24.36 23.235 25.245 20-24 27.04 24.97 22.655 25.335 25-29 27.189999999999998 25.355 22.075 25.380000000000003 30-34 26.395000000000003 24.63 23.65 25.324999999999996 35-39 26.91 24.175 22.625 26.290000000000003 40-44 26.400000000000002 24.990000000000002 23.085 25.525 45-49 27.060000000000002 24.709999999999997 22.95 25.28 50-54 27.275 24.505 23.25 24.97 55-59 27.775 24.169999999999998 23.125 24.93 60-64 26.77 24.41 23.34 25.480000000000004 65-69 27.525 24.15 23.44 24.884999999999998 70-74 27.765 23.200000000000003 23.215 25.82 75-79 27.315 24.044999999999998 23.47 25.169999999999998 80-84 27.405 24.755 23.52 24.32 85-89 26.75 24.15 23.77 25.330000000000002 90-94 27.02 24.91 23.830000000000002 24.240000000000002 95-99 27.175 24.98 22.900000000000002 24.945 100-104 27.42 24.59 23.575 24.415 105-109 27.825 24.175 23.52 24.48 110-114 27.575 25.165 23.005 24.255 115-119 28.405 24.735 22.99 23.87 120-124 28.194999999999997 25.455 22.58 23.77 125-129 28.115000000000002 24.755 23.18 23.95 130-134 28.955 24.43 22.895 23.72 135-139 29.299999999999997 24.279999999999998 22.775000000000002 23.645 140-144 29.335 24.455 23.549999999999997 22.66 145-149 29.89 23.669999999999998 22.88 23.56 150-151 29.4125 23.724999999999998 22.6375 24.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 3.0 27 3.0 28 2.0 29 3.0 30 3.5 31 5.0 32 8.5 33 13.0 34 15.5 35 18.5 36 34.0 37 49.0 38 63.0 39 84.0 40 96.5 41 126.5 42 150.5 43 148.5 44 155.5 45 149.5 46 161.5 47 173.0 48 161.5 49 154.5 50 147.0 51 131.5 52 132.5 53 137.5 54 115.0 55 95.5 56 76.5 57 69.5 58 89.0 59 92.5 60 82.0 61 92.5 62 83.0 63 71.0 64 82.5 65 85.5 66 80.0 67 70.5 68 62.5 69 54.5 70 52.5 71 51.5 72 41.0 73 34.5 74 33.0 75 28.5 76 22.0 77 17.5 78 15.5 79 14.0 80 13.0 81 7.0 82 2.0 83 2.5 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 1.0 90 1.0 91 0.0 92 0.5 93 1.5 94 1.0 95 0.5 96 1.0 97 1.0 98 2.5 99 2.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 78.7 #Duplication Level Percentage of deduplicated Percentage of total 1 80.27318932655655 63.175000000000004 2 14.485387547649301 22.8 3 3.8119440914866582 9.0 4 1.0800508259212198 3.4000000000000004 5 0.25412960609911056 1.0 6 0.03176620076238882 0.15 7 0.03176620076238882 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.03176620076238882 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit CAGGCTCATCAGTTGCTCTGTGCCGAACAACCGTGTCTCTGGTGTCCAGA 7 0.17500000000000002 No Hit GCACCACCCTCGAATTCCGCCATGCCGAAGGGGGCCAAGAAGCGTGCCAA 6 0.15 No Hit CTATTTAAAGCCGATTTATTAGAAGAAGGATCCTTTGATGCTGTAGTTGA 5 0.125 No Hit CGAAGATCACGGTGGCGATGATGCTGAACCGGAAGGGGCCGTGGACGGAG 5 0.125 No Hit GCGGCACAGCGGCAGGTAGAATGCAAGAATTGCGGCACGTTCTGCGGCAC 5 0.125 No Hit TGATGGACCTCCAGGAGAGGAACGAGAGGCTCTTCTACAAGCTCCTCATC 5 0.125 No Hit GTTGATCTCAGCGTTGATCTCAGCGCTGCTAGCGCTGCTGAAGAATACTA 5 0.125 No Hit AACCTTAGCACGTTTTCGCCAGTTGATAATTCAGCAAAGACGCGCGCGCG 5 0.125 No Hit ATTAGTTTTGTGCAGATCTGGCATACAGTGAGGAAATCGATACTGATGTG 5 0.125 No Hit GTAATGTACATGGCTGGTGATGTACTTCCTCTTCTTAAAAAAAACTGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.9625 0.0 0.0 0.0 0.0 92-93 1.175 0.0 0.0 0.0 0.0 94-95 1.4875 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.5999999999999996 0.0 0.0 0.0 0.0 102-103 2.8625 0.0 0.0 0.0 0.0 104-105 3.1625 0.0 0.0 0.0 0.0 106-107 3.5 0.0 0.0 0.0 0.0 108-109 3.825 0.0 0.0 0.0 0.0 110-111 4.387499999999999 0.0 0.0 0.0 0.0 112-113 5.137499999999999 0.0 0.0 0.0 0.0 114-115 5.612500000000001 0.0 0.0 0.0 0.0 116-117 6.2875 0.0 0.0 0.0 0.0 118-119 6.975 0.0 0.0 0.0 0.0 120-121 7.6125 0.0 0.0 0.0 0.0 122-123 8.2375 0.0 0.0 0.0 0.0 124-125 9.125 0.0 0.0 0.0 0.0 126-127 9.9875 0.0 0.0 0.0 0.0 128-129 10.675 0.0 0.0 0.0 0.0 130-131 11.412500000000001 0.0 0.0 0.0 0.0 132-133 12.399999999999999 0.0 0.0 0.0 0.0 134-135 13.3875 0.0 0.0 0.0 0.0 136-137 14.149999999999999 0.0 0.0 0.0 0.0 138-139 14.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGTG 10 0.006830828 145.0 9 TCCTTGT 10 0.006830828 145.0 145 GGGTCGT 10 0.006830828 145.0 1 CTGAAGC 10 0.006830828 145.0 2 AAGTGCA 10 0.006830828 145.0 8 >>END_MODULE Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690714 spots for SRR12951304.sra Written 1690714 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra Read 1690706 spots for SRR12951304.sra Written 1690706 spots for SRR12951304.sra SRR ids: ['SRR12951304.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gjkol_le SRR12951304.sra spots: 33814128 blocks: [[1, 1690706], [1690707, 3381412], [3381413, 5072118], [5072119, 6762824], [6762825, 8453530], [8453531, 10144236], [10144237, 11834942], [11834943, 13525648], [13525649, 15216354], [15216355, 16907060], [16907061, 18597766], [18597767, 20288472], [20288473, 21979178], [21979179, 23669884], [23669885, 25360590], [25360591, 27051296], [27051297, 28742002], [28742003, 30432708], [30432709, 32123414], [32123415, 33814128]] SRR12951304 file size 11469819 SRR12951304 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951304 SRR12951304_1.fastq SRR12951304_2.fastq Input file: SRR12951304_1.fastq Paired file: SRR12951304_2.fastq trimmed: SRR12951304-trimmed-pair1.fastq, SRR12951304-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:11:16 2024 >> started Sat Dec 7 11:11:59 2024 >> done (42.843s) 33814128 read pairs processed; of these: 213 ( 0.00%) short read pairs filtered out after trimming by size control 81811 ( 0.24%) empty read pairs filtered out after trimming by size control 33732104 (99.76%) read pairs available; of these: 6146024 (18.22%) trimmed read pairs available after processing 27586080 (81.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 17 0.00% 20 19 0.00% 21 27 0.00% 22 25 0.00% 23 40 0.00% 24 40 0.00% 25 62 0.00% 26 48 0.00% 27 54 0.00% 28 80 0.00% 29 55 0.00% 30 86 0.00% 31 93 0.00% 32 65 0.00% 33 76 0.00% 34 79 0.00% 35 83 0.00% 36 107 0.00% 37 117 0.00% 38 116 0.00% 39 129 0.00% 40 135 0.00% 41 152 0.00% 42 177 0.00% 43 157 0.00% 44 178 0.00% 45 219 0.00% 46 189 0.00% 47 244 0.00% 48 289 0.00% 49 341 0.00% 50 403 0.00% 51 450 0.00% 52 477 0.00% 53 518 0.00% 54 609 0.00% 55 558 0.00% 56 727 0.00% 57 834 0.00% 58 890 0.00% 59 1059 0.00% 60 1224 0.00% 61 1453 0.00% 62 1711 0.01% 63 1794 0.01% 64 2041 0.01% 65 2112 0.01% 66 2388 0.01% 67 2709 0.01% 68 3040 0.01% 69 3519 0.01% 70 4186 0.01% 71 4853 0.01% 72 5540 0.02% 73 6316 0.02% 74 6920 0.02% 75 7550 0.02% 76 8465 0.03% 77 9395 0.03% 78 9878 0.03% 79 11139 0.03% 80 12422 0.04% 81 14119 0.04% 82 16090 0.05% 83 18226 0.05% 84 19888 0.06% 85 22210 0.07% 86 23004 0.07% 87 24948 0.07% 88 26241 0.08% 89 27711 0.08% 90 29859 0.09% 91 32932 0.10% 92 35861 0.11% 93 39255 0.12% 94 41914 0.12% 95 44004 0.13% 96 46297 0.14% 97 48094 0.14% 98 49488 0.15% 99 51599 0.15% 100 53583 0.16% 101 55768 0.17% 102 59617 0.18% 103 62877 0.19% 104 66285 0.20% 105 68844 0.20% 106 71251 0.21% 107 72791 0.22% 108 73576 0.22% 109 75990 0.23% 110 76377 0.23% 111 79598 0.24% 112 83298 0.25% 113 86005 0.25% 114 89509 0.27% 115 93062 0.28% 116 93708 0.28% 117 96017 0.28% 118 96869 0.29% 119 98003 0.29% 120 99228 0.29% 121 101781 0.30% 122 103383 0.31% 123 106721 0.32% 124 111883 0.33% 125 111839 0.33% 126 114648 0.34% 127 115443 0.34% 128 115755 0.34% 129 117854 0.35% 130 118258 0.35% 131 118409 0.35% 132 120459 0.36% 133 123577 0.37% 134 124729 0.37% 135 127437 0.38% 136 131019 0.39% 137 130247 0.39% 138 131094 0.39% 139 131382 0.39% 140 130465 0.39% 141 132216 0.39% 142 133704 0.40% 143 133213 0.39% 144 138012 0.41% 145 140677 0.42% 146 140197 0.42% 147 140885 0.42% 148 140212 0.42% 149 138558 0.41% 150 139271 0.41% 151 27586080 81.78% 33732104 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.9 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=868.59 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=25.6 sequence=CGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGGATTGATCTGTGTGTTTTGATCGGATGGCTGGTGGCGCTCCGGCTCTCTGCTGCTGCTCCAACGTGGGTTGCTG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=35 prefix-density=0.58 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=265.98 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=26.8 sequence=GCGGCGGCGGCG SRR12951304 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:12:45 Started mapping on | Dec 07 11:12:45 Finished on | Dec 07 11:15:45 Mapping speed, Million of reads per hour | 674.64 Number of input reads | 33732104 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 30966504 Uniquely mapped reads % | 91.80% Average mapped length | 291.11 Number of splices: Total | 26491242 Number of splices: Annotated (sjdb) | 24556708 Number of splices: GT/AG | 26128594 Number of splices: GC/AG | 312084 Number of splices: AT/AC | 17889 Number of splices: Non-canonical | 32675 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.52 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271565 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 178145 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 2.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2494035 2494035 2494035 N_multimapping 271565 271565 271565 N_noFeature 1263373 30066706 1562621 N_ambiguous 688258 4262 87967 UnstrandedReadsAssigned:29014873 PositiveStrandReadsAssigned:895536 NegativeStrandReadsAssigned:29315916 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951304 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951304-trimmed-pair1.fastq SRR12951304-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,732,104 reads, 29,884,411 reads pseudoaligned [quant] estimated average fragment length: 236.382 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR12951304.ke.tsv 35125 SRR12951304.se.tsv 88098 total ==> SRR12951304.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 701.102 0 0 PNS24247 1044 808.618 167.437 9.97374 PNS24249 1928 1692.62 479.293 13.6393 PNS24246 1044 808.618 167.437 9.97374 PNS24248 1044 808.618 167.437 9.97374 PNS24244 1471 1235.62 271.396 10.5796 PNS24243 293 109.133 2 0.882722 KQK14069 1603 1367.62 55647 1959.87 KQK14071 474 255.32 111.627 21.0589 ==> SRR12951304.se.tsv <== BRADI_1g14170v3 55244 BRADI_1g53295v3 293 BRADI_1g59795v3 416 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 1077 BRADI_1g74790v3 2819 BRADI_1g09890v3 0 BRADI_1g77505v3 274 BRADI_1g48960v3 0 SRR12951304 completed mapping pipeline successfully