Starting /dee2/code/volunteer_pipeline.sh SRR12951306 current disk space = 1543118745600 free memory = 1606226636 SRR12951306 SRAfilesize b701e6ddc0d1e15fbac25030fbe777e5 SRR12951306.sra SRR12951306.sra file validated SRR12951306 is paired end SRR12951306 is conventional basespace SRR12951306 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951306_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.536 37.0 37.0 37.0 37.0 37.0 2 36.12 37.0 37.0 37.0 37.0 37.0 3 36.4305 37.0 37.0 37.0 37.0 37.0 4 36.5995 37.0 37.0 37.0 37.0 37.0 5 36.6005 37.0 37.0 37.0 37.0 37.0 6 36.6215 37.0 37.0 37.0 37.0 37.0 7 36.479 37.0 37.0 37.0 37.0 37.0 8 36.537 37.0 37.0 37.0 37.0 37.0 9 36.594 37.0 37.0 37.0 37.0 37.0 10-14 36.5863 37.0 37.0 37.0 37.0 37.0 15-19 36.583 37.0 37.0 37.0 37.0 37.0 20-24 36.519000000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4955 37.0 37.0 37.0 37.0 37.0 30-34 36.5066 37.0 37.0 37.0 37.0 37.0 35-39 36.46909999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4108 37.0 37.0 37.0 37.0 37.0 45-49 36.3742 37.0 37.0 37.0 37.0 37.0 50-54 36.3755 37.0 37.0 37.0 37.0 37.0 55-59 36.395199999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3069 37.0 37.0 37.0 37.0 37.0 65-69 36.3101 37.0 37.0 37.0 37.0 37.0 70-74 36.2582 37.0 37.0 37.0 37.0 37.0 75-79 36.3115 37.0 37.0 37.0 37.0 37.0 80-84 36.2701 37.0 37.0 37.0 37.0 37.0 85-89 36.2562 37.0 37.0 37.0 37.0 37.0 90-94 36.29129999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2495 37.0 37.0 37.0 37.0 37.0 100-104 36.2346 37.0 37.0 37.0 37.0 37.0 105-109 36.2836 37.0 37.0 37.0 37.0 37.0 110-114 36.206399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1975 37.0 37.0 37.0 37.0 37.0 120-124 36.1216 37.0 37.0 37.0 37.0 37.0 125-129 36.0987 37.0 37.0 37.0 37.0 37.0 130-134 36.1228 37.0 37.0 37.0 37.0 37.0 135-139 36.0399 37.0 37.0 37.0 37.0 37.0 140-144 35.9896 37.0 37.0 37.0 37.0 37.0 145-149 35.9248 37.0 37.0 37.0 37.0 37.0 150-151 35.756 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 3.0 25 5.0 26 5.0 27 4.0 28 12.0 29 13.0 30 25.0 31 42.0 32 51.0 33 66.0 34 115.0 35 245.0 36 2924.0 37 487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.5 11.125 3.975 34.4 2 21.565173628585807 11.675893306492199 33.81982888777051 32.939104177151485 3 19.7 17.150000000000002 26.174999999999997 36.975 4 25.324999999999996 23.125 21.725 29.825000000000003 5 26.55 27.900000000000002 22.825 22.725 6 24.175 32.324999999999996 20.4 23.1 7 19.2 25.374999999999996 37.675 17.75 8 20.95 23.05 30.4 25.6 9 19.425 21.875 32.175 26.525 10-14 23.880000000000003 26.27 24.66 25.19 15-19 23.465 25.035 25.040000000000003 26.46 20-24 24.135 25.635 24.36 25.869999999999997 25-29 24.075 24.935 24.715 26.275 30-34 24.224999999999998 24.985 24.625 26.165 35-39 24.215 25.545 24.175 26.064999999999998 40-44 23.369999999999997 25.290000000000003 24.615000000000002 26.724999999999998 45-49 23.685000000000002 25.355 25.069999999999997 25.89 50-54 24.39 25.19 24.42 26.0 55-59 23.82 25.44 24.895 25.845000000000002 60-64 23.355 24.745 25.380000000000003 26.52 65-69 24.485 25.085 24.265 26.165 70-74 24.515 24.445 24.675 26.365 75-79 24.37 25.365 25.21 25.055 80-84 24.615000000000002 25.555 24.445 25.385 85-89 25.074999999999996 24.63 24.585 25.71 90-94 25.069999999999997 24.59 24.845 25.495 95-99 25.46 25.47 23.705000000000002 25.365 100-104 25.0 24.215 24.735 26.05 105-109 24.77 25.205 24.075 25.95 110-114 25.290000000000003 24.3 24.355 26.055 115-119 24.740000000000002 25.3 23.76 26.200000000000003 120-124 24.224999999999998 24.83 24.224999999999998 26.72 125-129 24.834999999999997 24.62 23.69 26.855 130-134 24.55 25.505 23.375 26.57 135-139 24.395 25.64 23.39 26.575 140-144 24.805 25.224999999999998 23.265 26.705000000000002 145-149 24.195 25.305 23.98 26.52 150-151 23.7375 25.4625 24.075 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.5 29 4.5 30 5.0 31 7.5 32 12.5 33 16.5 34 25.5 35 33.0 36 46.0 37 68.0 38 91.0 39 106.0 40 116.0 41 132.0 42 135.5 43 163.5 44 192.0 45 182.0 46 176.0 47 187.0 48 182.5 49 151.5 50 162.0 51 156.0 52 134.5 53 133.0 54 116.0 55 102.0 56 89.5 57 82.0 58 70.0 59 69.0 60 71.0 61 61.0 62 67.0 63 75.5 64 85.5 65 76.5 66 53.5 67 56.0 68 59.5 69 57.0 70 50.0 71 33.0 72 20.5 73 21.5 74 16.5 75 11.0 76 13.5 77 9.0 78 2.0 79 2.0 80 2.5 81 1.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.65 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.31723315444246 70.7 2 12.82051282051282 21.5 3 2.265951103160406 5.7 4 0.4770423375074538 1.6 5 0.11926058437686345 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTTGTTACTACTCCAAAGGTCCTGTCACCTGAAGGATCAACCTCCTTA 5 0.125 No Hit CTTCTTCAAGGATGTGATGGGATCCCTTGCAGCGTAATGAGATTTCTCAT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAATCGACATCTCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) TCCATTTCTTTCAAGCAGTTTTCATGAATCGTGTGACCGCACGGCAAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.47500000000000003 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.6124999999999998 0.0 0.0 0.0 0.0 96-97 1.9875 0.0 0.0 0.0 0.0 98-99 2.225 0.0 0.0 0.0 0.0 100-101 2.4124999999999996 0.0 0.0 0.0 0.0 102-103 2.7375 0.0 0.0 0.0 0.0 104-105 3.2 0.0 0.0 0.0 0.0 106-107 3.5999999999999996 0.0 0.0 0.0 0.0 108-109 4.025 0.0 0.0 0.0 0.0 110-111 4.55 0.0 0.0 0.0 0.0 112-113 4.9625 0.0 0.0 0.0 0.0 114-115 5.4125 0.0 0.0 0.0 0.0 116-117 5.6625 0.0 0.0 0.0 0.0 118-119 6.050000000000001 0.0 0.0 0.0 0.0 120-121 6.5375 0.0 0.0 0.0 0.0 122-123 7.225 0.0 0.0 0.0 0.0 124-125 8.087499999999999 0.0 0.0 0.0 0.0 126-127 8.8625 0.0 0.0 0.0 0.0 128-129 9.55 0.0 0.0 0.0 0.0 130-131 10.0625 0.0 0.0 0.0 0.0 132-133 10.75 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.275 0.0 0.0 0.0 0.0 138-139 13.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTGC 10 0.006830828 145.0 7 AACAATG 10 0.006830828 145.0 7 CCTCAGG 10 0.006830828 145.0 2 >>END_MODULE SRR12951306 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951306_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.192 37.0 37.0 37.0 37.0 37.0 2 36.0335 37.0 37.0 37.0 37.0 37.0 3 36.043 37.0 37.0 37.0 37.0 37.0 4 36.078 37.0 37.0 37.0 37.0 37.0 5 36.081 37.0 37.0 37.0 37.0 37.0 6 36.0405 37.0 37.0 37.0 37.0 37.0 7 36.1105 37.0 37.0 37.0 37.0 37.0 8 36.1215 37.0 37.0 37.0 37.0 37.0 9 35.9895 37.0 37.0 37.0 37.0 37.0 10-14 36.0464 37.0 37.0 37.0 37.0 37.0 15-19 36.034000000000006 37.0 37.0 37.0 37.0 37.0 20-24 35.9615 37.0 37.0 37.0 37.0 37.0 25-29 35.9657 37.0 37.0 37.0 37.0 37.0 30-34 35.8867 37.0 37.0 37.0 37.0 37.0 35-39 35.934900000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.9482 37.0 37.0 37.0 37.0 37.0 45-49 35.920100000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.8471 37.0 37.0 37.0 37.0 37.0 55-59 35.826299999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.8368 37.0 37.0 37.0 37.0 37.0 65-69 35.890100000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.7704 37.0 37.0 37.0 37.0 37.0 75-79 35.8072 37.0 37.0 37.0 37.0 37.0 80-84 35.74380000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.73720000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.743100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.6924 37.0 37.0 37.0 37.0 37.0 100-104 35.616200000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.6306 37.0 37.0 37.0 37.0 37.0 110-114 35.6573 37.0 37.0 37.0 37.0 37.0 115-119 35.5993 37.0 37.0 37.0 37.0 37.0 120-124 35.59140000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.4897 37.0 37.0 37.0 37.0 37.0 130-134 35.3584 37.0 37.0 37.0 34.6 37.0 135-139 35.3281 37.0 37.0 37.0 37.0 37.0 140-144 35.1698 37.0 37.0 37.0 34.6 37.0 145-149 34.9767 37.0 37.0 37.0 27.4 37.0 150-151 34.69375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 10.0 14 5.0 15 4.0 16 5.0 17 2.0 18 2.0 19 6.0 20 11.0 21 11.0 22 9.0 23 17.0 24 13.0 25 9.0 26 15.0 27 9.0 28 14.0 29 20.0 30 25.0 31 29.0 32 42.0 33 90.0 34 164.0 35 437.0 36 2690.0 37 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.275 22.6 6.175 24.95 2 30.925000000000004 22.25 27.075 19.75 3 23.0 24.275 29.75 22.975 4 28.225 31.35 19.825 20.599999999999998 5 27.400000000000002 32.95 19.1 20.549999999999997 6 25.275 33.625 18.475 22.625 7 26.724999999999998 19.475 29.9 23.9 8 24.75 23.05 24.099999999999998 28.1 9 24.224999999999998 23.275000000000002 25.650000000000002 26.85 10-14 27.134999999999998 25.135 23.035 24.695 15-19 26.165 24.315 23.97 25.55 20-24 26.645000000000003 25.09 23.330000000000002 24.935 25-29 25.685000000000002 25.705 23.425 25.185000000000002 30-34 26.69 24.915000000000003 23.435 24.959999999999997 35-39 26.795 25.205 23.055 24.945 40-44 26.724999999999998 24.915000000000003 23.43 24.93 45-49 25.865 25.480000000000004 23.285 25.369999999999997 50-54 26.43 25.230000000000004 23.57 24.77 55-59 26.365 25.365 23.294999999999998 24.975 60-64 25.605 25.495 24.240000000000002 24.66 65-69 26.965 24.795 23.41 24.83 70-74 26.375 25.28 23.86 24.485 75-79 26.884999999999998 25.05 23.995 24.07 80-84 27.22 25.290000000000003 23.549999999999997 23.94 85-89 27.105 24.79 23.405 24.7 90-94 26.540000000000003 25.115 23.82 24.525 95-99 26.845000000000002 25.485000000000003 23.494999999999997 24.175 100-104 26.950000000000003 26.11 23.23 23.71 105-109 26.85 25.119999999999997 23.62 24.41 110-114 27.41 25.005 23.685000000000002 23.9 115-119 27.58 25.31 23.445 23.665 120-124 27.474999999999998 25.44 23.705000000000002 23.380000000000003 125-129 27.224999999999998 25.814999999999998 23.355 23.605 130-134 28.26 25.95 22.715 23.075000000000003 135-139 28.235 25.974999999999998 22.835 22.955000000000002 140-144 29.715000000000003 24.955 22.945 22.384999999999998 145-149 29.549999999999997 25.575 22.564999999999998 22.31 150-151 30.6875 24.337500000000002 22.1875 22.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.5 6 2.5 7 2.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 2.5 14 2.5 15 1.5 16 2.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 1.0 23 2.0 24 4.5 25 4.0 26 1.5 27 2.0 28 3.5 29 5.0 30 4.0 31 7.0 32 12.0 33 15.0 34 21.0 35 34.5 36 35.5 37 44.0 38 63.5 39 78.5 40 98.0 41 123.0 42 150.5 43 165.0 44 172.0 45 199.0 46 197.0 47 174.0 48 158.0 49 149.5 50 149.0 51 137.5 52 129.0 53 120.5 54 104.5 55 88.5 56 88.5 57 89.0 58 81.0 59 74.5 60 72.5 61 77.0 62 78.0 63 78.5 64 75.0 65 68.0 66 77.0 67 75.5 68 66.5 69 59.5 70 39.5 71 31.5 72 37.0 73 29.5 74 23.5 75 20.0 76 17.0 77 13.5 78 8.0 79 6.0 80 5.0 81 2.0 82 0.5 83 0.0 84 0.0 85 1.5 86 2.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 1.0 96 1.5 97 0.5 98 1.5 99 3.0 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.025 #Duplication Level Percentage of deduplicated Percentage of total 1 84.73668551026479 71.2 2 12.555786968164236 21.099999999999998 3 2.1719726271942874 5.475 4 0.41654269562630164 1.4000000000000001 5 0.05950609937518596 0.25 6 0.02975304968759298 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02975304968759298 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 6 0.15 No Hit ATTCCTGTTGCCACTGGTGCTGCCTTTGCTGCTAAGTACCGCCATGAGGT 5 0.125 No Hit CAGGGAGAATTTTTTTCACTGCTCAAAATGTGGATGCTGTTATTCTACAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.7124999999999999 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 0.9625 0.0 0.0 0.0 0.0 90-91 1.1124999999999998 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.6375000000000002 0.0 0.0 0.0 0.0 96-97 1.9875 0.0 0.0 0.0 0.0 98-99 2.225 0.0 0.0 0.0 0.0 100-101 2.4124999999999996 0.0 0.0 0.0 0.0 102-103 2.7375 0.0 0.0 0.0 0.0 104-105 3.2125 0.0 0.0 0.0 0.0 106-107 3.625 0.0 0.0 0.0 0.0 108-109 4.05 0.0 0.0 0.0 0.0 110-111 4.575 0.0 0.0 0.0 0.0 112-113 4.9625 0.0 0.0 0.0 0.0 114-115 5.4125 0.0 0.0 0.0 0.0 116-117 5.6625 0.0 0.0 0.0 0.0 118-119 6.050000000000001 0.0 0.0 0.0 0.0 120-121 6.5375 0.0 0.0 0.0 0.0 122-123 7.225 0.0 0.0 0.0 0.0 124-125 8.1125 0.0 0.0 0.0 0.0 126-127 8.8875 0.0 0.0 0.0 0.0 128-129 9.625 0.0 0.0 0.0 0.0 130-131 10.15 0.0 0.0 0.0 0.0 132-133 10.825 0.0 0.0 0.0 0.0 134-135 11.4625 0.0 0.0 0.0 0.0 136-137 12.35 0.0 0.0 0.0 0.0 138-139 13.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCGCA 10 0.006830828 145.0 6 >>END_MODULE Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637172 spots for SRR12951306.sra Written 1637172 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra Read 1637162 spots for SRR12951306.sra Written 1637162 spots for SRR12951306.sra SRR ids: ['SRR12951306.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ljrwrx50 SRR12951306.sra spots: 32743250 blocks: [[1, 1637162], [1637163, 3274324], [3274325, 4911486], [4911487, 6548648], [6548649, 8185810], [8185811, 9822972], [9822973, 11460134], [11460135, 13097296], [13097297, 14734458], [14734459, 16371620], [16371621, 18008782], [18008783, 19645944], [19645945, 21283106], [21283107, 22920268], [22920269, 24557430], [24557431, 26194592], [26194593, 27831754], [27831755, 29468916], [29468917, 31106078], [31106079, 32743250]] SRR12951306 file size 11105888 SRR12951306 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951306 SRR12951306_1.fastq SRR12951306_2.fastq Input file: SRR12951306_1.fastq Paired file: SRR12951306_2.fastq trimmed: SRR12951306-trimmed-pair1.fastq, SRR12951306-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:18:18 2024 >> started Sat Dec 7 11:18:52 2024 >> done (34.304s) 32743250 read pairs processed; of these: 254 ( 0.00%) short read pairs filtered out after trimming by size control 46106 ( 0.14%) empty read pairs filtered out after trimming by size control 32696890 (99.86%) read pairs available; of these: 5130416 (15.69%) trimmed read pairs available after processing 27566474 (84.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 13 0.00% 20 24 0.00% 21 26 0.00% 22 36 0.00% 23 53 0.00% 24 48 0.00% 25 82 0.00% 26 74 0.00% 27 78 0.00% 28 106 0.00% 29 93 0.00% 30 92 0.00% 31 96 0.00% 32 118 0.00% 33 87 0.00% 34 118 0.00% 35 111 0.00% 36 85 0.00% 37 110 0.00% 38 141 0.00% 39 119 0.00% 40 156 0.00% 41 138 0.00% 42 165 0.00% 43 167 0.00% 44 156 0.00% 45 184 0.00% 46 181 0.00% 47 233 0.00% 48 269 0.00% 49 285 0.00% 50 338 0.00% 51 370 0.00% 52 378 0.00% 53 379 0.00% 54 444 0.00% 55 568 0.00% 56 567 0.00% 57 663 0.00% 58 777 0.00% 59 915 0.00% 60 1068 0.00% 61 1153 0.00% 62 1292 0.00% 63 1521 0.00% 64 1657 0.01% 65 1850 0.01% 66 2010 0.01% 67 2211 0.01% 68 2521 0.01% 69 3013 0.01% 70 3459 0.01% 71 3920 0.01% 72 4601 0.01% 73 5111 0.02% 74 5702 0.02% 75 6336 0.02% 76 6933 0.02% 77 7403 0.02% 78 8337 0.03% 79 9292 0.03% 80 10491 0.03% 81 11781 0.04% 82 13477 0.04% 83 14590 0.04% 84 16096 0.05% 85 17151 0.05% 86 18471 0.06% 87 19530 0.06% 88 21054 0.06% 89 22300 0.07% 90 24310 0.07% 91 26475 0.08% 92 28348 0.09% 93 30865 0.09% 94 33118 0.10% 95 34364 0.11% 96 36250 0.11% 97 37387 0.11% 98 39080 0.12% 99 40794 0.12% 100 42879 0.13% 101 44666 0.14% 102 47424 0.15% 103 49675 0.15% 104 51468 0.16% 105 54606 0.17% 106 55994 0.17% 107 57465 0.18% 108 59169 0.18% 109 60033 0.18% 110 62829 0.19% 111 64930 0.20% 112 67469 0.21% 113 70298 0.21% 114 73348 0.22% 115 74779 0.23% 116 77254 0.24% 117 78341 0.24% 118 80402 0.25% 119 80713 0.25% 120 81528 0.25% 121 83818 0.26% 122 85671 0.26% 123 89114 0.27% 124 92146 0.28% 125 93813 0.29% 126 94732 0.29% 127 96322 0.29% 128 96877 0.30% 129 99698 0.30% 130 99335 0.30% 131 100853 0.31% 132 103171 0.32% 133 104859 0.32% 134 107506 0.33% 135 109096 0.33% 136 110613 0.34% 137 111315 0.34% 138 112531 0.34% 139 113596 0.35% 140 111942 0.34% 141 114016 0.35% 142 116543 0.36% 143 115802 0.35% 144 118682 0.36% 145 120001 0.37% 146 120789 0.37% 147 121486 0.37% 148 122447 0.37% 149 121375 0.37% 150 122611 0.37% 151 27566474 84.31% 32696890 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=16.76 fanout-score-rank=17 prefix-density=0.14 prefix-fanout=16.8 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAATCGACATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=1208.56 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=31.4 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGGGTGTGGGAGATGAAGAGCACCTCGTAAATCACCCCAGCAAGGCCACCGCC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=35 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=945.44 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=20.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR12951306 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:19:34 Started mapping on | Dec 07 11:19:34 Finished on | Dec 07 11:23:09 Mapping speed, Million of reads per hour | 547.48 Number of input reads | 32696890 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 30712479 Uniquely mapped reads % | 93.93% Average mapped length | 292.37 Number of splices: Total | 29438272 Number of splices: Annotated (sjdb) | 27477056 Number of splices: GT/AG | 29021857 Number of splices: GC/AG | 348348 Number of splices: AT/AC | 19297 Number of splices: Non-canonical | 48770 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354086 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 32457 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.44% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1630325 1630325 1630325 N_multimapping 354086 354086 354086 N_noFeature 1208065 29914781 1456438 N_ambiguous 650707 3999 102055 UnstrandedReadsAssigned:28853707 PositiveStrandReadsAssigned:793699 NegativeStrandReadsAssigned:29153986 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951306 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951306-trimmed-pair1.fastq SRR12951306-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,696,890 reads, 29,781,381 reads pseudoaligned [quant] estimated average fragment length: 254.694 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,256 rounds 52973 SRR12951306.ke.tsv 35125 SRR12951306.se.tsv 88098 total ==> SRR12951306.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.934 0 0 PNS24247 1044 790.306 161.455 10.0757 PNS24249 1928 1674.31 330.371 9.73169 PNS24246 1044 790.306 161.455 10.0757 PNS24248 1044 790.306 161.455 10.0757 PNS24244 1471 1217.31 167.263 6.77674 PNS24243 293 107.2 2 0.920142 KQK14069 1603 1349.31 35625 1302.16 KQK14071 474 246.324 191.288 38.3003 ==> SRR12951306.se.tsv <== BRADI_1g14170v3 36146 BRADI_1g53295v3 291 BRADI_1g59795v3 560 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 1341 BRADI_1g74790v3 1538 BRADI_1g09890v3 0 BRADI_1g77505v3 282 BRADI_1g48960v3 0 SRR12951306 completed mapping pipeline successfully