Starting /dee2/code/volunteer_pipeline.sh SRR12951307 current disk space = 1543137763328 free memory = 1602459516 SRR12951307 SRAfilesize 8cc99ad87e4ed33537eed4263080b324 SRR12951307.sra SRR12951307.sra file validated SRR12951307 is paired end SRR12951307 is conventional basespace SRR12951307 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951307_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5135 37.0 37.0 37.0 37.0 37.0 2 36.21875 37.0 37.0 37.0 37.0 37.0 3 36.5255 37.0 37.0 37.0 37.0 37.0 4 36.611 37.0 37.0 37.0 37.0 37.0 5 36.5185 37.0 37.0 37.0 37.0 37.0 6 36.5615 37.0 37.0 37.0 37.0 37.0 7 36.544 37.0 37.0 37.0 37.0 37.0 8 36.5845 37.0 37.0 37.0 37.0 37.0 9 36.517 37.0 37.0 37.0 37.0 37.0 10-14 36.5584 37.0 37.0 37.0 37.0 37.0 15-19 36.569 37.0 37.0 37.0 37.0 37.0 20-24 36.502599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4887 37.0 37.0 37.0 37.0 37.0 30-34 36.4423 37.0 37.0 37.0 37.0 37.0 35-39 36.4439 37.0 37.0 37.0 37.0 37.0 40-44 36.3625 37.0 37.0 37.0 37.0 37.0 45-49 36.386900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3421 37.0 37.0 37.0 37.0 37.0 55-59 36.32600000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.2682 37.0 37.0 37.0 37.0 37.0 65-69 36.223200000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.19 37.0 37.0 37.0 37.0 37.0 75-79 36.3295 37.0 37.0 37.0 37.0 37.0 80-84 36.2611 37.0 37.0 37.0 37.0 37.0 85-89 36.2763 37.0 37.0 37.0 37.0 37.0 90-94 36.2733 37.0 37.0 37.0 37.0 37.0 95-99 36.206399999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.2154 37.0 37.0 37.0 37.0 37.0 105-109 36.2307 37.0 37.0 37.0 37.0 37.0 110-114 36.1076 37.0 37.0 37.0 37.0 37.0 115-119 36.16969999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.108900000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.12949999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.032500000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.998000000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.888799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.9096 37.0 37.0 37.0 37.0 37.0 150-151 35.649 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 2.0 24 2.0 25 3.0 26 2.0 27 3.0 28 11.0 29 23.0 30 23.0 31 32.0 32 55.0 33 80.0 34 118.0 35 314.0 36 2868.0 37 460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.25 11.675 4.275 37.8 2 21.04601458385718 10.988182046768921 35.90646215740508 32.05934121196882 3 20.025000000000002 14.625 24.55 40.8 4 24.65 22.0 22.175 31.175000000000004 5 26.0 26.924999999999997 23.1 23.974999999999998 6 25.174999999999997 29.9 22.35 22.575 7 17.9 25.650000000000002 37.925 18.525 8 20.575 24.125 28.199999999999996 27.1 9 21.575 20.200000000000003 32.300000000000004 25.924999999999997 10-14 23.419999999999998 26.435 25.009999999999998 25.135 15-19 22.865 25.34 25.255 26.540000000000003 20-24 22.650000000000002 25.72 25.045 26.584999999999997 25-29 23.49 25.595000000000002 25.215 25.7 30-34 22.81 25.974999999999998 24.7 26.515 35-39 23.325000000000003 25.264999999999997 24.815 26.595000000000002 40-44 23.165 25.435000000000002 25.264999999999997 26.135 45-49 23.419999999999998 25.805 25.205 25.569999999999997 50-54 22.795 24.779999999999998 25.569999999999997 26.855 55-59 23.724999999999998 25.365 25.31 25.6 60-64 24.135 24.884999999999998 25.06 25.919999999999998 65-69 23.97 24.57 24.715 26.745 70-74 24.04 25.19 24.72 26.05 75-79 24.44 24.89 24.535 26.135 80-84 24.385 25.495 24.195 25.924999999999997 85-89 24.445 25.22 24.615000000000002 25.72 90-94 24.495 25.06 24.525 25.919999999999998 95-99 25.145 24.905 24.11 25.840000000000003 100-104 24.12 25.52 24.18 26.179999999999996 105-109 24.965 25.53 24.099999999999998 25.405 110-114 24.805 24.545 24.474999999999998 26.174999999999997 115-119 24.805 25.215 24.195 25.785000000000004 120-124 25.3 25.230000000000004 23.46 26.009999999999998 125-129 24.91 25.515 23.825 25.75 130-134 24.635 25.669999999999998 23.16 26.534999999999997 135-139 24.36 24.955 23.715 26.97 140-144 24.75 25.47 23.635 26.145000000000003 145-149 24.115000000000002 25.03 24.08 26.775 150-151 23.5 25.4625 23.549999999999997 27.487499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 2.5 27 3.0 28 1.5 29 5.0 30 7.5 31 11.5 32 13.0 33 13.0 34 20.0 35 39.0 36 47.5 37 57.5 38 72.0 39 90.0 40 118.5 41 143.5 42 158.5 43 167.5 44 197.5 45 218.0 46 210.0 47 190.0 48 193.5 49 198.0 50 168.0 51 149.0 52 121.5 53 105.5 54 108.0 55 87.5 56 81.0 57 83.0 58 78.5 59 71.0 60 66.0 61 57.5 62 50.5 63 56.0 64 48.0 65 45.0 66 52.0 67 51.5 68 49.5 69 43.0 70 41.5 71 46.0 72 36.5 73 25.0 74 21.5 75 17.0 76 17.0 77 15.5 78 12.0 79 6.0 80 2.5 81 2.0 82 1.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.15 #Duplication Level Percentage of deduplicated Percentage of total 1 84.15514131088393 69.975 2 12.717979555021047 21.15 3 2.3451593505712567 5.8500000000000005 4 0.4810583283223091 1.6 5 0.21046301864101025 0.8750000000000001 6 0.03006614552014432 0.15 7 0.03006614552014432 0.17500000000000002 8 0.0 0.0 9 0.03006614552014432 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 13 (97% over 37bp) CCAAATCCTCCCATGGCCACCCCCACCAAATTTAACACAACCCACTGATC 7 0.17500000000000002 No Hit ATCTTCTCAATTGCTTTTACAACCTGCAATCGTCAAGAAAAAGAACAAAA 6 0.15 No Hit ACCCATTTCACCAAATCCATATTGTGGCTTGACCGTAAGGAGCACCTTCT 5 0.125 No Hit TCCTTCTCCTCTTCCACCAGCGTCGCCCGCTCCTGCTCCGTGAGCGCCTC 5 0.125 No Hit CATCAGAGTAGTGGATTCCAGGGACAATTATTGCTGGGCAGAAAGCAATT 5 0.125 No Hit TCCACGTGGATGACCCAGCGGCGGCGGTAGACCTGCACCACCTTTCCCTC 5 0.125 No Hit GCGGAATACAAGCAAAAGGTAGTACAAGCCCTGCTCCACACGGAGTAAAA 5 0.125 No Hit GTGGAACCGGTGGCTGGGCTGCCTCAAGGGCGACGGTGTGGTGGTGCTGG 5 0.125 No Hit ATCCATTATCAGCATGGTAGCATAGGTCAGATACTGTGACTAGAAAGATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.2375 0.0 0.0 0.0 0.0 102-103 2.6375 0.0 0.0 0.0 0.0 104-105 3.0875000000000004 0.0 0.0 0.0 0.0 106-107 3.575 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.5875 0.0 0.0 0.0 0.0 112-113 5.074999999999999 0.0 0.0 0.0 0.0 114-115 5.475 0.0 0.0 0.0 0.0 116-117 6.2125 0.0 0.0 0.0 0.0 118-119 6.9875 0.0 0.0 0.0 0.0 120-121 7.6625 0.0 0.0 0.0 0.0 122-123 8.3375 0.0 0.0 0.0 0.0 124-125 8.912500000000001 0.0 0.0 0.0 0.0 126-127 9.6375 0.0 0.0 0.0 0.0 128-129 10.2375 0.0 0.0 0.0 0.0 130-131 10.9625 0.0 0.0 0.0 0.0 132-133 11.5625 0.0 0.0 0.0 0.0 134-135 12.162500000000001 0.0 0.0 0.0 0.0 136-137 12.7875 0.0 0.0 0.0 0.0 138-139 13.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12951307 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951307_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.253 37.0 37.0 37.0 37.0 37.0 2 36.1555 37.0 37.0 37.0 37.0 37.0 3 36.0895 37.0 37.0 37.0 37.0 37.0 4 36.118 37.0 37.0 37.0 37.0 37.0 5 36.232 37.0 37.0 37.0 37.0 37.0 6 36.272 37.0 37.0 37.0 37.0 37.0 7 36.156 37.0 37.0 37.0 37.0 37.0 8 36.143 37.0 37.0 37.0 37.0 37.0 9 36.29 37.0 37.0 37.0 37.0 37.0 10-14 36.1578 37.0 37.0 37.0 37.0 37.0 15-19 36.111000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.0356 37.0 37.0 37.0 37.0 37.0 25-29 35.9962 37.0 37.0 37.0 37.0 37.0 30-34 35.9538 37.0 37.0 37.0 37.0 37.0 35-39 35.92 37.0 37.0 37.0 37.0 37.0 40-44 35.9424 37.0 37.0 37.0 37.0 37.0 45-49 35.8721 37.0 37.0 37.0 37.0 37.0 50-54 35.9042 37.0 37.0 37.0 37.0 37.0 55-59 35.8664 37.0 37.0 37.0 37.0 37.0 60-64 35.82040000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.881099999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.804100000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.7839 37.0 37.0 37.0 37.0 37.0 80-84 35.7111 37.0 37.0 37.0 37.0 37.0 85-89 35.71169999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.7632 37.0 37.0 37.0 37.0 37.0 95-99 35.7281 37.0 37.0 37.0 37.0 37.0 100-104 35.6158 37.0 37.0 37.0 37.0 37.0 105-109 35.6326 37.0 37.0 37.0 37.0 37.0 110-114 35.574400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6645 37.0 37.0 37.0 37.0 37.0 120-124 35.533699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5299 37.0 37.0 37.0 37.0 37.0 130-134 35.3301 37.0 37.0 37.0 37.0 37.0 135-139 35.2925 37.0 37.0 37.0 37.0 37.0 140-144 35.143499999999996 37.0 37.0 37.0 32.2 37.0 145-149 34.8372 37.0 37.0 37.0 25.0 37.0 150-151 34.701750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 6.0 14 11.0 15 4.0 16 4.0 17 2.0 18 2.0 19 4.0 20 5.0 21 6.0 22 6.0 23 9.0 24 8.0 25 12.0 26 14.0 27 11.0 28 17.0 29 18.0 30 25.0 31 37.0 32 53.0 33 99.0 34 177.0 35 496.0 36 2662.0 37 309.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.3 24.075 6.625 28.000000000000004 2 30.475 23.35 26.0 20.175 3 22.875 24.85 29.799999999999997 22.475 4 28.1 28.849999999999998 21.349999999999998 21.7 5 29.349999999999998 32.875 18.925 18.85 6 24.95 34.475 19.6 20.974999999999998 7 23.775 19.175 33.7 23.35 8 23.625 23.25 25.25 27.875 9 24.175 22.475 25.474999999999998 27.875 10-14 26.340000000000003 25.605 22.695 25.36 15-19 26.915 24.79 23.86 24.435000000000002 20-24 27.3 24.740000000000002 23.48 24.48 25-29 26.590000000000003 24.89 23.69 24.83 30-34 25.629999999999995 24.48 23.865 26.025 35-39 27.025 24.654999999999998 23.435 24.884999999999998 40-44 27.37 24.545 23.43 24.654999999999998 45-49 26.91 24.34 23.580000000000002 25.169999999999998 50-54 27.544999999999998 24.215 23.810000000000002 24.43 55-59 26.650000000000002 24.33 24.490000000000002 24.529999999999998 60-64 27.05 24.385 23.955000000000002 24.610000000000003 65-69 27.250000000000004 24.865000000000002 23.515 24.37 70-74 27.150000000000002 24.935 23.755000000000003 24.16 75-79 27.105 24.295 24.215 24.385 80-84 26.87 24.505 24.055 24.57 85-89 26.950000000000003 24.32 24.2 24.529999999999998 90-94 27.650000000000002 24.305 24.585 23.46 95-99 26.495 24.85 23.59 25.064999999999998 100-104 27.32 24.975 23.810000000000002 23.895 105-109 27.089999999999996 25.615 23.465 23.830000000000002 110-114 28.24 25.6 23.005 23.155 115-119 28.144999999999996 25.4 23.015 23.44 120-124 28.325 25.064999999999998 22.895 23.715 125-129 28.92 26.21 22.314999999999998 22.555 130-134 28.849999999999998 25.755 22.985 22.41 135-139 28.754999999999995 24.965 23.36 22.919999999999998 140-144 29.285 24.89 23.395 22.43 145-149 30.064999999999998 24.755 23.05 22.13 150-151 31.2375 23.8125 23.025000000000002 21.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 1.0 26 1.0 27 2.0 28 3.0 29 5.5 30 8.0 31 7.0 32 9.0 33 14.0 34 20.0 35 32.5 36 39.0 37 49.0 38 88.5 39 103.0 40 103.0 41 125.5 42 140.5 43 157.0 44 174.0 45 181.0 46 179.0 47 167.0 48 161.0 49 166.5 50 146.0 51 125.0 52 131.5 53 130.0 54 121.5 55 101.5 56 88.0 57 80.5 58 80.5 59 88.0 60 76.0 61 69.0 62 72.5 63 69.0 64 55.0 65 51.0 66 57.0 67 58.5 68 60.5 69 54.5 70 47.0 71 49.0 72 53.0 73 47.5 74 28.0 75 21.0 76 22.0 77 18.0 78 10.5 79 6.0 80 4.0 81 2.0 82 2.5 83 1.5 84 1.0 85 1.5 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 1.5 95 1.5 96 0.5 97 1.5 98 3.0 99 2.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.75 #Duplication Level Percentage of deduplicated Percentage of total 1 84.71641791044776 70.95 2 12.447761194029852 20.849999999999998 3 2.1194029850746268 5.325 4 0.44776119402985076 1.5 5 0.208955223880597 0.8750000000000001 6 0.029850746268656716 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029850746268656716 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit CCGTGGAGAAGCTCAAGCTGAGGCACAAGGAGCACATCGCCGCCTACGGC 6 0.15 No Hit GCACATCTTGAAGAGGAGAAAAACATTTGCAAGTTGTGTGCCCATATCCT 5 0.125 No Hit CTCAAAAGCATTTTGCATTTGTTTTGAAAATCCAATCATCTACAATTGCT 5 0.125 No Hit GGCTGGGAGACCCCCGAGGTCGGCGACGAGGTCGAAGTGCATTACACGGG 5 0.125 No Hit AGAGGCCAATCACCCCCGCCGCCGCCATGAAGCGCAACCCCCGCGTCACG 5 0.125 No Hit AGAGCGCGGTGGCCAGGCTGAACAAGGCGAACCCCGGCGCGCCGCCTCTC 5 0.125 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit AGAACATTGATAATTTCTTCGCAGAAAATGAACAAATTGCTTTCTGCCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.5750000000000002 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 3.0625 0.0 0.0 0.0 0.0 106-107 3.5375 0.0 0.0 0.0 0.0 108-109 4.1 0.0 0.0 0.0 0.0 110-111 4.5625 0.0 0.0 0.0 0.0 112-113 5.050000000000001 0.0 0.0 0.0 0.0 114-115 5.45 0.0 0.0 0.0 0.0 116-117 6.2125 0.0 0.0 0.0 0.0 118-119 6.9625 0.0 0.0 0.0 0.0 120-121 7.637499999999999 0.0 0.0 0.0 0.0 122-123 8.2875 0.0 0.0 0.0 0.0 124-125 8.875 0.0 0.0 0.0 0.0 126-127 9.5875 0.0 0.0 0.0 0.0 128-129 10.1875 0.0 0.0 0.0 0.0 130-131 10.9125 0.0 0.0 0.0 0.0 132-133 11.524999999999999 0.0 0.0 0.0 0.0 134-135 12.1375 0.0 0.0 0.0 0.0 136-137 12.775 0.0 0.0 0.0 0.0 138-139 13.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGATAA 10 0.006830828 145.0 4 CAGGCGG 10 0.006830828 145.0 3 GGGGGGG 130 0.0070306947 8.923077 140-144 >>END_MODULE Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078619 spots for SRR12951307.sra Written 2078619 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra Read 2078600 spots for SRR12951307.sra Written 2078600 spots for SRR12951307.sra SRR ids: ['SRR12951307.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yiv0geux SRR12951307.sra spots: 41572019 blocks: [[1, 2078600], [2078601, 4157200], [4157201, 6235800], [6235801, 8314400], [8314401, 10393000], [10393001, 12471600], [12471601, 14550200], [14550201, 16628800], [16628801, 18707400], [18707401, 20786000], [20786001, 22864600], [22864601, 24943200], [24943201, 27021800], [27021801, 29100400], [29100401, 31179000], [31179001, 33257600], [33257601, 35336200], [35336201, 37414800], [37414801, 39493400], [39493401, 41572019]] SRR12951307 file size 14106290 SRR12951307 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951307 SRR12951307_1.fastq SRR12951307_2.fastq Input file: SRR12951307_1.fastq Paired file: SRR12951307_2.fastq trimmed: SRR12951307-trimmed-pair1.fastq, SRR12951307-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:19:29 2024 >> started Sat Dec 7 11:20:48 2024 >> done (78.832s) 41572019 read pairs processed; of these: 288 ( 0.00%) short read pairs filtered out after trimming by size control 131261 ( 0.32%) empty read pairs filtered out after trimming by size control 41440470 (99.68%) read pairs available; of these: 6926401 (16.71%) trimmed read pairs available after processing 34514069 (83.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 36 0.00% 20 52 0.00% 21 47 0.00% 22 46 0.00% 23 58 0.00% 24 82 0.00% 25 103 0.00% 26 97 0.00% 27 113 0.00% 28 128 0.00% 29 125 0.00% 30 121 0.00% 31 153 0.00% 32 133 0.00% 33 132 0.00% 34 163 0.00% 35 171 0.00% 36 169 0.00% 37 178 0.00% 38 191 0.00% 39 191 0.00% 40 211 0.00% 41 195 0.00% 42 225 0.00% 43 217 0.00% 44 212 0.00% 45 215 0.00% 46 236 0.00% 47 279 0.00% 48 292 0.00% 49 332 0.00% 50 419 0.00% 51 493 0.00% 52 523 0.00% 53 507 0.00% 54 592 0.00% 55 642 0.00% 56 703 0.00% 57 824 0.00% 58 983 0.00% 59 1049 0.00% 60 1354 0.00% 61 1490 0.00% 62 1696 0.00% 63 1975 0.00% 64 2006 0.00% 65 2291 0.01% 66 2607 0.01% 67 2636 0.01% 68 3209 0.01% 69 3506 0.01% 70 4288 0.01% 71 5041 0.01% 72 5573 0.01% 73 6531 0.02% 74 7421 0.02% 75 7886 0.02% 76 8724 0.02% 77 9736 0.02% 78 10514 0.03% 79 12154 0.03% 80 13686 0.03% 81 15100 0.04% 82 16845 0.04% 83 19325 0.05% 84 20878 0.05% 85 23147 0.06% 86 25094 0.06% 87 26736 0.06% 88 28642 0.07% 89 30654 0.07% 90 32974 0.08% 91 35486 0.09% 92 38288 0.09% 93 41645 0.10% 94 45127 0.11% 95 46784 0.11% 96 50382 0.12% 97 52959 0.13% 98 54949 0.13% 99 57618 0.14% 100 59446 0.14% 101 61738 0.15% 102 64851 0.16% 103 69139 0.17% 104 72264 0.17% 105 75513 0.18% 106 79053 0.19% 107 80598 0.19% 108 82720 0.20% 109 85380 0.21% 110 87094 0.21% 111 90182 0.22% 112 93164 0.22% 113 95427 0.23% 114 100544 0.24% 115 103073 0.25% 116 105260 0.25% 117 107568 0.26% 118 109278 0.26% 119 111432 0.27% 120 112452 0.27% 121 115099 0.28% 122 117317 0.28% 123 120597 0.29% 124 124845 0.30% 125 127337 0.31% 126 128560 0.31% 127 131006 0.32% 128 132142 0.32% 129 134917 0.33% 130 133885 0.32% 131 134741 0.33% 132 139551 0.34% 133 140382 0.34% 134 141472 0.34% 135 145576 0.35% 136 148476 0.36% 137 147736 0.36% 138 149770 0.36% 139 150132 0.36% 140 151015 0.36% 141 152468 0.37% 142 153865 0.37% 143 154082 0.37% 144 157324 0.38% 145 158717 0.38% 146 158773 0.38% 147 158738 0.38% 148 159783 0.39% 149 160877 0.39% 150 162424 0.39% 151 34514069 83.29% 41440470 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.6 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=487.09 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=22.6 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGGATTGATCTGTGTGTTTTGATCGGATGGCTGGTGGCGCTCCGGCTCTCTGCTGCTGCTCCAACGTGGGTTGCTG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=31 prefix-density=0.69 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=238.48 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=20.9 sequence=CGCCGCCGCCGA SRR12951307 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:21:26 Started mapping on | Dec 07 11:21:26 Finished on | Dec 07 11:25:02 Mapping speed, Million of reads per hour | 690.67 Number of input reads | 41440470 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 39148750 Uniquely mapped reads % | 94.47% Average mapped length | 292.21 Number of splices: Total | 37046092 Number of splices: Annotated (sjdb) | 34284743 Number of splices: GT/AG | 36512289 Number of splices: GC/AG | 468217 Number of splices: AT/AC | 26185 Number of splices: Non-canonical | 39401 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396544 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 122929 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 1.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1895176 1895176 1895176 N_multimapping 396544 396544 396544 N_noFeature 1739868 38021688 2111365 N_ambiguous 873269 5608 117263 UnstrandedReadsAssigned:36535613 PositiveStrandReadsAssigned:1121454 NegativeStrandReadsAssigned:36920122 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951307 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951307-trimmed-pair1.fastq SRR12951307-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,440,470 reads, 37,601,470 reads pseudoaligned [quant] estimated average fragment length: 251.42 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52973 SRR12951307.ke.tsv 35125 SRR12951307.se.tsv 88098 total ==> SRR12951307.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.305 0 0 PNS24247 1044 793.58 274.594 13.4302 PNS24249 1928 1677.58 604.269 13.9808 PNS24246 1044 793.58 274.594 13.4302 PNS24248 1044 793.58 274.594 13.4302 PNS24244 1471 1220.58 418.95 13.3223 PNS24243 293 108.565 0 0 KQK14069 1603 1352.58 84138.8 2414.44 KQK14071 474 248.975 292.314 45.5697 ==> SRR12951307.se.tsv <== BRADI_1g14170v3 84468 BRADI_1g53295v3 360 BRADI_1g59795v3 1401 BRADI_1g07683v3 0 BRADI_1g00485v3 56 BRADI_1g20270v3 1165 BRADI_1g74790v3 2606 BRADI_1g09890v3 0 BRADI_1g77505v3 489 BRADI_1g48960v3 0 SRR12951307 completed mapping pipeline successfully