Starting /dee2/code/volunteer_pipeline.sh SRR12951308 current disk space = 1543159001088 free memory = 1602897784 SRR12951308 SRAfilesize a9ca63182ba5df4dd38fad97ae49441b SRR12951308.sra SRR12951308.sra file validated SRR12951308 is paired end SRR12951308 is conventional basespace SRR12951308 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951308_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.589 37.0 37.0 37.0 37.0 37.0 2 36.19675 37.0 37.0 37.0 37.0 37.0 3 36.562 37.0 37.0 37.0 37.0 37.0 4 36.6185 37.0 37.0 37.0 37.0 37.0 5 36.646 37.0 37.0 37.0 37.0 37.0 6 36.656 37.0 37.0 37.0 37.0 37.0 7 36.576 37.0 37.0 37.0 37.0 37.0 8 36.5935 37.0 37.0 37.0 37.0 37.0 9 36.5795 37.0 37.0 37.0 37.0 37.0 10-14 36.556599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5874 37.0 37.0 37.0 37.0 37.0 20-24 36.5292 37.0 37.0 37.0 37.0 37.0 25-29 36.540200000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5 37.0 37.0 37.0 37.0 37.0 35-39 36.513400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.474599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.401399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.422399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.351800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3069 37.0 37.0 37.0 37.0 37.0 65-69 36.275400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3054 37.0 37.0 37.0 37.0 37.0 75-79 36.359700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3228 37.0 37.0 37.0 37.0 37.0 85-89 36.2559 37.0 37.0 37.0 37.0 37.0 90-94 36.2935 37.0 37.0 37.0 37.0 37.0 95-99 36.2371 37.0 37.0 37.0 37.0 37.0 100-104 36.2735 37.0 37.0 37.0 37.0 37.0 105-109 36.274699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1891 37.0 37.0 37.0 37.0 37.0 115-119 36.2453 37.0 37.0 37.0 37.0 37.0 120-124 36.1255 37.0 37.0 37.0 37.0 37.0 125-129 36.0689 37.0 37.0 37.0 37.0 37.0 130-134 36.059 37.0 37.0 37.0 37.0 37.0 135-139 35.9747 37.0 37.0 37.0 37.0 37.0 140-144 35.9241 37.0 37.0 37.0 37.0 37.0 145-149 35.9413 37.0 37.0 37.0 37.0 37.0 150-151 35.74275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 5.0 26 2.0 27 15.0 28 11.0 29 14.0 30 24.0 31 32.0 32 38.0 33 54.0 34 152.0 35 303.0 36 2810.0 37 539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.425000000000004 10.274999999999999 5.375 29.925 2 23.444976076555022 11.609166456811886 32.28405943087383 32.661798035759254 3 22.400000000000002 18.25 26.525 32.824999999999996 4 28.325 23.549999999999997 21.925 26.200000000000003 5 26.825 28.575 20.9 23.7 6 25.825 31.175000000000004 20.875 22.125 7 18.85 25.074999999999996 36.15 19.925 8 21.099999999999998 22.675 28.449999999999996 27.775 9 21.875 20.200000000000003 30.675 27.250000000000004 10-14 24.44 24.825 23.855 26.88 15-19 24.39 24.41 25.009999999999998 26.19 20-24 24.285 24.54 24.279999999999998 26.895000000000003 25-29 24.36 24.955 23.73 26.955000000000002 30-34 25.095 23.655 24.91 26.340000000000003 35-39 24.445 24.65 24.39 26.515 40-44 24.905 24.77 24.195 26.13 45-49 24.68 25.205 23.625 26.490000000000002 50-54 25.39 24.169999999999998 23.93 26.51 55-59 24.595 24.175 24.135 27.095000000000002 60-64 25.1 23.7 24.104999999999997 27.095000000000002 65-69 25.455 23.674999999999997 23.54 27.33 70-74 25.169999999999998 23.325000000000003 24.605 26.900000000000002 75-79 25.945 23.365 24.195 26.495 80-84 25.380000000000003 24.03 23.755000000000003 26.834999999999997 85-89 25.09 24.104999999999997 24.41 26.395000000000003 90-94 25.4 24.565 23.905 26.13 95-99 25.679999999999996 24.485 23.84 25.995 100-104 25.595000000000002 24.325 23.72 26.36 105-109 26.279999999999998 23.965 23.355 26.400000000000002 110-114 26.265 23.68 24.245 25.81 115-119 26.095000000000002 24.310000000000002 22.965 26.63 120-124 25.929999999999996 24.85 22.75 26.47 125-129 26.195 23.835 23.36 26.61 130-134 26.39 23.575 23.61 26.424999999999997 135-139 26.669999999999998 23.9 23.724999999999998 25.705 140-144 25.5 24.47 23.205000000000002 26.825 145-149 26.6 23.544999999999998 23.01 26.845000000000002 150-151 26.8625 23.7 23.075000000000003 26.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 2.0 25 2.5 26 0.5 27 0.5 28 0.5 29 0.5 30 1.5 31 3.5 32 7.0 33 13.5 34 20.5 35 29.0 36 36.5 37 45.0 38 70.0 39 94.5 40 111.0 41 120.5 42 126.0 43 147.5 44 177.5 45 183.0 46 178.5 47 173.0 48 181.0 49 175.5 50 145.0 51 128.0 52 123.0 53 113.5 54 107.5 55 106.0 56 98.0 57 93.0 58 85.0 59 79.5 60 81.0 61 81.0 62 70.0 63 64.5 64 69.0 65 71.5 66 72.5 67 72.5 68 64.5 69 62.0 70 58.0 71 53.5 72 46.5 73 36.0 74 27.5 75 22.5 76 25.0 77 16.0 78 4.0 79 3.5 80 4.5 81 5.0 82 5.0 83 2.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 78.7 #Duplication Level Percentage of deduplicated Percentage of total 1 80.6861499364676 63.5 2 14.263024142312581 22.45 3 3.5578144853875475 8.4 4 1.0165184243964422 3.2 5 0.1905972045743329 0.75 6 0.1905972045743329 0.8999999999999999 7 0.03176620076238882 0.17500000000000002 8 0.0 0.0 9 0.03176620076238882 0.22499999999999998 >10 0.03176620076238882 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGGACTTATCTCGTAT 16 0.4 TruSeq Adapter, Index 20 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGGACTTATCGCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 20 (97% over 37bp) GCATCATTCACCGGATGCATCACCCGGTAGTGGAAGAAGAACCCCACAAT 7 0.17500000000000002 No Hit GTCCGCCTTGAGCTTCCGCCCGCCCTCCTGCAGCTGGAAGTCGAGGTTGA 6 0.15 No Hit GATGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGAC 6 0.15 No Hit TCACCGATTCTTCATTTTTTGTTCAAAAGTGCAGAACCTAATTTTCAGAT 6 0.15 No Hit CTTCAGTCTCATAAATCGCTGCCATACAATAGGGAACAGGTCAATTACCC 6 0.15 No Hit AGGGAGTTATCGATGAATATCCTTGGAGATTGCTCGAATGGTGTGGAGTT 6 0.15 No Hit GGTAGTACAAGCCCTGCTCCACACGGAGTAAAACATCTGGAAACACGAAC 6 0.15 No Hit CTCGAGGAAGCGCCGGTTCATGACGACCTGGCCGTCGCCGCGGTCGGTGA 5 0.125 No Hit CCGAGCATATGTATGTAAAGCATTTTCCAAACATATTTTTTCTTCTCATA 5 0.125 No Hit GCGGCATTTCCTTTGCTGCCGTCGGCGGCAACGGCAGATGATGAGTCCAT 5 0.125 No Hit ATCACCTTCAATACTTGCATGTAAGCCTCTCTCTTCCACAGCAGCCTCAG 5 0.125 No Hit CCAGCATTTTCTTCAGAGCCCATGGCGTCGACGTCATGATGTCACTTTTC 5 0.125 No Hit GTGGTTCTTTGGAAGCATGCGGAATTGCTGAGTTAACTTGAGACACTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.05 12-13 0.0 0.0 0.0 0.0 0.05 14-15 0.0 0.0 0.0 0.0 0.05 16-17 0.0 0.0 0.0 0.0 0.05 18-19 0.0 0.0 0.0 0.0 0.05 20-21 0.0 0.0 0.0 0.0 0.05 22-23 0.0 0.0 0.0 0.0 0.05 24-25 0.0 0.0 0.0 0.0 0.05 26-27 0.0 0.0 0.0 0.0 0.05 28-29 0.0 0.0 0.0 0.0 0.05 30-31 0.0 0.0 0.0 0.0 0.05 32-33 0.0 0.0 0.0 0.0 0.05 34-35 0.0 0.0 0.0 0.0 0.05 36-37 0.0 0.0 0.0 0.0 0.05 38-39 0.0 0.0 0.0 0.0 0.05 40-41 0.0 0.0 0.0 0.0 0.05 42-43 0.0 0.0 0.0 0.0 0.05 44-45 0.0 0.0 0.0 0.0 0.05 46-47 0.0 0.0 0.0 0.0 0.05 48-49 0.0 0.0 0.0 0.0 0.05 50-51 0.0 0.0 0.0 0.0 0.05 52-53 0.0 0.0 0.0 0.0 0.05 54-55 0.0 0.0 0.0 0.0 0.05 56-57 0.0 0.0 0.0 0.0 0.05 58-59 0.0 0.0 0.0 0.0 0.05 60-61 0.0 0.0 0.0 0.0 0.05 62-63 0.0125 0.0 0.0 0.0 0.05 64-65 0.05 0.0 0.0 0.0 0.05 66-67 0.1 0.0 0.0 0.0 0.05 68-69 0.125 0.0 0.0 0.0 0.05 70-71 0.1375 0.0 0.0 0.0 0.05 72-73 0.22499999999999998 0.0 0.0 0.0 0.05 74-75 0.3 0.0 0.0 0.0 0.05 76-77 0.35 0.0 0.0 0.0 0.05 78-79 0.35 0.0 0.0 0.0 0.05 80-81 0.38749999999999996 0.0 0.0 0.0 0.05 82-83 0.5375 0.0 0.0 0.0 0.05 84-85 0.6375 0.0 0.0 0.0 0.05 86-87 0.7375 0.0 0.0 0.0 0.05 88-89 0.8625 0.0 0.0 0.0 0.05 90-91 0.975 0.0 0.0 0.0 0.05 92-93 1.0499999999999998 0.0 0.0 0.0 0.05 94-95 1.2625000000000002 0.0 0.0 0.0 0.05 96-97 1.7125 0.0 0.0 0.0 0.05 98-99 2.0 0.0 0.0 0.0 0.05 100-101 2.15 0.0 0.0 0.0 0.05 102-103 2.3125 0.0 0.0 0.0 0.05 104-105 2.6875 0.0 0.0 0.0 0.05 106-107 2.95 0.0 0.0 0.0 0.05 108-109 3.2249999999999996 0.0 0.0 0.0 0.05 110-111 3.6125 0.0 0.0 0.0 0.05 112-113 3.8625 0.0 0.0 0.0 0.05 114-115 4.112500000000001 0.0 0.0 0.0 0.05 116-117 4.6 0.0 0.0 0.0 0.05 118-119 5.125 0.0 0.0 0.0 0.05 120-121 5.4125 0.0 0.0 0.0 0.05 122-123 5.825 0.0 0.0 0.0 0.05 124-125 6.325 0.0 0.0 0.0 0.05 126-127 6.862500000000001 0.0 0.0 0.0 0.05 128-129 7.675000000000001 0.0 0.0 0.0 0.05 130-131 8.25 0.0 0.0 0.0 0.05 132-133 8.5 0.0 0.0 0.0 0.05 134-135 9.0875 0.0 0.0 0.0 0.05 136-137 9.5875 0.0 0.0 0.0 0.05 138-139 10.225 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGGCT 10 0.006830828 145.0 9 TATGGGC 10 0.006830828 145.0 8 >>END_MODULE SRR12951308 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951308_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0455 37.0 37.0 37.0 37.0 37.0 2 36.0315 37.0 37.0 37.0 37.0 37.0 3 35.996 37.0 37.0 37.0 37.0 37.0 4 35.986 37.0 37.0 37.0 37.0 37.0 5 35.8355 37.0 37.0 37.0 37.0 37.0 6 35.8785 37.0 37.0 37.0 37.0 37.0 7 35.858 37.0 37.0 37.0 37.0 37.0 8 35.8215 37.0 37.0 37.0 37.0 37.0 9 35.7805 37.0 37.0 37.0 37.0 37.0 10-14 35.818 37.0 37.0 37.0 37.0 37.0 15-19 35.7123 37.0 37.0 37.0 37.0 37.0 20-24 35.574 37.0 37.0 37.0 37.0 37.0 25-29 35.5024 37.0 37.0 37.0 37.0 37.0 30-34 35.433499999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.4979 37.0 37.0 37.0 37.0 37.0 40-44 35.4219 37.0 37.0 37.0 37.0 37.0 45-49 35.362 37.0 37.0 37.0 37.0 37.0 50-54 35.337 37.0 37.0 37.0 37.0 37.0 55-59 35.3614 37.0 37.0 37.0 37.0 37.0 60-64 35.3601 37.0 37.0 37.0 37.0 37.0 65-69 35.414100000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.337599999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.3438 37.0 37.0 37.0 37.0 37.0 80-84 35.2556 37.0 37.0 37.0 37.0 37.0 85-89 35.2735 37.0 37.0 37.0 37.0 37.0 90-94 35.2904 37.0 37.0 37.0 37.0 37.0 95-99 35.2582 37.0 37.0 37.0 37.0 37.0 100-104 35.2111 37.0 37.0 37.0 37.0 37.0 105-109 35.175799999999995 37.0 37.0 37.0 34.6 37.0 110-114 35.1183 37.0 37.0 37.0 34.6 37.0 115-119 35.1891 37.0 37.0 37.0 34.6 37.0 120-124 35.1385 37.0 37.0 37.0 34.6 37.0 125-129 35.0464 37.0 37.0 37.0 29.8 37.0 130-134 34.9604 37.0 37.0 37.0 27.4 37.0 135-139 34.8935 37.0 37.0 37.0 25.0 37.0 140-144 34.8127 37.0 37.0 37.0 25.0 37.0 145-149 34.738099999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.6235 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 17.0 14 20.0 15 22.0 16 3.0 17 9.0 18 7.0 19 4.0 20 15.0 21 17.0 22 26.0 23 17.0 24 27.0 25 17.0 26 11.0 27 14.0 28 18.0 29 15.0 30 18.0 31 21.0 32 44.0 33 75.0 34 162.0 35 453.0 36 2640.0 37 323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.625 17.95 7.000000000000001 24.425 2 30.95 21.45 22.3 25.3 3 27.175 23.549999999999997 26.325 22.95 4 31.225 29.075 16.625 23.075000000000003 5 28.725 31.8 17.65 21.825 6 26.55 31.874999999999996 18.875 22.7 7 25.75 19.45 30.175 24.625 8 25.525 23.25 21.95 29.275000000000002 9 25.650000000000002 21.525 23.95 28.875 10-14 28.53 24.654999999999998 21.115000000000002 25.7 15-19 28.59 24.279999999999998 21.17 25.96 20-24 28.1 24.43 22.16 25.31 25-29 27.560000000000002 24.43 22.575 25.435000000000002 30-34 27.650000000000002 24.18 22.625 25.545 35-39 27.685 24.310000000000002 22.259999999999998 25.745 40-44 28.294999999999998 24.044999999999998 22.86 24.8 45-49 27.99 23.75 22.625 25.635 50-54 28.005000000000003 24.68 22.97 24.345 55-59 28.444999999999997 23.974999999999998 22.23 25.35 60-64 28.225 23.78 22.54 25.455 65-69 27.27 24.605 23.189999999999998 24.935 70-74 28.16 24.8 22.27 24.77 75-79 27.875 24.855 22.28 24.990000000000002 80-84 27.794999999999998 24.85 21.884999999999998 25.47 85-89 27.694999999999997 25.205 21.91 25.19 90-94 27.925 24.775 22.33 24.97 95-99 28.27 24.325 22.745 24.66 100-104 27.765 24.490000000000002 22.945 24.8 105-109 27.994999999999997 24.535 22.25 25.22 110-114 28.1 24.89 21.654999999999998 25.355 115-119 28.765 25.0 21.745 24.490000000000002 120-124 28.060000000000002 25.014999999999997 22.055 24.87 125-129 28.875 24.995 22.065 24.065 130-134 29.64 24.525 21.745 24.09 135-139 30.044999999999998 24.93 21.805 23.22 140-144 30.285 25.52 21.93 22.264999999999997 145-149 31.759999999999998 24.490000000000002 21.04 22.71 150-151 31.924999999999997 24.925 20.4375 22.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.5 8 3.5 9 2.5 10 0.5 11 1.5 12 3.5 13 2.5 14 1.0 15 1.5 16 1.0 17 0.5 18 1.0 19 2.0 20 3.0 21 2.0 22 1.5 23 2.0 24 2.0 25 2.0 26 1.5 27 1.5 28 2.0 29 4.0 30 3.5 31 3.5 32 9.0 33 11.0 34 16.0 35 25.0 36 33.5 37 43.0 38 49.5 39 62.0 40 77.5 41 104.0 42 128.0 43 132.5 44 146.0 45 163.0 46 166.5 47 165.0 48 156.5 49 159.5 50 165.0 51 131.0 52 116.5 53 123.5 54 107.5 55 94.0 56 97.0 57 93.0 58 93.5 59 94.0 60 79.0 61 77.0 62 85.5 63 83.5 64 68.5 65 64.0 66 71.5 67 68.0 68 66.5 69 69.0 70 62.0 71 57.5 72 53.5 73 49.0 74 38.0 75 29.5 76 24.0 77 17.0 78 13.5 79 8.0 80 4.5 81 3.5 82 5.0 83 6.0 84 2.0 85 1.5 86 2.0 87 1.5 88 2.5 89 2.0 90 1.0 91 2.0 92 2.0 93 2.0 94 2.0 95 2.0 96 4.5 97 5.5 98 4.0 99 8.0 100 22.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.65 #Duplication Level Percentage of deduplicated Percentage of total 1 81.82674199623352 65.17500000000001 2 13.684871311989957 21.8 3 3.295668549905838 7.875 4 0.7846829880728187 2.5 5 0.2197112366603892 0.8750000000000001 6 0.12554927809165098 0.6 7 0.031387319522912745 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.031387319522912745 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 40 1.0 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit CCCGAACCCTCTCCCCCTGCCGCCGCCGCCGCCGCGCGCCGCCGCCACAA 6 0.15 No Hit CTCGTCTTTCTTGAAGGGGTTTGGACTTGCAAGTTCCTCCTCATCAACCC 6 0.15 No Hit GCTCCATCAGACGAGAAATGACGGTGGCAAAGGTTGGGGCGGCGATGGTG 6 0.15 No Hit GACTTATGGGAGATTGGGAAGCACCATCTTGTCACCTTGGGGCAGCATAT 6 0.15 No Hit GATCGATGGAAGAAAAAGGCGGCGGTGGCCTGGCTTATTACTGCCTGTTC 5 0.125 No Hit GATTAACAGTGAAGGAGATGGAAGAGCTACGTGATGACATTAAGATGCAT 5 0.125 No Hit TATGCATCCATTGGTGCATGGAGATTATCCCCCAGTGATGAGGAAGAATG 5 0.125 No Hit GCGAAGCTCTGAAGGACAAGCTCAGCTCCCTCGTGACGCTCAGCCGCGTG 5 0.125 No Hit CATGGCAAAGGGTATCGGCAACGGCATCCCTCTGGGCGCCGTGGTGACGA 5 0.125 No Hit GGGGTCTTGCCCGTTACGCCGCCATCTCTCAGGACAACGGTCTGGTGCCG 5 0.125 No Hit AAGATATTTAACCCGCTACATGATGAAACATTTTATTTGACCGAGGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.9500000000000002 0.0 0.0 0.0 0.0 100-101 2.1 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.2249999999999996 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 3.9000000000000004 0.0 0.0 0.0 0.0 114-115 4.137499999999999 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 5.15 0.0 0.0 0.0 0.0 120-121 5.4375 0.0 0.0 0.0 0.0 122-123 5.85 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.9 0.0 0.0 0.0 0.0 128-129 7.7 0.0 0.0 0.0 0.0 130-131 8.25 0.0 0.0 0.0 0.0 132-133 8.5125 0.0 0.0 0.0 0.0 134-135 9.0875 0.0 0.0 0.0 0.0 136-137 9.5625 0.0 0.0 0.0 0.0 138-139 10.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCTTG 10 0.006830828 145.0 1 >>END_MODULE Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949536 spots for SRR12951308.sra Written 1949536 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra Read 1949533 spots for SRR12951308.sra Written 1949533 spots for SRR12951308.sra SRR ids: ['SRR12951308.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d2zr2_3l SRR12951308.sra spots: 38990663 blocks: [[1, 1949533], [1949534, 3899066], [3899067, 5848599], [5848600, 7798132], [7798133, 9747665], [9747666, 11697198], [11697199, 13646731], [13646732, 15596264], [15596265, 17545797], [17545798, 19495330], [19495331, 21444863], [21444864, 23394396], [23394397, 25343929], [25343930, 27293462], [27293463, 29242995], [29242996, 31192528], [31192529, 33142061], [33142062, 35091594], [35091595, 37041127], [37041128, 38990663]] SRR12951308 file size 13229032 SRR12951308 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951308 SRR12951308_1.fastq SRR12951308_2.fastq Input file: SRR12951308_1.fastq Paired file: SRR12951308_2.fastq trimmed: SRR12951308-trimmed-pair1.fastq, SRR12951308-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:19:38 2024 >> started Sat Dec 7 11:20:38 2024 >> done (60.614s) 38990663 read pairs processed; of these: 273 ( 0.00%) short read pairs filtered out after trimming by size control 177443 ( 0.46%) empty read pairs filtered out after trimming by size control 38812947 (99.54%) read pairs available; of these: 5512625 (14.20%) trimmed read pairs available after processing 33300322 (85.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 28 0.00% 20 41 0.00% 21 46 0.00% 22 62 0.00% 23 75 0.00% 24 102 0.00% 25 111 0.00% 26 108 0.00% 27 149 0.00% 28 159 0.00% 29 130 0.00% 30 155 0.00% 31 125 0.00% 32 161 0.00% 33 156 0.00% 34 135 0.00% 35 149 0.00% 36 173 0.00% 37 158 0.00% 38 188 0.00% 39 204 0.00% 40 218 0.00% 41 235 0.00% 42 267 0.00% 43 265 0.00% 44 261 0.00% 45 314 0.00% 46 353 0.00% 47 384 0.00% 48 439 0.00% 49 476 0.00% 50 504 0.00% 51 578 0.00% 52 665 0.00% 53 603 0.00% 54 675 0.00% 55 788 0.00% 56 879 0.00% 57 1030 0.00% 58 1129 0.00% 59 1300 0.00% 60 1431 0.00% 61 1729 0.00% 62 1882 0.00% 63 2124 0.01% 64 2263 0.01% 65 2466 0.01% 66 2695 0.01% 67 2945 0.01% 68 3391 0.01% 69 4040 0.01% 70 4661 0.01% 71 5179 0.01% 72 6002 0.02% 73 6771 0.02% 74 7377 0.02% 75 7788 0.02% 76 8458 0.02% 77 9122 0.02% 78 9989 0.03% 79 11192 0.03% 80 12340 0.03% 81 14025 0.04% 82 15455 0.04% 83 16998 0.04% 84 18172 0.05% 85 19836 0.05% 86 20440 0.05% 87 21335 0.05% 88 22490 0.06% 89 23682 0.06% 90 26206 0.07% 91 28029 0.07% 92 30238 0.08% 93 32978 0.08% 94 35447 0.09% 95 36033 0.09% 96 37678 0.10% 97 38625 0.10% 98 40175 0.10% 99 41518 0.11% 100 43660 0.11% 101 46110 0.12% 102 48715 0.13% 103 51730 0.13% 104 53767 0.14% 105 56193 0.14% 106 57484 0.15% 107 58531 0.15% 108 59861 0.15% 109 60959 0.16% 110 62756 0.16% 111 65870 0.17% 112 69483 0.18% 113 72206 0.19% 114 75779 0.20% 115 77748 0.20% 116 80129 0.21% 117 80663 0.21% 118 81320 0.21% 119 82747 0.21% 120 84210 0.22% 121 86574 0.22% 122 89047 0.23% 123 93366 0.24% 124 97882 0.25% 125 100133 0.26% 126 101440 0.26% 127 101876 0.26% 128 102905 0.27% 129 104050 0.27% 130 103700 0.27% 131 106791 0.28% 132 109174 0.28% 133 114094 0.29% 134 116644 0.30% 135 120280 0.31% 136 121356 0.31% 137 121626 0.31% 138 121951 0.31% 139 122280 0.32% 140 122736 0.32% 141 124497 0.32% 142 126933 0.33% 143 128784 0.33% 144 133784 0.34% 145 135470 0.35% 146 137185 0.35% 147 137506 0.35% 148 138239 0.36% 149 137100 0.35% 150 138089 0.36% 151 33300322 85.80% 38812947 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=35 prefix-density=0.32 prefix-fanout=3.0 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=153.07 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=19.8 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=34 prefix-density=0.77 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=199.94 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=23.8 sequence=CGCCGCCGCCGC SRR12951308 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:21:20 Started mapping on | Dec 07 11:21:20 Finished on | Dec 07 11:25:50 Mapping speed, Million of reads per hour | 517.51 Number of input reads | 38812947 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 35754670 Uniquely mapped reads % | 92.12% Average mapped length | 292.97 Number of splices: Total | 31596175 Number of splices: Annotated (sjdb) | 29334096 Number of splices: GT/AG | 31163003 Number of splices: GC/AG | 357631 Number of splices: AT/AC | 18719 Number of splices: Non-canonical | 56822 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357653 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 40386 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.28% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2700624 2700624 2700624 N_multimapping 357653 357653 357653 N_noFeature 1204511 34805065 1503957 N_ambiguous 765170 4615 114981 UnstrandedReadsAssigned:33784989 PositiveStrandReadsAssigned:944990 NegativeStrandReadsAssigned:34135732 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951308 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951308-trimmed-pair1.fastq SRR12951308-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,812,947 reads, 35,121,999 reads pseudoaligned [quant] estimated average fragment length: 251.936 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR12951308.ke.tsv 35125 SRR12951308.se.tsv 88098 total ==> SRR12951308.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.781 0 0 PNS24247 1044 793.064 215.721 11.0105 PNS24249 1928 1677.06 622.681 15.0292 PNS24246 1044 793.064 215.721 11.0105 PNS24248 1044 793.064 215.721 11.0105 PNS24244 1471 1220.06 262.155 8.69753 PNS24243 293 104.568 0 0 KQK14069 1603 1352.06 29813.2 892.55 KQK14071 474 245.516 879.721 145.039 ==> SRR12951308.se.tsv <== BRADI_1g14170v3 32791 BRADI_1g53295v3 184 BRADI_1g59795v3 590 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1274 BRADI_1g74790v3 2453 BRADI_1g09890v3 0 BRADI_1g77505v3 297 BRADI_1g48960v3 0 SRR12951308 completed mapping pipeline successfully