Starting /dee2/code/volunteer_pipeline.sh SRR12951310 current disk space = 1543021051904 free memory = 1600410700 SRR12951310 SRAfilesize 9081fc3c6ae7e7f559296a443ef30772 SRR12951310.sra SRR12951310.sra file validated SRR12951310 is paired end SRR12951310 is conventional basespace SRR12951310 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951310_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.499 37.0 37.0 37.0 37.0 37.0 2 36.23175 37.0 37.0 37.0 37.0 37.0 3 36.456 37.0 37.0 37.0 37.0 37.0 4 36.567 37.0 37.0 37.0 37.0 37.0 5 36.675 37.0 37.0 37.0 37.0 37.0 6 36.5655 37.0 37.0 37.0 37.0 37.0 7 36.571 37.0 37.0 37.0 37.0 37.0 8 36.526 37.0 37.0 37.0 37.0 37.0 9 36.6005 37.0 37.0 37.0 37.0 37.0 10-14 36.6096 37.0 37.0 37.0 37.0 37.0 15-19 36.5865 37.0 37.0 37.0 37.0 37.0 20-24 36.558499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.515499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.49679999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4889 37.0 37.0 37.0 37.0 37.0 40-44 36.425799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4085 37.0 37.0 37.0 37.0 37.0 50-54 36.3946 37.0 37.0 37.0 37.0 37.0 55-59 36.3705 37.0 37.0 37.0 37.0 37.0 60-64 36.340599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2642 37.0 37.0 37.0 37.0 37.0 70-74 36.3017 37.0 37.0 37.0 37.0 37.0 75-79 36.285199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3142 37.0 37.0 37.0 37.0 37.0 85-89 36.2259 37.0 37.0 37.0 37.0 37.0 90-94 36.2611 37.0 37.0 37.0 37.0 37.0 95-99 36.216499999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2045 37.0 37.0 37.0 37.0 37.0 105-109 36.224000000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.144800000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.092400000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.034800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.99 37.0 37.0 37.0 37.0 37.0 130-134 35.8964 37.0 37.0 37.0 37.0 37.0 135-139 35.8806 37.0 37.0 37.0 37.0 37.0 140-144 35.669200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.6333 37.0 37.0 37.0 37.0 37.0 150-151 35.386750000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 8.0 26 6.0 27 5.0 28 8.0 29 14.0 30 27.0 31 39.0 32 48.0 33 82.0 34 123.0 35 306.0 36 2865.0 37 464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.775000000000006 11.75 5.525 32.95 2 23.699421965317917 9.75119376727821 33.19929630560443 33.350087961799446 3 21.375 14.725 26.05 37.85 4 25.05 20.9 23.75 30.3 5 27.500000000000004 27.275 22.8 22.425 6 26.575 29.075 20.974999999999998 23.375 7 20.275000000000002 22.875 37.425000000000004 19.425 8 20.375 23.875 29.799999999999997 25.95 9 21.15 20.775 31.424999999999997 26.650000000000002 10-14 23.73 25.19 25.380000000000003 25.7 15-19 24.19 24.060000000000002 24.925 26.825 20-24 24.285 24.69 24.815 26.21 25-29 24.38 24.25 24.97 26.400000000000002 30-34 24.279999999999998 24.6 24.425 26.695 35-39 23.810000000000002 24.610000000000003 24.990000000000002 26.590000000000003 40-44 24.595 24.295 24.85 26.26 45-49 24.805 24.415 23.45 27.33 50-54 23.685000000000002 24.27 25.34 26.705000000000002 55-59 24.645 24.415 24.8 26.14 60-64 25.019999999999996 24.224999999999998 24.005000000000003 26.75 65-69 24.884999999999998 24.815 24.05 26.25 70-74 25.009999999999998 24.925 24.15 25.915 75-79 25.369999999999997 24.45 23.335 26.845000000000002 80-84 25.369999999999997 24.215 24.065 26.35 85-89 25.195 23.77 24.145 26.889999999999997 90-94 25.41 24.235 23.57 26.784999999999997 95-99 25.14 24.279999999999998 23.76 26.82 100-104 25.645 24.215 23.674999999999997 26.465 105-109 25.295 24.525 24.04 26.14 110-114 24.69 24.355 23.985 26.97 115-119 25.380000000000003 23.765 23.925 26.93 120-124 25.165 25.009999999999998 23.145 26.68 125-129 24.83 24.560000000000002 24.22 26.39 130-134 25.36 24.295 22.955000000000002 27.389999999999997 135-139 24.93 24.785 23.39 26.895000000000003 140-144 24.805 24.709999999999997 23.895 26.590000000000003 145-149 24.865000000000002 24.48 23.32 27.334999999999997 150-151 24.575 24.55 23.974999999999998 26.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 1.5 26 1.5 27 1.5 28 1.0 29 2.5 30 4.0 31 11.5 32 12.5 33 13.5 34 24.0 35 27.5 36 42.5 37 55.0 38 56.5 39 86.5 40 105.5 41 117.5 42 145.0 43 163.5 44 160.0 45 162.0 46 182.5 47 181.5 48 184.5 49 182.0 50 162.5 51 135.0 52 131.0 53 130.0 54 110.0 55 92.5 56 96.5 57 102.5 58 81.5 59 65.0 60 62.0 61 72.5 62 70.5 63 70.5 64 70.0 65 69.0 66 74.5 67 73.5 68 66.5 69 51.0 70 46.0 71 40.0 72 38.5 73 36.5 74 33.0 75 30.5 76 20.0 77 14.0 78 8.5 79 5.0 80 3.5 81 3.0 82 2.5 83 1.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.55 #Duplication Level Percentage of deduplicated Percentage of total 1 83.19200484554815 68.675 2 13.567534827377347 22.400000000000002 3 2.57419745608722 6.375 4 0.3331314354936402 1.0999999999999999 5 0.27256208358570566 1.125 6 0.03028467595396729 0.15 7 0.03028467595396729 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCAAACCTGAGACTTTGGCAACGAAATCCCAACGGCGATCACCGAACA 7 0.17500000000000002 No Hit GGACGGGCATCGCGCGATCTCCTCCCCGAGGCGGAGGTCCGCGAGCGTGA 6 0.15 No Hit ATCAACATCTTCGTCTTCGTCTTCATCATCAGAAATTCTGAAATCCTCCA 5 0.125 No Hit CTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCC 5 0.125 No Hit GTCCAGGTCCGGGCACGACGTGTCGTGGAACCCCCACGACAGCCCGGGGG 5 0.125 No Hit GTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTA 5 0.125 No Hit CCACGCAACCCTTTATTCCGACAAACCCTCAGTACGTTGCTTTATTATTA 5 0.125 No Hit GGTGATTGTTCAACATTTGGTGAGCACCTTCCAGCATCGTTCTTCATCGA 5 0.125 No Hit GTCCGGGTAGGCCACGCCGCCGTGATCCGGGTCACGCATCTTGGTGAACA 5 0.125 No Hit GGGTCGGGGCAGGCGGCGGGCGCAGGCGCCGCTTGCTAGCTTGGATTCTG 5 0.125 No Hit CATCATATAACCTTTCAATATCCCGTAGAATGATACATATTGCTACTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.05 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 1.9249999999999998 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 2.8875 0.0 0.0 0.0 0.0 110-111 3.225 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.9875 0.0 0.0 0.0 0.0 116-117 4.324999999999999 0.0 0.0 0.0 0.0 118-119 4.8 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 6.0875 0.0 0.0 0.0 0.0 124-125 6.625 0.0 0.0 0.0 0.0 126-127 7.275 0.0 0.0 0.0 0.0 128-129 7.675000000000001 0.0 0.0 0.0 0.0 130-131 8.2375 0.0 0.0 0.0 0.0 132-133 8.875 0.0 0.0 0.0 0.0 134-135 9.4625 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 10.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACATG 10 0.006830828 145.0 4 AACATGC 10 0.006830828 145.0 5 >>END_MODULE SRR12951310 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951310_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1795 37.0 37.0 37.0 37.0 37.0 2 36.2635 37.0 37.0 37.0 37.0 37.0 3 35.9975 37.0 37.0 37.0 37.0 37.0 4 36.177 37.0 37.0 37.0 37.0 37.0 5 36.292 37.0 37.0 37.0 37.0 37.0 6 36.2025 37.0 37.0 37.0 37.0 37.0 7 36.115 37.0 37.0 37.0 37.0 37.0 8 36.194 37.0 37.0 37.0 37.0 37.0 9 36.1915 37.0 37.0 37.0 37.0 37.0 10-14 36.2239 37.0 37.0 37.0 37.0 37.0 15-19 36.1996 37.0 37.0 37.0 37.0 37.0 20-24 36.1506 37.0 37.0 37.0 37.0 37.0 25-29 36.1057 37.0 37.0 37.0 37.0 37.0 30-34 36.070499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.09759999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.026199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0447 37.0 37.0 37.0 37.0 37.0 50-54 35.974399999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.9384 37.0 37.0 37.0 37.0 37.0 60-64 35.9311 37.0 37.0 37.0 37.0 37.0 65-69 35.8738 37.0 37.0 37.0 37.0 37.0 70-74 35.9476 37.0 37.0 37.0 37.0 37.0 75-79 35.931200000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.85 37.0 37.0 37.0 37.0 37.0 85-89 35.8099 37.0 37.0 37.0 37.0 37.0 90-94 35.8619 37.0 37.0 37.0 37.0 37.0 95-99 35.782500000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.752599999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.750299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7798 37.0 37.0 37.0 37.0 37.0 115-119 35.7643 37.0 37.0 37.0 37.0 37.0 120-124 35.68129999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.636100000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.442899999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.496 37.0 37.0 37.0 37.0 37.0 140-144 35.4476 37.0 37.0 37.0 37.0 37.0 145-149 35.2678 37.0 37.0 37.0 37.0 37.0 150-151 34.992000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 8.0 15 4.0 16 4.0 17 5.0 18 2.0 19 3.0 20 4.0 21 4.0 22 10.0 23 6.0 24 10.0 25 8.0 26 12.0 27 7.0 28 9.0 29 17.0 30 15.0 31 33.0 32 52.0 33 92.0 34 161.0 35 455.0 36 2660.0 37 412.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.175 23.225 6.425 26.174999999999997 2 30.875000000000004 24.3 23.974999999999998 20.849999999999998 3 24.349999999999998 24.75 27.075 23.825 4 26.424999999999997 31.05 19.8 22.725 5 26.924999999999997 31.874999999999996 18.375 22.825 6 24.3 35.0 18.65 22.05 7 24.05 20.349999999999998 30.575000000000003 25.025 8 23.225 22.95 23.200000000000003 30.625000000000004 9 24.474999999999998 21.675 25.575 28.275 10-14 26.32 25.165 22.415 26.1 15-19 26.400000000000002 24.555 23.48 25.564999999999998 20-24 26.21 25.505 23.015 25.27 25-29 26.495 23.86 23.62 26.025 30-34 26.685 24.02 22.85 26.445 35-39 26.27 24.915000000000003 23.205000000000002 25.61 40-44 26.674999999999997 23.345 23.97 26.009999999999998 45-49 26.3 24.205 23.885 25.61 50-54 26.924999999999997 24.490000000000002 23.435 25.15 55-59 27.339999999999996 24.325 23.43 24.905 60-64 26.939999999999998 24.735 23.13 25.195 65-69 27.295 24.47 23.415 24.82 70-74 27.99 24.645 22.875 24.490000000000002 75-79 26.515 24.705 23.57 25.21 80-84 27.529999999999998 24.45 23.21 24.81 85-89 27.339999999999996 24.58 22.314999999999998 25.765 90-94 27.265 24.94 23.185 24.610000000000003 95-99 28.08 24.104999999999997 22.665 25.15 100-104 27.51 23.855 23.305 25.330000000000002 105-109 27.589999999999996 24.48 22.845 25.085 110-114 27.450000000000003 23.845 23.665 25.040000000000003 115-119 27.325 24.46 22.645 25.569999999999997 120-124 27.52 25.05 22.495 24.935 125-129 28.105000000000004 24.87 22.68 24.345 130-134 28.175 24.685000000000002 22.585 24.555 135-139 29.01 25.319999999999997 22.15 23.52 140-144 29.165000000000003 24.825 22.755 23.255 145-149 28.560000000000002 24.545 22.115000000000002 24.779999999999998 150-151 28.9375 24.975 22.2625 23.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 1.0 24 0.0 25 1.5 26 1.5 27 0.5 28 4.5 29 5.0 30 3.0 31 6.5 32 9.5 33 9.5 34 15.5 35 22.5 36 28.5 37 41.5 38 62.5 39 91.0 40 115.0 41 132.5 42 144.0 43 144.5 44 149.5 45 139.5 46 137.5 47 162.5 48 176.5 49 160.0 50 134.5 51 125.5 52 134.5 53 126.5 54 116.0 55 131.5 56 105.0 57 71.5 58 86.5 59 93.5 60 90.5 61 87.5 62 82.0 63 77.5 64 68.0 65 81.0 66 87.5 67 75.0 68 65.0 69 68.5 70 62.5 71 48.5 72 49.0 73 43.0 74 30.5 75 20.0 76 13.5 77 12.5 78 9.5 79 6.0 80 4.0 81 3.0 82 2.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 1.5 98 1.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.05 #Duplication Level Percentage of deduplicated Percentage of total 1 83.80493678506924 69.6 2 13.004214328717639 21.6 3 2.4984948826008426 6.225 4 0.4214328717639976 1.4000000000000001 5 0.2107164358819988 0.8750000000000001 6 0.060204695966285374 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAACAAAGTGCCTAATAACCAACCTTCTTCCGATCAGGCTGGAGTTC 6 0.15 No Hit TCGGGAGCTAGGGTTTACGGCGGGCGGAGATGTCGGCGTACGACGAGGTG 6 0.15 No Hit CATGGTGGTGTGCGCGATGGGACCACCCTCGTGCTGTGGGAGTGGTGCGA 5 0.125 No Hit GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 5 0.125 No Hit GGCAATTGTGACAAGCAGCATGTACTGCATGGGGCGATATGTTTCGGATA 5 0.125 No Hit AAAGATCAAATTTGCAAGATGATCAGCTTAACTCCAACCTTGAGGGCACT 5 0.125 No Hit GCGATAGTAATTCAACCTAGTACGAGAGGAACCGTTGATTCACACAATTG 5 0.125 No Hit GGGAAGCCGTCGACCTCCAGGACGTGCTGCTCCGGCTCACGTTCGACAAC 5 0.125 No Hit CACACGACACTTGGGTCGGTGATTGATCAAGTAGCTAGCTACTCTCGTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.9125000000000001 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2374999999999998 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.7000000000000002 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.3375000000000004 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.324999999999999 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 6.0875 0.0 0.0 0.0 0.0 124-125 6.6625 0.0 0.0 0.0 0.0 126-127 7.325 0.0 0.0 0.0 0.0 128-129 7.7125 0.0 0.0 0.0 0.0 130-131 8.2625 0.0 0.0 0.0 0.0 132-133 8.899999999999999 0.0 0.0 0.0 0.0 134-135 9.5125 0.0 0.0 0.0 0.0 136-137 10.1125 0.0 0.0 0.0 0.0 138-139 10.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619162 spots for SRR12951310.sra Written 1619162 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra Read 1619152 spots for SRR12951310.sra Written 1619152 spots for SRR12951310.sra SRR ids: ['SRR12951310.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ke198jao SRR12951310.sra spots: 32383050 blocks: [[1, 1619152], [1619153, 3238304], [3238305, 4857456], [4857457, 6476608], [6476609, 8095760], [8095761, 9714912], [9714913, 11334064], [11334065, 12953216], [12953217, 14572368], [14572369, 16191520], [16191521, 17810672], [17810673, 19429824], [19429825, 21048976], [21048977, 22668128], [22668129, 24287280], [24287281, 25906432], [25906433, 27525584], [27525585, 29144736], [29144737, 30763888], [30763889, 32383050]] SRR12951310 file size 10983476 SRR12951310 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951310 SRR12951310_1.fastq SRR12951310_2.fastq Input file: SRR12951310_1.fastq Paired file: SRR12951310_2.fastq trimmed: SRR12951310-trimmed-pair1.fastq, SRR12951310-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:24:31 2024 >> started Sat Dec 7 11:25:05 2024 >> done (34.032s) 32383050 read pairs processed; of these: 278 ( 0.00%) short read pairs filtered out after trimming by size control 43523 ( 0.13%) empty read pairs filtered out after trimming by size control 32339249 (99.86%) read pairs available; of these: 4529060 (14.00%) trimmed read pairs available after processing 27810189 (86.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 34 0.00% 20 44 0.00% 21 49 0.00% 22 47 0.00% 23 69 0.00% 24 74 0.00% 25 106 0.00% 26 93 0.00% 27 136 0.00% 28 132 0.00% 29 126 0.00% 30 157 0.00% 31 151 0.00% 32 153 0.00% 33 130 0.00% 34 132 0.00% 35 153 0.00% 36 153 0.00% 37 155 0.00% 38 153 0.00% 39 199 0.00% 40 144 0.00% 41 158 0.00% 42 165 0.00% 43 201 0.00% 44 188 0.00% 45 200 0.00% 46 214 0.00% 47 246 0.00% 48 222 0.00% 49 277 0.00% 50 293 0.00% 51 341 0.00% 52 356 0.00% 53 405 0.00% 54 414 0.00% 55 454 0.00% 56 493 0.00% 57 483 0.00% 58 654 0.00% 59 682 0.00% 60 780 0.00% 61 810 0.00% 62 1007 0.00% 63 1130 0.00% 64 1236 0.00% 65 1339 0.00% 66 1377 0.00% 67 1666 0.01% 68 1838 0.01% 69 2161 0.01% 70 2548 0.01% 71 2795 0.01% 72 3383 0.01% 73 3756 0.01% 74 4102 0.01% 75 4581 0.01% 76 4967 0.02% 77 5444 0.02% 78 5958 0.02% 79 6666 0.02% 80 7469 0.02% 81 8457 0.03% 82 9747 0.03% 83 10888 0.03% 84 11765 0.04% 85 13087 0.04% 86 14004 0.04% 87 15270 0.05% 88 16195 0.05% 89 17694 0.05% 90 18527 0.06% 91 20595 0.06% 92 22275 0.07% 93 24131 0.07% 94 26029 0.08% 95 28083 0.09% 96 29293 0.09% 97 30326 0.09% 98 32400 0.10% 99 33812 0.10% 100 35468 0.11% 101 36855 0.11% 102 39037 0.12% 103 41819 0.13% 104 43523 0.13% 105 45683 0.14% 106 47533 0.15% 107 49176 0.15% 108 50630 0.16% 109 52185 0.16% 110 53832 0.17% 111 56674 0.18% 112 57777 0.18% 113 59765 0.18% 114 63069 0.20% 115 64697 0.20% 116 66913 0.21% 117 68719 0.21% 118 69881 0.22% 119 71294 0.22% 120 72282 0.22% 121 74443 0.23% 122 75923 0.23% 123 77891 0.24% 124 81165 0.25% 125 82213 0.25% 126 84217 0.26% 127 86870 0.27% 128 87638 0.27% 129 88876 0.27% 130 90005 0.28% 131 91493 0.28% 132 92679 0.29% 133 95329 0.29% 134 96347 0.30% 135 98845 0.31% 136 100565 0.31% 137 101895 0.32% 138 102596 0.32% 139 104188 0.32% 140 104430 0.32% 141 105436 0.33% 142 107173 0.33% 143 107832 0.33% 144 109720 0.34% 145 112236 0.35% 146 111511 0.34% 147 112163 0.35% 148 113699 0.35% 149 113299 0.35% 150 114918 0.36% 151 27810189 86.00% 32339249 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.76 fanout-score-rank=26 prefix-density=0.23 prefix-fanout=3.7 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=878.09 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=26.4 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGGGTGTGGGAGATGAAGAGCACCTCGTAAATCACCCCAGCAAGGCCACCGCC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=38 prefix-density=0.61 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=203.27 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=20.8 sequence=CGGCGGCGGCGA SRR12951310 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:26:18 Started mapping on | Dec 07 11:26:19 Finished on | Dec 07 11:29:19 Mapping speed, Million of reads per hour | 646.78 Number of input reads | 32339249 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 30321982 Uniquely mapped reads % | 93.76% Average mapped length | 293.61 Number of splices: Total | 30489796 Number of splices: Annotated (sjdb) | 28614258 Number of splices: GT/AG | 30063046 Number of splices: GC/AG | 359696 Number of splices: AT/AC | 20539 Number of splices: Non-canonical | 46515 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357113 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 76097 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 1.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1660154 1660154 1660154 N_multimapping 357113 357113 357113 N_noFeature 992083 29550387 1232553 N_ambiguous 620246 4009 90518 UnstrandedReadsAssigned:28709653 PositiveStrandReadsAssigned:767586 NegativeStrandReadsAssigned:28998911 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951310 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951310-trimmed-pair1.fastq SRR12951310-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,339,249 reads, 29,499,180 reads pseudoaligned [quant] estimated average fragment length: 261.069 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR12951310.ke.tsv 35125 SRR12951310.se.tsv 88098 total ==> SRR12951310.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.679 0 0 PNS24247 1044 783.931 94.5673 5.74678 PNS24249 1928 1667.93 300.416 8.58037 PNS24246 1044 783.931 94.5673 5.74678 PNS24248 1044 783.931 94.5673 5.74678 PNS24244 1471 1210.93 189.882 7.47009 PNS24243 293 103.716 1 0.459319 KQK14069 1603 1342.93 44188.4 1567.53 KQK14071 474 241.156 592.856 117.115 ==> SRR12951310.se.tsv <== BRADI_1g14170v3 46989 BRADI_1g53295v3 216 BRADI_1g59795v3 656 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 1272 BRADI_1g74790v3 1702 BRADI_1g09890v3 0 BRADI_1g77505v3 378 BRADI_1g48960v3 0 SRR12951310 completed mapping pipeline successfully