Starting /dee2/code/volunteer_pipeline.sh SRR12951315 current disk space = 1543100538880 free memory = 1606729692 SRR12951315 SRAfilesize ae645f8353a8df9a3b7db2869a2d474b SRR12951315.sra SRR12951315.sra file validated SRR12951315 is paired end SRR12951315 is conventional basespace SRR12951315 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951315_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4035 37.0 37.0 37.0 37.0 37.0 2 36.1595 37.0 37.0 37.0 37.0 37.0 3 36.5085 37.0 37.0 37.0 37.0 37.0 4 36.532 37.0 37.0 37.0 37.0 37.0 5 36.6595 37.0 37.0 37.0 37.0 37.0 6 36.584 37.0 37.0 37.0 37.0 37.0 7 36.517 37.0 37.0 37.0 37.0 37.0 8 36.537 37.0 37.0 37.0 37.0 37.0 9 36.536 37.0 37.0 37.0 37.0 37.0 10-14 36.553700000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.485 37.0 37.0 37.0 37.0 37.0 20-24 36.4888 37.0 37.0 37.0 37.0 37.0 25-29 36.4732 37.0 37.0 37.0 37.0 37.0 30-34 36.4572 37.0 37.0 37.0 37.0 37.0 35-39 36.44690000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4587 37.0 37.0 37.0 37.0 37.0 45-49 36.432599999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.364999999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3708 37.0 37.0 37.0 37.0 37.0 60-64 36.3552 37.0 37.0 37.0 37.0 37.0 65-69 36.278999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3387 37.0 37.0 37.0 37.0 37.0 75-79 36.2358 37.0 37.0 37.0 37.0 37.0 80-84 36.2294 37.0 37.0 37.0 37.0 37.0 85-89 36.2603 37.0 37.0 37.0 37.0 37.0 90-94 36.2279 37.0 37.0 37.0 37.0 37.0 95-99 36.152699999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1786 37.0 37.0 37.0 37.0 37.0 105-109 36.193599999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.08540000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1255 37.0 37.0 37.0 37.0 37.0 120-124 36.0307 37.0 37.0 37.0 37.0 37.0 125-129 36.0149 37.0 37.0 37.0 37.0 37.0 130-134 35.9824 37.0 37.0 37.0 37.0 37.0 135-139 35.937599999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8697 37.0 37.0 37.0 37.0 37.0 145-149 35.82919999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.652 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 9.0 27 8.0 28 11.0 29 16.0 30 24.0 31 34.0 32 48.0 33 83.0 34 147.0 35 307.0 36 2850.0 37 459.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.925000000000004 11.125 5.050000000000001 40.9 2 20.567553992968357 10.1958814665997 36.74033149171271 32.49623304871923 3 19.225 13.750000000000002 25.775 41.25 4 24.825 20.349999999999998 22.275 32.550000000000004 5 26.3 25.974999999999998 23.45 24.275 6 24.474999999999998 29.975 21.825 23.724999999999998 7 19.475 24.975 36.975 18.575 8 20.349999999999998 23.724999999999998 27.800000000000004 28.125 9 18.975 22.225 33.15 25.650000000000002 10-14 23.815 26.179999999999996 25.36 24.645 15-19 23.44 24.665 24.945 26.950000000000003 20-24 23.285 24.985 25.124999999999996 26.605 25-29 23.225 25.45 24.610000000000003 26.715 30-34 23.57 25.14 25.115 26.174999999999997 35-39 23.775 25.085 24.84 26.3 40-44 24.125 26.135 24.310000000000002 25.430000000000003 45-49 23.585 25.380000000000003 24.55 26.484999999999996 50-54 23.62 25.31 24.88 26.19 55-59 23.52 25.21 25.005 26.265 60-64 23.69 24.775 25.3 26.235000000000003 65-69 23.785 24.905 24.94 26.369999999999997 70-74 23.825 25.035 24.884999999999998 26.255 75-79 24.065 24.85 24.82 26.265 80-84 24.154999999999998 25.11 24.615000000000002 26.119999999999997 85-89 24.67 24.905 24.905 25.52 90-94 24.415 24.525 24.95 26.11 95-99 24.26 24.805 24.36 26.575 100-104 24.07 26.150000000000002 24.325 25.455 105-109 24.404999999999998 25.52 23.73 26.345000000000002 110-114 24.83 25.240000000000002 24.36 25.569999999999997 115-119 25.66 24.32 24.585 25.435000000000002 120-124 24.935 24.68 24.65 25.735000000000003 125-129 25.085 24.315 24.265 26.334999999999997 130-134 24.415 25.035 24.2 26.35 135-139 24.46 25.595000000000002 23.974999999999998 25.97 140-144 25.014999999999997 25.36 23.46 26.165 145-149 25.080000000000002 24.55 24.855 25.515 150-151 25.2875 25.4625 24.275 24.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 0.5 27 0.5 28 1.0 29 3.0 30 4.0 31 4.0 32 9.5 33 18.5 34 26.0 35 32.0 36 46.5 37 66.0 38 88.5 39 108.5 40 119.0 41 126.5 42 158.5 43 193.5 44 196.5 45 194.0 46 186.5 47 188.5 48 182.0 49 163.0 50 162.0 51 148.5 52 122.5 53 112.5 54 117.5 55 106.5 56 81.5 57 73.0 58 73.0 59 67.5 60 62.0 61 61.5 62 71.5 63 63.5 64 52.0 65 52.5 66 49.5 67 54.5 68 64.0 69 54.0 70 34.0 71 35.5 72 38.0 73 30.5 74 23.5 75 16.5 76 12.5 77 15.0 78 10.0 79 5.5 80 4.5 81 1.0 82 2.0 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.55 #Duplication Level Percentage of deduplicated Percentage of total 1 82.18884120171673 67.025 2 14.193746167995094 23.150000000000002 3 2.6977314530962597 6.6000000000000005 4 0.7050889025137952 2.3 5 0.18393623543838136 0.75 6 0.0 0.0 7 0.030656039239730225 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTTCCGTCCTGGTCAACTTTCCACCAGAAAAGAGCTCATAAATTAAAC 7 0.17500000000000002 No Hit GGGTGTTCTTGGCTTCAACCTTCTTCTTGTGCTCCTCATCCTCAGACTTG 5 0.125 No Hit CCACAAGGAAATCCGATGAATTGCTGATTGGGGGAAATCAACTCTTTACA 5 0.125 No Hit GTCCTGCAGCCATAGCGTGCGGTACACGAGGTCCGACTTGAAGTACTCCG 5 0.125 No Hit ACGGGTTGCAGGTGCAGTTGTCCCCGCACTTGCAGCCTCCGTTCTCGGCT 5 0.125 No Hit GTCGATGTAGAGGACCGCGTCCTGGATGCGGCTGGTGGGGGGCAGCGGGA 5 0.125 No Hit GCCCCCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 5.975 0.0 0.0 0.0 0.0 126-127 6.4375 0.0 0.0 0.0 0.0 128-129 7.074999999999999 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.3875 0.0 0.0 0.0 0.0 134-135 9.0875 0.0 0.0 0.0 0.0 136-137 9.6125 0.0 0.0 0.0 0.0 138-139 9.9125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTATTT 10 0.006830828 145.0 2 >>END_MODULE SRR12951315 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951315_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.278 37.0 37.0 37.0 37.0 37.0 2 36.136 37.0 37.0 37.0 37.0 37.0 3 36.075 37.0 37.0 37.0 37.0 37.0 4 36.1755 37.0 37.0 37.0 37.0 37.0 5 36.3575 37.0 37.0 37.0 37.0 37.0 6 36.2305 37.0 37.0 37.0 37.0 37.0 7 36.2115 37.0 37.0 37.0 37.0 37.0 8 36.332 37.0 37.0 37.0 37.0 37.0 9 36.2485 37.0 37.0 37.0 37.0 37.0 10-14 36.2334 37.0 37.0 37.0 37.0 37.0 15-19 36.221999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.199 37.0 37.0 37.0 37.0 37.0 25-29 36.209 37.0 37.0 37.0 37.0 37.0 30-34 36.169399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1649 37.0 37.0 37.0 37.0 37.0 40-44 36.123099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.08050000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.0469 37.0 37.0 37.0 37.0 37.0 55-59 35.9977 37.0 37.0 37.0 37.0 37.0 60-64 36.0437 37.0 37.0 37.0 37.0 37.0 65-69 36.0043 37.0 37.0 37.0 37.0 37.0 70-74 35.97429999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.9856 37.0 37.0 37.0 37.0 37.0 80-84 35.935300000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9606 37.0 37.0 37.0 37.0 37.0 90-94 35.90630000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8319 37.0 37.0 37.0 37.0 37.0 100-104 35.7687 37.0 37.0 37.0 37.0 37.0 105-109 35.7644 37.0 37.0 37.0 37.0 37.0 110-114 35.7573 37.0 37.0 37.0 37.0 37.0 115-119 35.884 37.0 37.0 37.0 37.0 37.0 120-124 35.6931 37.0 37.0 37.0 37.0 37.0 125-129 35.673899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.599900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.549699999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.46170000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.3248 37.0 37.0 37.0 34.6 37.0 150-151 34.90825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 2.0 16 0.0 17 3.0 18 2.0 19 5.0 20 4.0 21 2.0 22 2.0 23 5.0 24 8.0 25 8.0 26 7.0 27 13.0 28 14.0 29 17.0 30 23.0 31 31.0 32 58.0 33 89.0 34 167.0 35 548.0 36 2676.0 37 310.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 21.224999999999998 7.625 32.725 2 31.25 22.775000000000002 25.95 20.025000000000002 3 20.65 24.8 30.8 23.75 4 24.925 29.25 22.075 23.75 5 27.900000000000002 32.15 19.400000000000002 20.549999999999997 6 23.3 36.225 19.175 21.3 7 23.225 20.849999999999998 33.650000000000006 22.275 8 23.175 22.625 25.3 28.9 9 23.45 21.65 26.900000000000002 28.000000000000004 10-14 25.755 25.155 23.205000000000002 25.885 15-19 26.179999999999996 24.79 23.835 25.195 20-24 26.365 25.324999999999996 23.44 24.87 25-29 25.905 23.965 24.25 25.88 30-34 25.569999999999997 24.62 24.22 25.590000000000003 35-39 26.640000000000004 23.72 24.37 25.27 40-44 25.835 24.085 24.11 25.97 45-49 26.16 24.740000000000002 24.14 24.959999999999997 50-54 26.384999999999998 24.63 23.905 25.080000000000002 55-59 26.31 24.86 23.82 25.009999999999998 60-64 26.015 24.37 24.275 25.34 65-69 26.224999999999998 24.975 24.09 24.709999999999997 70-74 26.534999999999997 24.575 24.240000000000002 24.65 75-79 26.784999999999997 24.07 24.240000000000002 24.905 80-84 26.11 24.21 25.155 24.525 85-89 26.950000000000003 24.335 24.01 24.705 90-94 26.52 24.695 24.125 24.66 95-99 27.35 24.585 24.6 23.465 100-104 26.3 25.224999999999998 23.990000000000002 24.485 105-109 26.584999999999997 25.180000000000003 24.37 23.865 110-114 27.42 24.715 23.724999999999998 24.14 115-119 28.26 24.23 23.74 23.77 120-124 27.865000000000002 24.805 23.95 23.380000000000003 125-129 27.384999999999998 24.555 24.685000000000002 23.375 130-134 28.53 24.975 22.99 23.505000000000003 135-139 28.744999999999997 24.685000000000002 23.630000000000003 22.939999999999998 140-144 28.68 25.564999999999998 22.745 23.01 145-149 29.69 24.29 23.765 22.255 150-151 29.2875 23.9 23.5375 23.275000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 1.5 27 1.5 28 3.0 29 2.5 30 1.5 31 4.0 32 11.5 33 19.5 34 23.5 35 30.5 36 40.0 37 47.0 38 59.5 39 81.0 40 111.5 41 135.0 42 163.0 43 190.5 44 191.5 45 184.5 46 185.0 47 178.0 48 158.0 49 153.5 50 155.5 51 139.5 52 130.5 53 113.0 54 91.0 55 96.5 56 90.0 57 85.0 58 93.5 59 80.0 60 68.0 61 76.0 62 78.5 63 72.5 64 63.5 65 69.0 66 62.5 67 54.5 68 62.5 69 57.5 70 49.5 71 48.0 72 39.0 73 27.0 74 20.0 75 17.5 76 19.5 77 17.0 78 12.0 79 4.0 80 4.0 81 5.0 82 2.5 83 1.5 84 1.0 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.5 99 2.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.65 #Duplication Level Percentage of deduplicated Percentage of total 1 82.73116962645439 67.55 2 13.472137170851195 22.0 3 2.7556644213104717 6.75 4 0.7960808328230252 2.6 5 0.1837109614206981 0.75 6 0.0 0.0 7 0.0612369871402327 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit GTATGCTTGTCCAGTGTAGTTGTTACTCAAACTCTGGACTGGAAGCTTCA 7 0.17500000000000002 No Hit AGAGGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCC 5 0.125 No Hit GGTCCCTCCGCCGCCGCCGCTGACGCCGCGGTCCAAGGGCCGGTCCTGCC 5 0.125 No Hit CTTTTGTGCGTTCTTCTTCTTCTACATCGTTCAATCATGTCGTGCTGCGG 5 0.125 No Hit AGAAGAAGGAGAGCTAGCAGAGCGGCTTCGAGGATGGGCTCCCGCTACGA 5 0.125 No Hit TCTTGGTCTTGAGACTGCTGGTGGAGTTATGACTGTGCTCATCACAAGGA 5 0.125 No Hit CTCCCATTGTTGGGATTCTCACAAGGCACGATCTCATGCCGGAGCATATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 6.012499999999999 0.0 0.0 0.0 0.0 126-127 6.487500000000001 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.5875 0.0 0.0 0.0 0.0 132-133 8.4375 0.0 0.0 0.0 0.0 134-135 9.149999999999999 0.0 0.0 0.0 0.0 136-137 9.712499999999999 0.0 0.0 0.0 0.0 138-139 10.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970201 spots for SRR12951315.sra Written 1970201 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra Read 1970192 spots for SRR12951315.sra Written 1970192 spots for SRR12951315.sra SRR ids: ['SRR12951315.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rrupc66k SRR12951315.sra spots: 39403849 blocks: [[1, 1970192], [1970193, 3940384], [3940385, 5910576], [5910577, 7880768], [7880769, 9850960], [9850961, 11821152], [11821153, 13791344], [13791345, 15761536], [15761537, 17731728], [17731729, 19701920], [19701921, 21672112], [21672113, 23642304], [23642305, 25612496], [25612497, 27582688], [27582689, 29552880], [29552881, 31523072], [31523073, 33493264], [33493265, 35463456], [35463457, 37433648], [37433649, 39403849]] SRR12951315 file size 13369451 SRR12951315 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951315 SRR12951315_1.fastq SRR12951315_2.fastq Input file: SRR12951315_1.fastq Paired file: SRR12951315_2.fastq trimmed: SRR12951315-trimmed-pair1.fastq, SRR12951315-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:37:05 2024 >> started Sat Dec 7 11:37:47 2024 >> done (41.607s) 39403849 read pairs processed; of these: 236 ( 0.00%) short read pairs filtered out after trimming by size control 12823 ( 0.03%) empty read pairs filtered out after trimming by size control 39390790 (99.97%) read pairs available; of these: 5343100 (13.56%) trimmed read pairs available after processing 34047690 (86.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 18 0.00% 20 26 0.00% 21 30 0.00% 22 35 0.00% 23 52 0.00% 24 74 0.00% 25 67 0.00% 26 68 0.00% 27 65 0.00% 28 108 0.00% 29 73 0.00% 30 80 0.00% 31 88 0.00% 32 91 0.00% 33 71 0.00% 34 96 0.00% 35 101 0.00% 36 94 0.00% 37 106 0.00% 38 107 0.00% 39 112 0.00% 40 103 0.00% 41 125 0.00% 42 117 0.00% 43 114 0.00% 44 142 0.00% 45 152 0.00% 46 151 0.00% 47 165 0.00% 48 210 0.00% 49 220 0.00% 50 237 0.00% 51 268 0.00% 52 283 0.00% 53 276 0.00% 54 288 0.00% 55 361 0.00% 56 367 0.00% 57 451 0.00% 58 507 0.00% 59 595 0.00% 60 686 0.00% 61 817 0.00% 62 1002 0.00% 63 975 0.00% 64 1043 0.00% 65 1195 0.00% 66 1326 0.00% 67 1429 0.00% 68 1626 0.00% 69 1914 0.00% 70 2203 0.01% 71 2588 0.01% 72 3036 0.01% 73 3331 0.01% 74 3788 0.01% 75 4100 0.01% 76 4450 0.01% 77 5120 0.01% 78 5615 0.01% 79 6271 0.02% 80 7092 0.02% 81 8322 0.02% 82 9195 0.02% 83 10372 0.03% 84 11534 0.03% 85 12944 0.03% 86 13850 0.04% 87 14915 0.04% 88 16624 0.04% 89 17505 0.04% 90 19293 0.05% 91 21114 0.05% 92 23243 0.06% 93 25168 0.06% 94 27666 0.07% 95 29374 0.07% 96 31785 0.08% 97 32772 0.08% 98 34431 0.09% 99 37161 0.09% 100 38751 0.10% 101 40676 0.10% 102 43419 0.11% 103 46786 0.12% 104 48881 0.12% 105 51540 0.13% 106 53753 0.14% 107 55618 0.14% 108 56852 0.14% 109 59742 0.15% 110 62101 0.16% 111 63885 0.16% 112 67309 0.17% 113 68988 0.18% 114 73006 0.19% 115 75504 0.19% 116 78376 0.20% 117 80102 0.20% 118 82978 0.21% 119 83774 0.21% 120 86325 0.22% 121 88101 0.22% 122 90234 0.23% 123 92912 0.24% 124 97361 0.25% 125 98902 0.25% 126 101791 0.26% 127 103565 0.26% 128 104341 0.26% 129 107353 0.27% 130 108786 0.28% 131 109483 0.28% 132 112877 0.29% 133 114360 0.29% 134 116666 0.30% 135 121443 0.31% 136 122876 0.31% 137 124770 0.32% 138 125323 0.32% 139 126781 0.32% 140 128084 0.33% 141 128750 0.33% 142 131084 0.33% 143 133236 0.34% 144 135334 0.34% 145 137085 0.35% 146 138377 0.35% 147 139141 0.35% 148 139997 0.36% 149 140016 0.36% 150 142118 0.36% 151 34047690 86.44% 39390790 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=7.81 fanout-score-rank=22 prefix-density=0.27 prefix-fanout=4.9 sequence=TGCAGTTGTCGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=5 fanout-score=240.15 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=30.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=223.24 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=22.0 sequence=CGCCGCCGCCGG SRR12951315 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:38:28 Started mapping on | Dec 07 11:38:29 Finished on | Dec 07 11:41:47 Mapping speed, Million of reads per hour | 716.20 Number of input reads | 39390790 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 38015238 Uniquely mapped reads % | 96.51% Average mapped length | 294.31 Number of splices: Total | 36658735 Number of splices: Annotated (sjdb) | 33936470 Number of splices: GT/AG | 36131715 Number of splices: GC/AG | 443367 Number of splices: AT/AC | 22185 Number of splices: Non-canonical | 61468 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394050 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 37491 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 981502 981502 981502 N_multimapping 394050 394050 394050 N_noFeature 1619749 36997403 1938476 N_ambiguous 835038 5334 135760 UnstrandedReadsAssigned:35560451 PositiveStrandReadsAssigned:1012501 NegativeStrandReadsAssigned:35941002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951315 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951315-trimmed-pair1.fastq SRR12951315-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,390,790 reads, 36,252,139 reads pseudoaligned [quant] estimated average fragment length: 260.42 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 SRR12951315.ke.tsv 35125 SRR12951315.se.tsv 88098 total ==> SRR12951315.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.272 0 0 PNS24247 1044 784.58 233.502 12.223 PNS24249 1928 1668.58 422.55 10.4005 PNS24246 1044 784.58 233.502 12.223 PNS24248 1044 784.58 233.502 12.223 PNS24244 1471 1211.58 267.945 9.08276 PNS24243 293 102.997 0 0 KQK14069 1603 1343.58 50324.6 1538.3 KQK14071 474 241.338 255.95 43.5566 ==> SRR12951315.se.tsv <== BRADI_1g14170v3 51382 BRADI_1g53295v3 390 BRADI_1g59795v3 976 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 950 BRADI_1g74790v3 2773 BRADI_1g09890v3 0 BRADI_1g77505v3 369 BRADI_1g48960v3 0 SRR12951315 completed mapping pipeline successfully