Starting /dee2/code/volunteer_pipeline.sh SRR12951316 current disk space = 1543086415872 free memory = 1606548660 SRR12951316 SRAfilesize 1c79b3b7767e29eada29917dcaf0ce40 SRR12951316.sra SRR12951316.sra file validated SRR12951316 is paired end SRR12951316 is conventional basespace SRR12951316 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951316_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5455 37.0 37.0 37.0 37.0 37.0 2 36.21425 37.0 37.0 37.0 37.0 37.0 3 36.525 37.0 37.0 37.0 37.0 37.0 4 36.616 37.0 37.0 37.0 37.0 37.0 5 36.5915 37.0 37.0 37.0 37.0 37.0 6 36.646 37.0 37.0 37.0 37.0 37.0 7 36.4995 37.0 37.0 37.0 37.0 37.0 8 36.534 37.0 37.0 37.0 37.0 37.0 9 36.604 37.0 37.0 37.0 37.0 37.0 10-14 36.5998 37.0 37.0 37.0 37.0 37.0 15-19 36.5886 37.0 37.0 37.0 37.0 37.0 20-24 36.569100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.5034 37.0 37.0 37.0 37.0 37.0 30-34 36.462 37.0 37.0 37.0 37.0 37.0 35-39 36.4649 37.0 37.0 37.0 37.0 37.0 40-44 36.3946 37.0 37.0 37.0 37.0 37.0 45-49 36.374900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.415099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.360699999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.34519999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3131 37.0 37.0 37.0 37.0 37.0 70-74 36.3212 37.0 37.0 37.0 37.0 37.0 75-79 36.3491 37.0 37.0 37.0 37.0 37.0 80-84 36.3081 37.0 37.0 37.0 37.0 37.0 85-89 36.281 37.0 37.0 37.0 37.0 37.0 90-94 36.3289 37.0 37.0 37.0 37.0 37.0 95-99 36.23 37.0 37.0 37.0 37.0 37.0 100-104 36.2842 37.0 37.0 37.0 37.0 37.0 105-109 36.250299999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1991 37.0 37.0 37.0 37.0 37.0 115-119 36.1826 37.0 37.0 37.0 37.0 37.0 120-124 36.1321 37.0 37.0 37.0 37.0 37.0 125-129 36.0634 37.0 37.0 37.0 37.0 37.0 130-134 36.014799999999994 37.0 37.0 37.0 37.0 37.0 135-139 36.05 37.0 37.0 37.0 37.0 37.0 140-144 35.868300000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8502 37.0 37.0 37.0 37.0 37.0 150-151 35.716750000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 1.0 24 4.0 25 3.0 26 3.0 27 4.0 28 8.0 29 20.0 30 24.0 31 43.0 32 47.0 33 65.0 34 126.0 35 274.0 36 2857.0 37 519.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.6 11.65 4.3 38.45 2 20.89927153981412 10.650590303943734 36.67420246169304 31.775935694549105 3 18.95 12.625 27.325 41.099999999999994 4 25.25 20.0 23.1 31.65 5 26.0 26.25 23.175 24.575 6 26.1 31.125000000000004 20.65 22.125 7 20.349999999999998 26.325 35.175 18.15 8 19.375 24.65 30.275000000000002 25.7 9 19.475 20.9 32.875 26.75 10-14 23.080000000000002 26.334999999999997 24.935 25.650000000000002 15-19 23.26 24.895 25.3 26.545 20-24 23.565 25.369999999999997 25.679999999999996 25.385 25-29 23.155 25.369999999999997 25.185000000000002 26.290000000000003 30-34 23.18 25.2 25.19 26.43 35-39 23.835 25.205 24.72 26.240000000000002 40-44 23.325000000000003 25.145 25.330000000000002 26.200000000000003 45-49 23.745 24.85 25.345000000000002 26.06 50-54 23.445 25.009999999999998 25.285000000000004 26.26 55-59 23.169999999999998 25.305 25.045 26.479999999999997 60-64 24.295 24.87 24.745 26.090000000000003 65-69 23.73 24.6 24.795 26.875 70-74 24.37 24.44 25.465 25.724999999999998 75-79 24.14 24.915000000000003 24.245 26.700000000000003 80-84 24.51 24.67 24.905 25.915 85-89 24.39 25.295 24.42 25.895000000000003 90-94 25.1 25.365 23.945 25.590000000000003 95-99 24.69 25.11 24.115000000000002 26.085 100-104 24.395 24.555 24.47 26.58 105-109 25.130000000000003 25.669999999999998 23.794999999999998 25.405 110-114 24.42 25.169999999999998 24.865000000000002 25.545 115-119 23.665 25.724999999999998 24.23 26.38 120-124 25.130000000000003 25.290000000000003 24.305 25.275 125-129 24.685000000000002 24.945 23.66 26.71 130-134 25.130000000000003 25.259999999999998 23.75 25.86 135-139 25.014999999999997 25.66 23.62 25.705 140-144 25.264999999999997 24.955 24.415 25.365 145-149 25.52 23.93 24.709999999999997 25.840000000000003 150-151 24.349999999999998 24.85 24.7875 26.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.5 28 2.5 29 3.5 30 5.5 31 5.5 32 7.0 33 21.0 34 34.0 35 35.5 36 43.0 37 47.0 38 68.5 39 104.5 40 123.0 41 135.5 42 145.0 43 171.0 44 178.5 45 175.0 46 193.0 47 196.5 48 189.5 49 187.5 50 177.0 51 158.0 52 149.5 53 129.0 54 104.5 55 97.5 56 93.5 57 88.0 58 74.5 59 66.0 60 65.5 61 62.0 62 61.5 63 61.5 64 66.0 65 63.0 66 53.5 67 49.5 68 48.5 69 49.0 70 40.0 71 35.0 72 33.5 73 20.0 74 13.0 75 16.0 76 14.0 77 9.5 78 9.0 79 5.5 80 1.0 81 2.5 82 3.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.0 #Duplication Level Percentage of deduplicated Percentage of total 1 82.90123456790124 67.15 2 12.839506172839506 20.8 3 3.148148148148148 7.6499999999999995 4 0.7716049382716049 2.5 5 0.15432098765432098 0.625 6 0.06172839506172839 0.3 7 0.0925925925925926 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.030864197530864196 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTCGGTTATCTCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 18 (97% over 38bp) CCTCAATGACAGTCAGGCCAAATGCTTCGTAGAATGCAGGCTGCACAAAT 7 0.17500000000000002 No Hit CTCACCGGCCTCCTCGCACAGAGACCCCGCAGCCAGGGTCTCCGGGTCCG 7 0.17500000000000002 No Hit CTGTCAAACTTCGCTAACACATGTCAACAGAACATGTGAAATTTCATCTA 7 0.17500000000000002 No Hit CGGTTTAGATTTGGAACTTGTTGGTTGACCTGATGGCAGTTCATTCCTAT 6 0.15 No Hit CACACACAGACACACAGATACATACATACTCACAAGGAAGGATACACCAA 6 0.15 No Hit GGTGTGCTTCCATAGTTGTTTCTCCCGTCTGCTTTTGCAGCTCTTTCGTT 5 0.125 No Hit CTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACT 5 0.125 No Hit GCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGC 5 0.125 No Hit GTCAGTAAGCTTGGTCCTTACATCAAGGGATAGAGTTCTGCAATTACTAG 5 0.125 No Hit ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.9625 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 90-91 1.35 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.9375 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.4625 0.0 0.0 0.0 0.0 100-101 2.75 0.0 0.0 0.0 0.0 102-103 3.2 0.0 0.0 0.0 0.0 104-105 3.6500000000000004 0.0 0.0 0.0 0.0 106-107 3.9875 0.0 0.0 0.0 0.0 108-109 4.65 0.0 0.0 0.0 0.0 110-111 5.325 0.0 0.0 0.0 0.0 112-113 5.824999999999999 0.0 0.0 0.0 0.0 114-115 6.525 0.0 0.0 0.0 0.0 116-117 7.15 0.0 0.0 0.0 0.0 118-119 7.725 0.0 0.0 0.0 0.0 120-121 8.350000000000001 0.0 0.0 0.0 0.0 122-123 9.0 0.0 0.0 0.0 0.0 124-125 9.475 0.0 0.0 0.0 0.0 126-127 10.162500000000001 0.0 0.0 0.0 0.0 128-129 10.837499999999999 0.0 0.0 0.0 0.0 130-131 11.4375 0.0 0.0 0.0 0.0 132-133 12.0 0.0 0.0 0.0 0.0 134-135 13.2625 0.0 0.0 0.0 0.0 136-137 13.912500000000001 0.0 0.0 0.0 0.0 138-139 14.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12951316 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951316_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0805 37.0 37.0 37.0 37.0 37.0 2 35.9295 37.0 37.0 37.0 37.0 37.0 3 36.0635 37.0 37.0 37.0 37.0 37.0 4 36.097 37.0 37.0 37.0 37.0 37.0 5 36.1335 37.0 37.0 37.0 37.0 37.0 6 36.1275 37.0 37.0 37.0 37.0 37.0 7 36.156 37.0 37.0 37.0 37.0 37.0 8 36.0635 37.0 37.0 37.0 37.0 37.0 9 36.174 37.0 37.0 37.0 37.0 37.0 10-14 36.1197 37.0 37.0 37.0 37.0 37.0 15-19 36.1357 37.0 37.0 37.0 37.0 37.0 20-24 36.10680000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.9961 37.0 37.0 37.0 37.0 37.0 30-34 35.9708 37.0 37.0 37.0 37.0 37.0 35-39 35.9641 37.0 37.0 37.0 37.0 37.0 40-44 35.939 37.0 37.0 37.0 37.0 37.0 45-49 35.9944 37.0 37.0 37.0 37.0 37.0 50-54 35.932100000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8173 37.0 37.0 37.0 37.0 37.0 60-64 35.9625 37.0 37.0 37.0 37.0 37.0 65-69 35.9366 37.0 37.0 37.0 37.0 37.0 70-74 35.82340000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.7421 37.0 37.0 37.0 37.0 37.0 80-84 35.677 37.0 37.0 37.0 37.0 37.0 85-89 35.6589 37.0 37.0 37.0 37.0 37.0 90-94 35.7798 37.0 37.0 37.0 37.0 37.0 95-99 35.739 37.0 37.0 37.0 37.0 37.0 100-104 35.681 37.0 37.0 37.0 37.0 37.0 105-109 35.6335 37.0 37.0 37.0 37.0 37.0 110-114 35.6115 37.0 37.0 37.0 37.0 37.0 115-119 35.7055 37.0 37.0 37.0 37.0 37.0 120-124 35.521 37.0 37.0 37.0 37.0 37.0 125-129 35.4462 37.0 37.0 37.0 37.0 37.0 130-134 35.271 37.0 37.0 37.0 34.6 37.0 135-139 35.323100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.2164 37.0 37.0 37.0 34.6 37.0 145-149 34.8987 37.0 37.0 37.0 25.0 37.0 150-151 34.66575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 5.0 15 5.0 16 1.0 17 0.0 18 2.0 19 0.0 20 5.0 21 4.0 22 9.0 23 8.0 24 1.0 25 9.0 26 11.0 27 18.0 28 15.0 29 15.0 30 19.0 31 55.0 32 69.0 33 120.0 34 212.0 35 625.0 36 2526.0 37 261.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.275 23.225 6.875000000000001 29.625 2 29.049999999999997 24.05 26.8 20.1 3 22.225 25.05 30.7 22.025 4 26.075 30.25 20.925 22.75 5 26.700000000000003 32.300000000000004 20.225 20.775 6 24.575 34.825 19.900000000000002 20.7 7 24.725 19.7 33.25 22.325 8 23.549999999999997 20.95 25.650000000000002 29.849999999999998 9 25.825 21.25 27.05 25.874999999999996 10-14 26.619999999999997 25.365 22.830000000000002 25.185000000000002 15-19 25.985000000000003 24.255 24.47 25.290000000000003 20-24 26.26 25.430000000000003 23.65 24.66 25-29 26.155 24.915000000000003 24.104999999999997 24.825 30-34 25.765 24.515 24.505 25.215 35-39 26.25 24.42 24.04 25.290000000000003 40-44 25.995 24.425 24.42 25.16 45-49 25.005 24.93 24.615000000000002 25.45 50-54 25.535000000000004 24.945 25.040000000000003 24.48 55-59 26.19 24.740000000000002 24.185000000000002 24.884999999999998 60-64 27.189999999999998 24.93 24.345 23.535 65-69 26.82 24.035 24.445 24.7 70-74 26.950000000000003 24.82 24.235 23.995 75-79 26.665 25.185000000000002 24.015 24.135 80-84 26.805 24.81 24.135 24.25 85-89 27.215 24.759999999999998 24.044999999999998 23.98 90-94 27.145000000000003 24.605 23.830000000000002 24.42 95-99 27.88 25.045 23.28 23.794999999999998 100-104 27.26 25.480000000000004 23.77 23.49 105-109 27.13 25.09 24.474999999999998 23.305 110-114 28.22 25.035 23.49 23.255 115-119 28.205000000000002 25.205 23.535 23.055 120-124 28.599999999999998 25.055 23.575 22.770000000000003 125-129 28.73 25.005 23.225 23.04 130-134 29.654999999999998 24.404999999999998 23.025000000000002 22.915 135-139 29.995 24.4 24.12 21.485000000000003 140-144 29.925 24.735 23.69 21.65 145-149 30.75 24.279999999999998 23.745 21.224999999999998 150-151 32.0375 23.6875 23.45 20.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 4.5 29 10.5 30 10.0 31 7.5 32 10.0 33 14.5 34 25.5 35 39.0 36 49.0 37 54.0 38 65.0 39 94.0 40 111.0 41 117.5 42 150.0 43 180.5 44 181.0 45 177.0 46 182.0 47 193.0 48 183.5 49 164.5 50 134.5 51 126.5 52 134.5 53 121.0 54 110.5 55 94.0 56 81.5 57 79.5 58 82.0 59 82.5 60 74.0 61 58.5 62 67.0 63 67.0 64 60.5 65 66.5 66 56.5 67 55.5 68 63.5 69 60.5 70 51.5 71 43.5 72 42.0 73 35.5 74 30.5 75 25.0 76 12.0 77 6.5 78 5.5 79 3.5 80 2.5 81 3.0 82 1.5 83 1.5 84 1.5 85 1.5 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 1.5 95 1.0 96 1.0 97 1.0 98 2.0 99 4.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.375 #Duplication Level Percentage of deduplicated Percentage of total 1 84.15781487101668 69.325 2 12.018209408194233 19.8 3 2.7010622154779966 6.675000000000001 4 0.8497723823975721 2.8000000000000003 5 0.09104704097116845 0.375 6 0.06069802731411229 0.3 7 0.09104704097116845 0.525 8 0.030349013657056147 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CCTCGACCGTGTAAAGAACATGACAGGCTTGGTTGAGATGTATGGCAAGA 7 0.17500000000000002 No Hit AGGCCAGTCTGGTGGAAATGGGGAAGCAAGAGGCTTCTCTACGAAGTACT 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 7 0.17500000000000002 No Hit ATCGCCGCGCAAGTCCGTCGACCTCGACTACCCGTCCCCGTCGCCGACCC 6 0.15 No Hit CAATAAGGGAAGGCTGATAGGGTTGCTGAGAATGTGGGGGACCAATTCAC 6 0.15 No Hit GTTTTCTCTTATCTCTTCTTCGATTCGATATTCCATTGGTGATTAGAGAA 5 0.125 No Hit GACTTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACT 5 0.125 No Hit CTTTTACCCAACCCTCCTCCTCTCCGGACTCCGGCCAGCCGCCCTCGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 90-91 1.3 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.8875 0.0 0.0 0.0 0.0 96-97 2.0875 0.0 0.0 0.0 0.0 98-99 2.4125 0.0 0.0 0.0 0.0 100-101 2.7 0.0 0.0 0.0 0.0 102-103 3.1375 0.0 0.0 0.0 0.0 104-105 3.5875 0.0 0.0 0.0 0.0 106-107 3.9375 0.0 0.0 0.0 0.0 108-109 4.625 0.0 0.0 0.0 0.0 110-111 5.3 0.0 0.0 0.0 0.0 112-113 5.7875 0.0 0.0 0.0 0.0 114-115 6.475 0.0 0.0 0.0 0.0 116-117 7.1 0.0 0.0 0.0 0.0 118-119 7.6625 0.0 0.0 0.0 0.0 120-121 8.3 0.0 0.0 0.0 0.0 122-123 8.95 0.0 0.0 0.0 0.0 124-125 9.425 0.0 0.0 0.0 0.0 126-127 10.1125 0.0 0.0 0.0 0.0 128-129 10.787500000000001 0.0 0.0 0.0 0.0 130-131 11.4 0.0 0.0 0.0 0.0 132-133 11.95 0.0 0.0 0.0 0.0 134-135 13.2375 0.0 0.0 0.0 0.0 136-137 13.95 0.0 0.0 0.0 0.0 138-139 14.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTAC 10 0.006830828 145.0 1 CACTGCT 10 0.006830828 145.0 9 CAAGGGA 10 0.006830828 145.0 3 CCAAGGG 10 0.006830828 145.0 2 >>END_MODULE Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698312 spots for SRR12951316.sra Written 1698312 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra Read 1698293 spots for SRR12951316.sra Written 1698293 spots for SRR12951316.sra SRR ids: ['SRR12951316.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j5ei7gil SRR12951316.sra spots: 33965879 blocks: [[1, 1698293], [1698294, 3396586], [3396587, 5094879], [5094880, 6793172], [6793173, 8491465], [8491466, 10189758], [10189759, 11888051], [11888052, 13586344], [13586345, 15284637], [15284638, 16982930], [16982931, 18681223], [18681224, 20379516], [20379517, 22077809], [22077810, 23776102], [23776103, 25474395], [25474396, 27172688], [27172689, 28870981], [28870982, 30569274], [30569275, 32267567], [32267568, 33965879]] SRR12951316 file size 11521391 SRR12951316 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951316 SRR12951316_1.fastq SRR12951316_2.fastq Input file: SRR12951316_1.fastq Paired file: SRR12951316_2.fastq trimmed: SRR12951316-trimmed-pair1.fastq, SRR12951316-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:38:23 2024 >> started Sat Dec 7 11:39:12 2024 >> done (48.647s) 33965879 read pairs processed; of these: 271 ( 0.00%) short read pairs filtered out after trimming by size control 86773 ( 0.26%) empty read pairs filtered out after trimming by size control 33878835 (99.74%) read pairs available; of these: 6468145 (19.09%) trimmed read pairs available after processing 27410690 (80.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 21 0.00% 20 33 0.00% 21 41 0.00% 22 38 0.00% 23 51 0.00% 24 63 0.00% 25 79 0.00% 26 86 0.00% 27 105 0.00% 28 97 0.00% 29 124 0.00% 30 123 0.00% 31 95 0.00% 32 131 0.00% 33 115 0.00% 34 138 0.00% 35 126 0.00% 36 148 0.00% 37 123 0.00% 38 154 0.00% 39 171 0.00% 40 160 0.00% 41 190 0.00% 42 179 0.00% 43 174 0.00% 44 168 0.00% 45 218 0.00% 46 221 0.00% 47 252 0.00% 48 274 0.00% 49 361 0.00% 50 394 0.00% 51 486 0.00% 52 498 0.00% 53 541 0.00% 54 598 0.00% 55 669 0.00% 56 679 0.00% 57 774 0.00% 58 1015 0.00% 59 1132 0.00% 60 1364 0.00% 61 1529 0.00% 62 1782 0.01% 63 2052 0.01% 64 2257 0.01% 65 2354 0.01% 66 2642 0.01% 67 2977 0.01% 68 3306 0.01% 69 3922 0.01% 70 4536 0.01% 71 5494 0.02% 72 6265 0.02% 73 7024 0.02% 74 7638 0.02% 75 8915 0.03% 76 9646 0.03% 77 10427 0.03% 78 11253 0.03% 79 12884 0.04% 80 14211 0.04% 81 16337 0.05% 82 18064 0.05% 83 20307 0.06% 84 22273 0.07% 85 24635 0.07% 86 26419 0.08% 87 28384 0.08% 88 30116 0.09% 89 31656 0.09% 90 34195 0.10% 91 36544 0.11% 92 39280 0.12% 93 43484 0.13% 94 45989 0.14% 95 48061 0.14% 96 50837 0.15% 97 52836 0.16% 98 54834 0.16% 99 57420 0.17% 100 59331 0.18% 101 61266 0.18% 102 64238 0.19% 103 67607 0.20% 104 70533 0.21% 105 72892 0.22% 106 76751 0.23% 107 78212 0.23% 108 78858 0.23% 109 81205 0.24% 110 81978 0.24% 111 85994 0.25% 112 88329 0.26% 113 90471 0.27% 114 95719 0.28% 115 98352 0.29% 116 100562 0.30% 117 100803 0.30% 118 103256 0.30% 119 104822 0.31% 120 106420 0.31% 121 107028 0.32% 122 109161 0.32% 123 113148 0.33% 124 115654 0.34% 125 116940 0.35% 126 119476 0.35% 127 121248 0.36% 128 121351 0.36% 129 123366 0.36% 130 122643 0.36% 131 123215 0.36% 132 126989 0.37% 133 128058 0.38% 134 127851 0.38% 135 131727 0.39% 136 133722 0.39% 137 133337 0.39% 138 133142 0.39% 139 135895 0.40% 140 137098 0.40% 141 137296 0.41% 142 138676 0.41% 143 137533 0.41% 144 140425 0.41% 145 141026 0.42% 146 141173 0.42% 147 141593 0.42% 148 142450 0.42% 149 141312 0.42% 150 142806 0.42% 151 27410690 80.91% 33878835 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=2.4 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=341.39 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=33.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=34 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=180.82 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.0 sequence=ACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGAAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCCCATTACGAGTTCTATCAGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTCCGGTGAGCCGCGCCATGGAATCGGGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCG SRR12951316 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:39:49 Started mapping on | Dec 07 11:39:49 Finished on | Dec 07 11:42:37 Mapping speed, Million of reads per hour | 725.98 Number of input reads | 33878835 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 30935689 Uniquely mapped reads % | 91.31% Average mapped length | 290.68 Number of splices: Total | 29642388 Number of splices: Annotated (sjdb) | 27376579 Number of splices: GT/AG | 29194876 Number of splices: GC/AG | 391187 Number of splices: AT/AC | 19778 Number of splices: Non-canonical | 36547 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291714 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 329337 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 4.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2651432 2651432 2651432 N_multimapping 291714 291714 291714 N_noFeature 1578402 30036983 1882578 N_ambiguous 699213 4179 104101 UnstrandedReadsAssigned:28658074 PositiveStrandReadsAssigned:894527 NegativeStrandReadsAssigned:28949010 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951316 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951316-trimmed-pair1.fastq SRR12951316-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,878,835 reads, 29,319,553 reads pseudoaligned [quant] estimated average fragment length: 245.004 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR12951316.ke.tsv 35125 SRR12951316.se.tsv 88098 total ==> SRR12951316.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.621 0 0 PNS24247 1044 799.996 216.652 13.7965 PNS24249 1928 1684 422.273 12.7746 PNS24246 1044 799.996 216.652 13.7965 PNS24248 1044 799.996 216.652 13.7965 PNS24244 1471 1227 270.772 11.2423 PNS24243 293 112.106 0 0 KQK14069 1603 1359 67017.2 2512.25 KQK14071 474 254.26 1278.58 256.18 ==> SRR12951316.se.tsv <== BRADI_1g14170v3 72044 BRADI_1g53295v3 338 BRADI_1g59795v3 1359 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 768 BRADI_1g74790v3 2120 BRADI_1g09890v3 0 BRADI_1g77505v3 379 BRADI_1g48960v3 0 SRR12951316 completed mapping pipeline successfully