Starting /dee2/code/volunteer_pipeline.sh SRR12951317 current disk space = 1543067123712 free memory = 1606547456 SRR12951317 SRAfilesize fa34089a4065953b6d3df69169c13282 SRR12951317.sra SRR12951317.sra file validated SRR12951317 is paired end SRR12951317 is conventional basespace SRR12951317 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951317_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.63 37.0 37.0 37.0 37.0 37.0 2 36.287 37.0 37.0 37.0 37.0 37.0 3 36.52 37.0 37.0 37.0 37.0 37.0 4 36.644 37.0 37.0 37.0 37.0 37.0 5 36.635 37.0 37.0 37.0 37.0 37.0 6 36.57 37.0 37.0 37.0 37.0 37.0 7 36.5605 37.0 37.0 37.0 37.0 37.0 8 36.598 37.0 37.0 37.0 37.0 37.0 9 36.514 37.0 37.0 37.0 37.0 37.0 10-14 36.644400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.566700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.592 37.0 37.0 37.0 37.0 37.0 25-29 36.543699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.6038 37.0 37.0 37.0 37.0 37.0 35-39 36.524699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4893 37.0 37.0 37.0 37.0 37.0 45-49 36.470600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4683 37.0 37.0 37.0 37.0 37.0 55-59 36.455200000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3788 37.0 37.0 37.0 37.0 37.0 65-69 36.3936 37.0 37.0 37.0 37.0 37.0 70-74 36.3962 37.0 37.0 37.0 37.0 37.0 75-79 36.3617 37.0 37.0 37.0 37.0 37.0 80-84 36.400600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.349599999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.3756 37.0 37.0 37.0 37.0 37.0 95-99 36.331900000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.3728 37.0 37.0 37.0 37.0 37.0 105-109 36.2971 37.0 37.0 37.0 37.0 37.0 110-114 36.2736 37.0 37.0 37.0 37.0 37.0 115-119 36.3318 37.0 37.0 37.0 37.0 37.0 120-124 36.197500000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.12220000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.14790000000001 37.0 37.0 37.0 37.0 37.0 135-139 36.050700000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.9581 37.0 37.0 37.0 37.0 37.0 145-149 35.893 37.0 37.0 37.0 37.0 37.0 150-151 35.62525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 5.0 26 4.0 27 5.0 28 9.0 29 8.0 30 23.0 31 29.0 32 36.0 33 64.0 34 121.0 35 252.0 36 2889.0 37 553.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.300000000000004 11.1 3.85 38.75 2 21.715145436308926 10.832497492477431 36.73520561685055 30.71715145436309 3 19.825 14.674999999999999 27.55 37.95 4 25.275 21.25 22.175 31.3 5 25.45 27.275 23.325000000000003 23.95 6 24.75 31.324999999999996 22.725 21.2 7 18.925 23.375 38.4 19.3 8 19.25 23.35 30.55 26.85 9 19.075 22.35 33.4 25.174999999999997 10-14 23.494999999999997 26.669999999999998 24.675 25.16 15-19 23.485 25.215 25.374999999999996 25.924999999999997 20-24 22.93 25.624999999999996 25.15 26.295 25-29 23.16 25.424999999999997 25.785000000000004 25.629999999999995 30-34 23.275000000000002 24.855 25.255 26.615 35-39 23.11 25.369999999999997 25.119999999999997 26.400000000000002 40-44 23.34 25.180000000000003 25.31 26.169999999999998 45-49 23.28 25.245 24.990000000000002 26.484999999999996 50-54 23.325000000000003 25.855 24.815 26.005 55-59 23.875 25.155 24.84 26.13 60-64 23.724999999999998 25.28 25.080000000000002 25.915 65-69 23.465 25.074999999999996 25.1 26.36 70-74 23.54 25.39 24.85 26.22 75-79 24.89 25.445 23.830000000000002 25.835 80-84 23.535 25.080000000000002 25.415 25.97 85-89 24.565 25.83 23.54 26.064999999999998 90-94 24.85 25.245 24.4 25.505 95-99 24.7 25.525 24.12 25.655 100-104 24.104999999999997 25.36 24.610000000000003 25.924999999999997 105-109 24.445 25.36 24.345 25.85 110-114 24.395 25.53 23.925 26.150000000000002 115-119 24.27 25.595000000000002 23.89 26.245 120-124 24.145 25.825 23.45 26.58 125-129 24.66 24.93 23.995 26.415 130-134 24.13 25.915 22.98 26.974999999999998 135-139 23.990000000000002 25.885 23.605 26.52 140-144 24.095 25.71 23.3 26.895000000000003 145-149 24.205 26.075 23.56 26.16 150-151 23.825 25.174999999999997 24.1375 26.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 5.5 29 7.0 30 6.0 31 11.0 32 14.5 33 18.5 34 28.5 35 36.0 36 42.5 37 47.5 38 61.5 39 88.0 40 113.0 41 127.0 42 156.0 43 203.0 44 220.5 45 224.0 46 198.0 47 176.5 48 170.0 49 157.5 50 159.0 51 150.0 52 131.5 53 120.0 54 121.0 55 115.5 56 104.0 57 96.0 58 83.0 59 74.5 60 66.5 61 52.5 62 47.0 63 56.0 64 64.0 65 60.5 66 55.5 67 45.5 68 41.5 69 41.5 70 36.5 71 34.0 72 27.5 73 24.5 74 22.5 75 13.0 76 13.0 77 12.5 78 5.0 79 2.5 80 2.0 81 1.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 82.74377114733929 67.25 2 13.288219009535526 21.6 3 2.829898492771455 6.9 4 0.7382343894186404 2.4 5 0.27683789603199016 1.125 6 0.030759766225776686 0.15 7 0.030759766225776686 0.17500000000000002 8 0.06151953245155337 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTTCTTCTGGTAGTTTAGCCTTCTTAAGCAGCCTACCGAGTTTAACCTC 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCAACATCTCGTAT 8 0.2 TruSeq Adapter, Index 5 (97% over 37bp) GTCACACCAATTTCACGGATCCATTACAGAAAGCAAACACCACAATTATC 7 0.17500000000000002 No Hit ATTAGCCCAGCTGTTTCCTCGTAAACTTGAATTGTAGCTGAATCGCCCTC 6 0.15 No Hit GCACCAGCACAGACACCAGCAGTGTAATCACCTTCATCCCCTTCTTGAGT 5 0.125 No Hit ATCACGGCGTATGGGAATACCACGGCACTCATCGGAACGACCATTGTATC 5 0.125 No Hit GGCCAGTCATAGCATATTCTGGAGCATGATATCCAAATGTTCCTAATACA 5 0.125 No Hit CATACATATAGTTTACATATGAAACTGAACACACAGCGCACTTGCAAACA 5 0.125 No Hit CTCTTGATGTGGTAGATGGTGAGCCCATCCGAGTTCATCAGCTTCAGGAT 5 0.125 No Hit ACCTGCTCGCCGCCGCCCTTCGCCGCCATCGCGCGCGCTCCCCAACTCAC 5 0.125 No Hit CCTCGACCGATTAGTACTGGTCAGCTCCATGCATTGCTGCACTTCCACCC 5 0.125 No Hit GCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCC 5 0.125 No Hit CAGGCATTGTGGAAACTACTAAACACCAATTCAGTTCTATAGCACGAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.1375 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2125 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.325 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.5375000000000001 0.0 0.0 0.0 0.0 76-77 0.5874999999999999 0.0 0.0 0.0 0.0 78-79 0.7 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.3375 0.0 0.0 0.0 0.0 84-85 1.5125000000000002 0.0 0.0 0.0 0.0 86-87 1.7875 0.0 0.0 0.0 0.0 88-89 2.1500000000000004 0.0 0.0 0.0 0.0 90-91 2.4124999999999996 0.0 0.0 0.0 0.0 92-93 2.7 0.0 0.0 0.0 0.0 94-95 2.9375 0.0 0.0 0.0 0.0 96-97 3.2625 0.0 0.0 0.0 0.0 98-99 3.675 0.0 0.0 0.0 0.0 100-101 4.125 0.0 0.0 0.0 0.0 102-103 4.45 0.0 0.0 0.0 0.0 104-105 4.9 0.0 0.0 0.0 0.0 106-107 5.887499999999999 0.0 0.0 0.0 0.0 108-109 6.4625 0.0 0.0 0.0 0.0 110-111 7.0375 0.0 0.0 0.0 0.0 112-113 7.6875 0.0 0.0 0.0 0.0 114-115 8.1875 0.0 0.0 0.0 0.0 116-117 8.75 0.0 0.0 0.0 0.0 118-119 9.45 0.0 0.0 0.0 0.0 120-121 10.1875 0.0 0.0 0.0 0.0 122-123 10.9875 0.0 0.0 0.0 0.0 124-125 11.9875 0.0 0.0 0.0 0.0 126-127 12.600000000000001 0.0 0.0 0.0 0.0 128-129 13.25 0.0 0.0 0.0 0.0 130-131 14.275 0.0 0.0 0.0 0.0 132-133 15.100000000000001 0.0 0.0 0.0 0.0 134-135 16.0875 0.0 0.0 0.0 0.0 136-137 16.8875 0.0 0.0 0.0 0.0 138-139 17.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACGAC 10 0.006830828 145.0 5 GCCAATT 10 0.006830828 145.0 1 AAAAAAA 150 2.0670056E-4 9.666667 130-134 >>END_MODULE SRR12951317 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951317_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2425 37.0 37.0 37.0 37.0 37.0 2 36.2135 37.0 37.0 37.0 37.0 37.0 3 36.1995 37.0 37.0 37.0 37.0 37.0 4 36.2245 37.0 37.0 37.0 37.0 37.0 5 36.386 37.0 37.0 37.0 37.0 37.0 6 36.305 37.0 37.0 37.0 37.0 37.0 7 36.398 37.0 37.0 37.0 37.0 37.0 8 36.282 37.0 37.0 37.0 37.0 37.0 9 36.36 37.0 37.0 37.0 37.0 37.0 10-14 36.318200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2922 37.0 37.0 37.0 37.0 37.0 20-24 36.267999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2088 37.0 37.0 37.0 37.0 37.0 30-34 36.1753 37.0 37.0 37.0 37.0 37.0 35-39 36.1149 37.0 37.0 37.0 37.0 37.0 40-44 36.1715 37.0 37.0 37.0 37.0 37.0 45-49 36.1442 37.0 37.0 37.0 37.0 37.0 50-54 36.1064 37.0 37.0 37.0 37.0 37.0 55-59 36.0834 37.0 37.0 37.0 37.0 37.0 60-64 36.052099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.041999999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.02120000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.9902 37.0 37.0 37.0 37.0 37.0 80-84 35.9494 37.0 37.0 37.0 37.0 37.0 85-89 35.9102 37.0 37.0 37.0 37.0 37.0 90-94 35.968 37.0 37.0 37.0 37.0 37.0 95-99 35.923199999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.900999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7721 37.0 37.0 37.0 37.0 37.0 110-114 35.7744 37.0 37.0 37.0 37.0 37.0 115-119 35.8318 37.0 37.0 37.0 37.0 37.0 120-124 35.72160000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.5596 37.0 37.0 37.0 37.0 37.0 130-134 35.464800000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.3692 37.0 37.0 37.0 37.0 37.0 140-144 35.268899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.0009 37.0 37.0 37.0 27.4 37.0 150-151 34.716750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 3.0 16 3.0 17 1.0 18 1.0 19 2.0 20 4.0 21 3.0 22 7.0 23 2.0 24 5.0 25 4.0 26 8.0 27 10.0 28 16.0 29 20.0 30 22.0 31 25.0 32 52.0 33 99.0 34 192.0 35 556.0 36 2640.0 37 319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.175000000000004 24.5 5.975 27.35 2 28.725 22.775000000000002 28.675 19.825 3 22.75 24.975 30.7 21.575 4 25.275 31.95 20.75 22.025 5 27.950000000000003 32.800000000000004 18.95 20.3 6 25.1 35.4 19.175 20.325 7 25.3 20.150000000000002 33.300000000000004 21.25 8 25.0 22.425 25.374999999999996 27.200000000000003 9 21.925 22.55 29.075 26.450000000000003 10-14 26.56 24.81 23.51 25.119999999999997 15-19 26.195 25.395 23.27 25.14 20-24 26.090000000000003 25.374999999999996 24.185000000000002 24.349999999999998 25-29 26.240000000000002 24.915000000000003 24.005000000000003 24.84 30-34 26.575 24.94 23.985 24.5 35-39 25.369999999999997 25.019999999999996 24.65 24.959999999999997 40-44 26.625 25.27 23.549999999999997 24.555 45-49 26.705000000000002 25.105 24.085 24.104999999999997 50-54 26.700000000000003 25.145 24.37 23.785 55-59 26.41 24.85 24.79 23.95 60-64 26.474999999999998 24.86 24.65 24.015 65-69 26.66 25.369999999999997 24.175 23.794999999999998 70-74 26.314999999999998 24.23 25.009999999999998 24.445 75-79 27.284999999999997 24.39 24.52 23.805 80-84 25.605 25.715 24.72 23.96 85-89 26.979999999999997 24.755 24.12 24.145 90-94 27.445000000000004 25.040000000000003 23.77 23.745 95-99 26.795 25.09 24.04 24.075 100-104 27.834999999999997 24.709999999999997 23.95 23.505000000000003 105-109 27.884999999999998 25.15 23.89 23.075000000000003 110-114 27.794999999999998 25.374999999999996 23.845 22.985 115-119 28.465 25.25 23.62 22.665 120-124 27.375 25.205 24.3 23.119999999999997 125-129 29.2 25.095 23.150000000000002 22.555 130-134 29.509999999999998 26.150000000000002 22.54 21.8 135-139 29.549999999999997 25.679999999999996 22.925 21.845 140-144 30.570000000000004 26.040000000000003 22.58 20.810000000000002 145-149 30.73 26.0 21.52 21.75 150-151 32.6 24.2625 22.325 20.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.0 27 3.5 28 3.0 29 4.0 30 10.5 31 11.5 32 11.0 33 14.0 34 16.5 35 29.5 36 49.5 37 55.5 38 78.5 39 107.0 40 125.0 41 142.5 42 156.0 43 164.0 44 177.5 45 193.0 46 175.0 47 180.0 48 170.5 49 139.5 50 150.5 51 140.0 52 124.0 53 121.0 54 111.5 55 107.0 56 98.0 57 86.5 58 89.0 59 93.5 60 79.5 61 67.0 62 65.0 63 64.0 64 65.5 65 63.0 66 56.0 67 50.0 68 47.5 69 44.0 70 46.5 71 45.0 72 32.5 73 26.5 74 20.5 75 15.5 76 11.0 77 9.5 78 9.0 79 7.0 80 5.5 81 3.5 82 2.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.5 98 3.5 99 5.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.625 #Duplication Level Percentage of deduplicated Percentage of total 1 82.94027565084227 67.7 2 13.200612557427258 21.55 3 2.7258805513016844 6.675000000000001 4 0.8269525267993875 2.7 5 0.21439509954058195 0.8750000000000001 6 0.030627871362940276 0.15 7 0.06125574272588055 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTACATTTCACAGTGTACTAGATCCAACAAAGACATGTGGCTACGTTTC 7 0.17500000000000002 No Hit TGAAGGTGCCACCAAGTTCCTTCTTAGCAAGATCAAGGACCTTCAGTTCT 7 0.17500000000000002 No Hit CAGATCGAGCCAGAGACCCGTCTCACATCTCCTCTCCTCTCTTCTCCCCT 6 0.15 No Hit AGATGCTCAAACGGGCCTGACATCAACGCTCAACAGCTGGAACTAACCAG 5 0.125 No Hit CGGACAGGGCGACTCCCAAGGGGATCCTGAAGCTGATGAACTCGGATGGG 5 0.125 No Hit CCGGTTAGCATTAAGAGTCTTGCAGGAAGCTTCGCGACACTAGCCAACTG 5 0.125 No Hit ATGGGAGACAAGCGGCAATCAAGAAATTTGATGCATCAGAAAATGAGCCT 5 0.125 No Hit GTTCAGGATTATAGCTGTGCAGATGTCAGTGGTGGTTCTCAAAATGAGTC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GAACAGTTTTGTCTGCTGTTTGGTTGTGATGATGAAAACTGTGAGCGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.1375 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.23750000000000002 0.0 0.0 0.0 0.0 64-65 0.2875 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.5375000000000001 0.0 0.0 0.0 0.0 76-77 0.5874999999999999 0.0 0.0 0.0 0.0 78-79 0.7 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.3375 0.0 0.0 0.0 0.0 84-85 1.5125000000000002 0.0 0.0 0.0 0.0 86-87 1.7875 0.0 0.0 0.0 0.0 88-89 2.1500000000000004 0.0 0.0 0.0 0.0 90-91 2.4124999999999996 0.0 0.0 0.0 0.0 92-93 2.7 0.0 0.0 0.0 0.0 94-95 2.9375 0.0 0.0 0.0 0.0 96-97 3.2625 0.0 0.0 0.0 0.0 98-99 3.675 0.0 0.0 0.0 0.0 100-101 4.125 0.0 0.0 0.0 0.0 102-103 4.45 0.0 0.0 0.0 0.0 104-105 4.925000000000001 0.0 0.0 0.0 0.0 106-107 5.9125 0.0 0.0 0.0 0.0 108-109 6.487500000000001 0.0 0.0 0.0 0.0 110-111 7.0625 0.0 0.0 0.0 0.0 112-113 7.7125 0.0 0.0 0.0 0.0 114-115 8.2 0.0 0.0 0.0 0.0 116-117 8.75 0.0 0.0 0.0 0.0 118-119 9.5 0.0 0.0 0.0 0.0 120-121 10.2375 0.0 0.0 0.0 0.0 122-123 11.024999999999999 0.0 0.0 0.0 0.0 124-125 12.024999999999999 0.0 0.0 0.0 0.0 126-127 12.6375 0.0 0.0 0.0 0.0 128-129 13.2625 0.0 0.0 0.0 0.0 130-131 14.2625 0.0 0.0 0.0 0.0 132-133 15.100000000000001 0.0 0.0 0.0 0.0 134-135 16.075 0.0 0.0 0.0 0.0 136-137 16.8625 0.0 0.0 0.0 0.0 138-139 17.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117104 spots for SRR12951317.sra Written 1117104 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra Read 1117096 spots for SRR12951317.sra Written 1117096 spots for SRR12951317.sra SRR ids: ['SRR12951317.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k3ambfey SRR12951317.sra spots: 22341928 blocks: [[1, 1117096], [1117097, 2234192], [2234193, 3351288], [3351289, 4468384], [4468385, 5585480], [5585481, 6702576], [6702577, 7819672], [7819673, 8936768], [8936769, 10053864], [10053865, 11170960], [11170961, 12288056], [12288057, 13405152], [13405153, 14522248], [14522249, 15639344], [15639345, 16756440], [16756441, 17873536], [17873537, 18990632], [18990633, 20107728], [20107729, 21224824], [21224825, 22341928]] SRR12951317 file size 7571064 SRR12951317 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951317 SRR12951317_1.fastq SRR12951317_2.fastq Input file: SRR12951317_1.fastq Paired file: SRR12951317_2.fastq trimmed: SRR12951317-trimmed-pair1.fastq, SRR12951317-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:38:15 2024 >> started Sat Dec 7 11:39:07 2024 >> done (51.220s) 22341928 read pairs processed; of these: 290 ( 0.00%) short read pairs filtered out after trimming by size control 73769 ( 0.33%) empty read pairs filtered out after trimming by size control 22267869 (99.67%) read pairs available; of these: 4813652 (21.62%) trimmed read pairs available after processing 17454217 (78.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 27 0.00% 20 40 0.00% 21 46 0.00% 22 74 0.00% 23 89 0.00% 24 105 0.00% 25 109 0.00% 26 137 0.00% 27 118 0.00% 28 142 0.00% 29 154 0.00% 30 155 0.00% 31 137 0.00% 32 170 0.00% 33 161 0.00% 34 166 0.00% 35 154 0.00% 36 178 0.00% 37 173 0.00% 38 191 0.00% 39 182 0.00% 40 180 0.00% 41 200 0.00% 42 204 0.00% 43 219 0.00% 44 236 0.00% 45 241 0.00% 46 308 0.00% 47 316 0.00% 48 340 0.00% 49 378 0.00% 50 488 0.00% 51 501 0.00% 52 525 0.00% 53 609 0.00% 54 650 0.00% 55 743 0.00% 56 840 0.00% 57 889 0.00% 58 1116 0.01% 59 1266 0.01% 60 1443 0.01% 61 1759 0.01% 62 1961 0.01% 63 2158 0.01% 64 2440 0.01% 65 2661 0.01% 66 2700 0.01% 67 3243 0.01% 68 3525 0.02% 69 4142 0.02% 70 4967 0.02% 71 5398 0.02% 72 6336 0.03% 73 7266 0.03% 74 7973 0.04% 75 8770 0.04% 76 9570 0.04% 77 10414 0.05% 78 11257 0.05% 79 12887 0.06% 80 13812 0.06% 81 15916 0.07% 82 17601 0.08% 83 19669 0.09% 84 21376 0.10% 85 23209 0.10% 86 24358 0.11% 87 25709 0.12% 88 27525 0.12% 89 28248 0.13% 90 30802 0.14% 91 32808 0.15% 92 34742 0.16% 93 38204 0.17% 94 40767 0.18% 95 41359 0.19% 96 44084 0.20% 97 45395 0.20% 98 45882 0.21% 99 47858 0.21% 100 49989 0.22% 101 51409 0.23% 102 54081 0.24% 103 56208 0.25% 104 57585 0.26% 105 59864 0.27% 106 61054 0.27% 107 61437 0.28% 108 62482 0.28% 109 64187 0.29% 110 65432 0.29% 111 67252 0.30% 112 70073 0.31% 113 69269 0.31% 114 72967 0.33% 115 73954 0.33% 116 75215 0.34% 117 76867 0.35% 118 78273 0.35% 119 76939 0.35% 120 78037 0.35% 121 78707 0.35% 122 80193 0.36% 123 81458 0.37% 124 84600 0.38% 125 84265 0.38% 126 85113 0.38% 127 85970 0.39% 128 86364 0.39% 129 86597 0.39% 130 87877 0.39% 131 86711 0.39% 132 87847 0.39% 133 89335 0.40% 134 90008 0.40% 135 90458 0.41% 136 91660 0.41% 137 90598 0.41% 138 92460 0.42% 139 92898 0.42% 140 90892 0.41% 141 93313 0.42% 142 94932 0.43% 143 92979 0.42% 144 92876 0.42% 145 95742 0.43% 146 93635 0.42% 147 94401 0.42% 148 94948 0.43% 149 95327 0.43% 150 95745 0.43% 151 17454217 78.38% 22267869 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.3 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=224.12 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=19.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=33 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=149.96 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=20.7 sequence=CCGCCGCCGCCG SRR12951317 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:39:45 Started mapping on | Dec 07 11:39:45 Finished on | Dec 07 11:43:17 Mapping speed, Million of reads per hour | 378.13 Number of input reads | 22267869 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 20548430 Uniquely mapped reads % | 92.28% Average mapped length | 288.49 Number of splices: Total | 19275802 Number of splices: Annotated (sjdb) | 17806242 Number of splices: GT/AG | 18984112 Number of splices: GC/AG | 254125 Number of splices: AT/AC | 12353 Number of splices: Non-canonical | 25212 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.52 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207099 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 88575 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.61% % of reads unmapped: other | 1.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1512340 1512340 1512340 N_multimapping 207099 207099 207099 N_noFeature 1022874 19940401 1222066 N_ambiguous 474469 2816 65564 UnstrandedReadsAssigned:19051087 PositiveStrandReadsAssigned:605213 NegativeStrandReadsAssigned:19260800 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR12951317 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951317-trimmed-pair1.fastq SRR12951317-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,267,869 reads, 19,523,119 reads pseudoaligned [quant] estimated average fragment length: 239.653 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR12951317.ke.tsv 35125 SRR12951317.se.tsv 88098 total ==> SRR12951317.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.795 0 0 PNS24247 1044 805.347 160.519 15.3511 PNS24249 1928 1689.35 267.048 12.1749 PNS24246 1044 805.347 160.519 15.3511 PNS24248 1044 805.347 160.519 15.3511 PNS24244 1471 1232.35 154.395 9.64927 PNS24243 293 115.421 0 0 KQK14069 1603 1364.35 41520 2343.84 KQK14071 474 258.772 668.272 198.898 ==> SRR12951317.se.tsv <== BRADI_1g14170v3 44379 BRADI_1g53295v3 218 BRADI_1g59795v3 845 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 473 BRADI_1g74790v3 1230 BRADI_1g09890v3 0 BRADI_1g77505v3 254 BRADI_1g48960v3 0 SRR12951317 completed mapping pipeline successfully