Starting /dee2/code/volunteer_pipeline.sh SRR12951319 current disk space = 1542990823424 free memory = 1603301268 SRR12951319 SRAfilesize d907ffda346c27820b9a2ef9bb0bfc7c SRR12951319.sra SRR12951319.sra file validated SRR12951319 is paired end SRR12951319 is conventional basespace SRR12951319 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951319_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.559 37.0 37.0 37.0 37.0 37.0 2 36.32475 37.0 37.0 37.0 37.0 37.0 3 36.4805 37.0 37.0 37.0 37.0 37.0 4 36.568 37.0 37.0 37.0 37.0 37.0 5 36.594 37.0 37.0 37.0 37.0 37.0 6 36.614 37.0 37.0 37.0 37.0 37.0 7 36.485 37.0 37.0 37.0 37.0 37.0 8 36.587 37.0 37.0 37.0 37.0 37.0 9 36.5675 37.0 37.0 37.0 37.0 37.0 10-14 36.544200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.527100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4431 37.0 37.0 37.0 37.0 37.0 25-29 36.458000000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4588 37.0 37.0 37.0 37.0 37.0 35-39 36.453700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.37660000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.280899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3705 37.0 37.0 37.0 37.0 37.0 55-59 36.1742 37.0 37.0 37.0 37.0 37.0 60-64 36.0875 37.0 37.0 37.0 37.0 37.0 65-69 36.0799 37.0 37.0 37.0 37.0 37.0 70-74 36.112899999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.27909999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.243199999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.1942 37.0 37.0 37.0 37.0 37.0 90-94 36.256299999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.193200000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2352 37.0 37.0 37.0 37.0 37.0 105-109 36.21249999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1262 37.0 37.0 37.0 37.0 37.0 115-119 36.1922 37.0 37.0 37.0 37.0 37.0 120-124 36.060100000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.042899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9996 37.0 37.0 37.0 37.0 37.0 135-139 35.9686 37.0 37.0 37.0 37.0 37.0 140-144 35.8212 37.0 37.0 37.0 37.0 37.0 145-149 35.773700000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.64925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 1.0 23 2.0 24 5.0 25 3.0 26 4.0 27 10.0 28 9.0 29 24.0 30 37.0 31 40.0 32 31.0 33 81.0 34 143.0 35 278.0 36 2813.0 37 516.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.675 10.5 8.425 36.4 2 22.5182206584569 13.244533802462929 31.088213118874087 33.14903242020608 3 21.825 18.125 27.025 33.025 4 24.75 22.6 21.575 31.075000000000003 5 27.6 28.299999999999997 21.05 23.05 6 26.924999999999997 30.825000000000003 21.525 20.724999999999998 7 19.950000000000003 23.65 38.2 18.2 8 20.9 24.925 27.6 26.575 9 23.9 21.05 30.5 24.55 10-14 23.125 26.77 24.395 25.71 15-19 23.34 25.415 24.715 26.529999999999998 20-24 23.400000000000002 25.915 24.5 26.185000000000002 25-29 23.294999999999998 25.775 25.445 25.485000000000003 30-34 23.07 24.595 25.715 26.619999999999997 35-39 24.345 25.435000000000002 24.495 25.724999999999998 40-44 23.72 25.369999999999997 25.285000000000004 25.624999999999996 45-49 23.97 25.095 24.959999999999997 25.974999999999998 50-54 24.335 24.75 24.265 26.650000000000002 55-59 23.494999999999997 24.345 25.535000000000004 26.625 60-64 24.265 24.615000000000002 25.385 25.735000000000003 65-69 23.96 25.89 24.154999999999998 25.995 70-74 24.825 24.654999999999998 24.145 26.375 75-79 25.655 24.965 23.9 25.480000000000004 80-84 25.605 24.68 23.945 25.77 85-89 26.145000000000003 24.015 24.275 25.564999999999998 90-94 26.174999999999997 24.175 24.43 25.22 95-99 26.305 24.04 24.404999999999998 25.25 100-104 26.025 25.55 23.195 25.230000000000004 105-109 26.229999999999997 24.985 23.165 25.619999999999997 110-114 25.525 24.91 23.415 26.150000000000002 115-119 26.525 25.045 23.64 24.79 120-124 25.86 24.72 23.59 25.83 125-129 26.39 24.8 22.82 25.990000000000002 130-134 26.334999999999997 24.52 23.335 25.81 135-139 26.655 24.88 22.79 25.674999999999997 140-144 25.990000000000002 24.23 23.799999999999997 25.979999999999997 145-149 26.14 24.37 23.395 26.095000000000002 150-151 27.212500000000002 23.5375 23.25 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.5 27 1.5 28 2.5 29 7.5 30 10.0 31 11.5 32 14.5 33 22.0 34 26.0 35 32.5 36 51.0 37 65.5 38 76.0 39 95.5 40 128.0 41 147.0 42 155.0 43 160.0 44 152.0 45 162.0 46 184.5 47 175.5 48 174.0 49 176.0 50 154.5 51 146.0 52 141.5 53 123.5 54 108.5 55 101.5 56 78.0 57 72.5 58 88.5 59 77.0 60 54.5 61 59.0 62 68.0 63 62.0 64 66.0 65 77.0 66 83.5 67 71.0 68 56.5 69 53.0 70 40.5 71 33.5 72 33.5 73 32.5 74 23.5 75 16.0 76 14.5 77 10.0 78 8.5 79 5.5 80 2.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.7 #Duplication Level Percentage of deduplicated Percentage of total 1 82.71375464684016 66.75 2 13.289962825278812 21.45 3 3.004956629491945 7.2749999999999995 4 0.8364312267657992 2.7 5 0.09293680297397769 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.061957868649318466 1.4500000000000002 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTAGGTTATCTCGTAT 40 1.0 TruSeq Adapter, Index 22 (97% over 41bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTAGGTTATCGCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 22 (97% over 41bp) CACCGATATCCACATCCACAGCCCCTTGGACCACCCAATGGCCATCGACC 5 0.125 No Hit CTGCTTTATCTCCATGCCACCTGCATAGATGAGGAAGATAGGAAGATTGA 5 0.125 No Hit GCCACAAATAGAAGTTGTACAACAAAATTAATGCATCATGCACGAATCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.2875 0.0 0.0 0.0 0.0 92-93 1.5499999999999998 0.0 0.0 0.0 0.0 94-95 2.1 0.0 0.0 0.0 0.0 96-97 2.6125 0.0 0.0 0.0 0.0 98-99 2.9375 0.0 0.0 0.0 0.0 100-101 3.25 0.0 0.0 0.0 0.0 102-103 3.5 0.0 0.0 0.0 0.0 104-105 3.9250000000000003 0.0 0.0 0.0 0.0 106-107 4.5125 0.0 0.0 0.0 0.0 108-109 5.4625 0.0 0.0 0.0 0.0 110-111 6.1625 0.0 0.0 0.0 0.0 112-113 6.6125 0.0 0.0 0.0 0.0 114-115 7.525 0.0 0.0 0.0 0.0 116-117 8.412500000000001 0.0 0.0 0.0 0.0 118-119 9.3 0.0 0.0 0.0 0.0 120-121 10.0875 0.0 0.0 0.0 0.0 122-123 10.7375 0.0 0.0 0.0 0.0 124-125 11.4375 0.0 0.0 0.0 0.0 126-127 12.0375 0.0 0.0 0.0 0.0 128-129 12.65 0.0 0.0 0.0 0.0 130-131 13.399999999999999 0.0 0.0 0.0 0.0 132-133 14.15 0.0 0.0 0.0 0.0 134-135 15.024999999999999 0.0 0.0 0.0 0.0 136-137 15.9125 0.0 0.0 0.0 0.0 138-139 16.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTTG 10 0.006830828 145.0 9 ATAAACA 10 0.006830828 145.0 4 AACAACA 35 0.0033124194 62.14286 7 >>END_MODULE SRR12951319 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951319_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2595 37.0 37.0 37.0 37.0 37.0 2 36.125 37.0 37.0 37.0 37.0 37.0 3 35.979 37.0 37.0 37.0 37.0 37.0 4 36.0735 37.0 37.0 37.0 37.0 37.0 5 36.1735 37.0 37.0 37.0 37.0 37.0 6 36.1795 37.0 37.0 37.0 37.0 37.0 7 36.0495 37.0 37.0 37.0 37.0 37.0 8 36.0525 37.0 37.0 37.0 37.0 37.0 9 36.0345 37.0 37.0 37.0 37.0 37.0 10-14 36.041399999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.9802 37.0 37.0 37.0 37.0 37.0 20-24 35.8503 37.0 37.0 37.0 37.0 37.0 25-29 35.7636 37.0 37.0 37.0 37.0 37.0 30-34 35.6564 37.0 37.0 37.0 37.0 37.0 35-39 35.680600000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.7033 37.0 37.0 37.0 37.0 37.0 45-49 35.60600000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.5784 37.0 37.0 37.0 37.0 37.0 55-59 35.607299999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.6064 37.0 37.0 37.0 37.0 37.0 65-69 35.6446 37.0 37.0 37.0 37.0 37.0 70-74 35.5575 37.0 37.0 37.0 37.0 37.0 75-79 35.4054 37.0 37.0 37.0 37.0 37.0 80-84 35.4473 37.0 37.0 37.0 37.0 37.0 85-89 35.511799999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.6582 37.0 37.0 37.0 37.0 37.0 95-99 35.6092 37.0 37.0 37.0 37.0 37.0 100-104 35.6095 37.0 37.0 37.0 37.0 37.0 105-109 35.571 37.0 37.0 37.0 37.0 37.0 110-114 35.5104 37.0 37.0 37.0 37.0 37.0 115-119 35.5315 37.0 37.0 37.0 37.0 37.0 120-124 35.452 37.0 37.0 37.0 37.0 37.0 125-129 35.2233 37.0 37.0 37.0 34.6 37.0 130-134 35.0343 37.0 37.0 37.0 32.2 37.0 135-139 34.9463 37.0 37.0 37.0 25.0 37.0 140-144 34.6571 37.0 37.0 37.0 25.0 37.0 145-149 34.4613 37.0 37.0 37.0 25.0 37.0 150-151 34.08725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 9.0 14 7.0 15 11.0 16 2.0 17 1.0 18 5.0 19 8.0 20 3.0 21 6.0 22 4.0 23 16.0 24 14.0 25 16.0 26 9.0 27 10.0 28 33.0 29 24.0 30 42.0 31 46.0 32 65.0 33 103.0 34 219.0 35 564.0 36 2524.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.875 18.875 11.600000000000001 26.650000000000002 2 31.374999999999996 20.3 25.0 23.325000000000003 3 28.625 22.675 26.125 22.575 4 30.575000000000003 29.45 18.925 21.05 5 29.675 28.549999999999997 20.0 21.775 6 26.674999999999997 31.65 20.05 21.625 7 24.125 18.4 33.225 24.25 8 25.025 22.625 22.925 29.425 9 26.325 22.45 24.875 26.35 10-14 28.249999999999996 24.415 22.435 24.9 15-19 28.355000000000004 23.355 23.05 25.240000000000002 20-24 27.57 24.145 23.51 24.775 25-29 27.894999999999996 23.82 23.565 24.72 30-34 27.82 24.08 23.705000000000002 24.395 35-39 27.76 24.73 22.915 24.595 40-44 27.74 24.58 23.119999999999997 24.560000000000002 45-49 27.705000000000002 23.580000000000002 24.035 24.68 50-54 27.99 23.715 23.880000000000003 24.415 55-59 27.595 24.37 23.125 24.91 60-64 27.935 24.54 23.255 24.27 65-69 28.005000000000003 23.580000000000002 23.674999999999997 24.740000000000002 70-74 27.42 24.435000000000002 23.865 24.279999999999998 75-79 26.640000000000004 24.310000000000002 24.165 24.884999999999998 80-84 27.860000000000003 23.775 24.135 24.23 85-89 28.26 24.42 22.925 24.395 90-94 27.825 24.215 24.08 23.880000000000003 95-99 28.4 24.895 23.145 23.56 100-104 28.044999999999998 25.064999999999998 23.105 23.785 105-109 28.804999999999996 25.09 22.58 23.525 110-114 29.054999999999996 24.67 23.41 22.865 115-119 28.98 25.790000000000003 22.27 22.96 120-124 29.525000000000002 25.235000000000003 22.68 22.56 125-129 30.270000000000003 24.25 22.685 22.795 130-134 31.345 24.355 21.97 22.33 135-139 31.56 23.665 23.25 21.525 140-144 32.425 23.97 22.445 21.16 145-149 33.629999999999995 23.885 21.44 21.044999999999998 150-151 34.125 23.724999999999998 22.675 19.475 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 1.5 7 1.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 1.0 14 0.5 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 3.5 26 2.5 27 2.0 28 4.5 29 4.5 30 3.5 31 9.0 32 13.5 33 15.5 34 27.0 35 39.0 36 45.0 37 49.5 38 60.5 39 80.5 40 99.5 41 122.0 42 136.0 43 142.5 44 154.0 45 153.5 46 149.5 47 164.5 48 183.0 49 178.0 50 157.0 51 143.0 52 130.0 53 118.0 54 100.5 55 93.5 56 100.0 57 80.5 58 66.0 59 75.5 60 84.0 61 88.0 62 81.0 63 69.0 64 61.5 65 57.5 66 59.5 67 65.0 68 62.0 69 56.0 70 54.5 71 51.0 72 44.0 73 33.0 74 29.5 75 25.5 76 17.0 77 13.5 78 15.0 79 10.5 80 5.0 81 4.0 82 4.0 83 3.0 84 1.0 85 1.5 86 1.5 87 1.0 88 1.0 89 1.5 90 2.5 91 1.5 92 1.0 93 2.0 94 1.5 95 3.0 96 2.5 97 1.0 98 3.0 99 6.0 100 28.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.6 #Duplication Level Percentage of deduplicated Percentage of total 1 83.63970588235294 68.25 2 12.683823529411764 20.7 3 2.8186274509803924 6.9 4 0.7046568627450981 2.3 5 0.12254901960784313 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.030637254901960783 1.35 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 54 1.35 No Hit GGAAAATGCTGGAAAGATGGAGGAACAAACGGAAGAGAAACAAGACAAAA 5 0.125 No Hit GAAATCTTCTCCCAGGGGAGCTAAATCTCGAGCGGCGGCGCCATGTTGGT 5 0.125 No Hit CGTGCTCGTCCAAGGGGGGCGCCGTACAGGGAGATGAGTTCTTCTTTCAC 5 0.125 No Hit GTGCCGGTTTCTCCGGGCACGGGTTTAAGATGGGCCCGGCTGTCGGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7124999999999999 0.0 0.0 0.0 0.0 88-89 0.8999999999999999 0.0 0.0 0.0 0.0 90-91 1.2625 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 2.075 0.0 0.0 0.0 0.0 96-97 2.5875 0.0 0.0 0.0 0.0 98-99 2.9125 0.0 0.0 0.0 0.0 100-101 3.2 0.0 0.0 0.0 0.0 102-103 3.4375 0.0 0.0 0.0 0.0 104-105 3.85 0.0 0.0 0.0 0.0 106-107 4.4375 0.0 0.0 0.0 0.0 108-109 5.3625 0.0 0.0 0.0 0.0 110-111 6.0375 0.0 0.0 0.0 0.0 112-113 6.5125 0.0 0.0 0.0 0.0 114-115 7.4 0.0 0.0 0.0 0.0 116-117 8.3 0.0 0.0 0.0 0.0 118-119 9.162500000000001 0.0 0.0 0.0 0.0 120-121 9.925 0.0 0.0 0.0 0.0 122-123 10.575 0.0 0.0 0.0 0.0 124-125 11.2875 0.0 0.0 0.0 0.0 126-127 11.8875 0.0 0.0 0.0 0.0 128-129 12.5625 0.0 0.0 0.0 0.0 130-131 13.350000000000001 0.0 0.0 0.0 0.0 132-133 14.075 0.0 0.0 0.0 0.0 134-135 14.95 0.0 0.0 0.0 0.0 136-137 15.825 0.0 0.0 0.0 0.0 138-139 16.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATG 10 0.006830828 145.0 6 GCAAATG 10 0.006830828 145.0 3 >>END_MODULE Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597374 spots for SRR12951319.sra Written 1597374 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra Read 1597364 spots for SRR12951319.sra Written 1597364 spots for SRR12951319.sra SRR ids: ['SRR12951319.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_curk_wv3 SRR12951319.sra spots: 31947290 blocks: [[1, 1597364], [1597365, 3194728], [3194729, 4792092], [4792093, 6389456], [6389457, 7986820], [7986821, 9584184], [9584185, 11181548], [11181549, 12778912], [12778913, 14376276], [14376277, 15973640], [15973641, 17571004], [17571005, 19168368], [19168369, 20765732], [20765733, 22363096], [22363097, 23960460], [23960461, 25557824], [25557825, 27155188], [27155189, 28752552], [28752553, 30349916], [30349917, 31947290]] SRR12951319 file size 10835386 SRR12951319 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951319 SRR12951319_1.fastq SRR12951319_2.fastq Input file: SRR12951319_1.fastq Paired file: SRR12951319_2.fastq trimmed: SRR12951319-trimmed-pair1.fastq, SRR12951319-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:43:13 2024 >> started Sat Dec 7 11:43:50 2024 >> done (36.806s) 31947290 read pairs processed; of these: 306 ( 0.00%) short read pairs filtered out after trimming by size control 405857 ( 1.27%) empty read pairs filtered out after trimming by size control 31541127 (98.73%) read pairs available; of these: 6723194 (21.32%) trimmed read pairs available after processing 24817933 (78.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 14 0.00% 20 28 0.00% 21 32 0.00% 22 29 0.00% 23 36 0.00% 24 38 0.00% 25 44 0.00% 26 41 0.00% 27 50 0.00% 28 59 0.00% 29 61 0.00% 30 88 0.00% 31 81 0.00% 32 104 0.00% 33 95 0.00% 34 87 0.00% 35 106 0.00% 36 124 0.00% 37 150 0.00% 38 210 0.00% 39 181 0.00% 40 379 0.00% 41 269 0.00% 42 270 0.00% 43 298 0.00% 44 297 0.00% 45 353 0.00% 46 360 0.00% 47 436 0.00% 48 482 0.00% 49 688 0.00% 50 793 0.00% 51 837 0.00% 52 904 0.00% 53 1088 0.00% 54 1108 0.00% 55 1200 0.00% 56 1270 0.00% 57 1494 0.00% 58 2023 0.01% 59 2199 0.01% 60 2968 0.01% 61 3016 0.01% 62 3221 0.01% 63 3716 0.01% 64 3836 0.01% 65 4106 0.01% 66 4389 0.01% 67 4878 0.02% 68 5758 0.02% 69 6474 0.02% 70 7288 0.02% 71 8970 0.03% 72 9909 0.03% 73 11314 0.04% 74 12420 0.04% 75 13159 0.04% 76 14138 0.04% 77 14942 0.05% 78 16484 0.05% 79 18504 0.06% 80 20307 0.06% 81 23012 0.07% 82 26022 0.08% 83 28952 0.09% 84 30861 0.10% 85 33382 0.11% 86 34240 0.11% 87 35837 0.11% 88 38022 0.12% 89 39772 0.13% 90 43476 0.14% 91 46504 0.15% 92 50159 0.16% 93 54588 0.17% 94 58324 0.18% 95 60225 0.19% 96 61556 0.20% 97 62099 0.20% 98 63076 0.20% 99 65815 0.21% 100 67919 0.22% 101 71027 0.23% 102 75204 0.24% 103 78791 0.25% 104 82018 0.26% 105 84335 0.27% 106 85631 0.27% 107 84685 0.27% 108 86234 0.27% 109 86669 0.27% 110 89003 0.28% 111 91835 0.29% 112 95461 0.30% 113 98209 0.31% 114 103003 0.33% 115 104416 0.33% 116 104512 0.33% 117 105668 0.34% 118 104721 0.33% 119 105158 0.33% 120 105081 0.33% 121 107105 0.34% 122 109169 0.35% 123 113366 0.36% 124 117395 0.37% 125 117757 0.37% 126 120360 0.38% 127 119800 0.38% 128 119154 0.38% 129 119468 0.38% 130 117970 0.37% 131 118213 0.37% 132 120400 0.38% 133 123585 0.39% 134 126504 0.40% 135 128855 0.41% 136 131031 0.42% 137 129466 0.41% 138 128648 0.41% 139 128305 0.41% 140 127085 0.40% 141 127576 0.40% 142 129191 0.41% 143 128998 0.41% 144 133083 0.42% 145 134319 0.43% 146 135703 0.43% 147 135654 0.43% 148 135374 0.43% 149 133546 0.42% 150 132388 0.42% 151 24817933 78.68% 31541127 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=21.93 fanout-score-rank=7 prefix-density=0.21 prefix-fanout=21.9 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTAGGTTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=300.12 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=31.6 sequence=CTTCTTCTTCTGCTCCGGGGTGAACTCCGGC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=37 prefix-density=0.70 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=211.78 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=21.3 sequence=CGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR12951319 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:44:42 Started mapping on | Dec 07 11:44:42 Finished on | Dec 07 11:48:08 Mapping speed, Million of reads per hour | 551.20 Number of input reads | 31541127 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 29320726 Uniquely mapped reads % | 92.96% Average mapped length | 287.96 Number of splices: Total | 26617893 Number of splices: Annotated (sjdb) | 24507970 Number of splices: GT/AG | 26216032 Number of splices: GC/AG | 342903 Number of splices: AT/AC | 18258 Number of splices: Non-canonical | 40700 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268040 % of reads mapped to multiple loci | 0.85% Number of reads mapped to too many loci | 37569 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.49% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1952361 1952361 1952361 N_multimapping 268040 268040 268040 N_noFeature 1468696 28452382 1775336 N_ambiguous 654803 3981 93121 UnstrandedReadsAssigned:27197227 PositiveStrandReadsAssigned:864363 NegativeStrandReadsAssigned:27452269 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR12951319 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951319-trimmed-pair1.fastq SRR12951319-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,541,127 reads, 28,073,450 reads pseudoaligned [quant] estimated average fragment length: 231.238 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR12951319.ke.tsv 35125 SRR12951319.se.tsv 88098 total ==> SRR12951319.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 706.205 0 0 PNS24247 1044 813.762 209.688 13.6074 PNS24249 1928 1697.76 541.609 16.8463 PNS24246 1044 813.762 209.688 13.6074 PNS24248 1044 813.762 209.688 13.6074 PNS24244 1471 1240.76 164.326 6.99384 PNS24243 293 116.002 1 0.455231 KQK14069 1603 1372.76 66252.7 2548.62 KQK14071 474 262.226 1595.41 321.288 ==> SRR12951319.se.tsv <== BRADI_1g14170v3 70304 BRADI_1g53295v3 393 BRADI_1g59795v3 1201 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 644 BRADI_1g74790v3 1979 BRADI_1g09890v3 0 BRADI_1g77505v3 310 BRADI_1g48960v3 0 SRR12951319 completed mapping pipeline successfully